CN111437391A - Application of knock-down circHECTD1 in preparation of drug for treating glioma - Google Patents

Abstract

The invention discloses a new medical application of knocking down circHECTD1, in particular to an application of knocking down circHECTD1 in preparing a medicament for treating glioma. The invention proves that knocking down circHECTD1 can inhibit the proliferation (P < 0.05) and migration (P < 0.05) of glioma cells in vitro through in vitro proliferation and migration experiments; furthermore, in vivo tumor formation experiments show that the knock-down circHECTD1 can inhibit the growth of glioma in vivo, and the weight of glioma with low expression of circHECTD1 is obviously lighter than that of glioma with normal expression of circHECTD 1. Therefore, the knockdown circHECTD1 can be used for preparing a medicament for treating glioma and has good application prospect.

Description

Application of knock-down circHECTD1 in preparation of drug for treating glioma

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of knocking-down circHECTD1 in preparation of a medicine for treating glioma.

Background

Gliomas are a common primary brain tumor, and there are many types, including astrocytomas, oligodendrogliomas, ependymomas, etc., among which glioblastoma multiforme (GBM) is the most common malignant tumor of the central nervous system, accounting for more than 80% of malignant brain tumors. High mortality, high relapse rate, and short overall survival time are typical features of GBM. The diffuse invasiveness and high metastasis of GBM make the GBM unable to be completely removed by surgery, and although a method combining surgery, radiotherapy and chemotherapy can be adopted, the median survival time of GBM patients is still short and is only 12-15 months. Therefore, other therapeutic strategies including immunotherapy and gene therapy are becoming important research directions.

Circular RNA (circular RNA) is an endogenous non-coding RNA, is a single-stranded RNA with a closed circular structure, and is widely present in mammalian cells. The CircRNAs have miRNAs binding sites which are the same as target genes of microRNAs (miRNAs for short), can play a role of miRNAs sponge, relieve the inhibition effect of the miRNAs on the target gene expression thereof by a competitive mechanism, and increase the expression level of the target genes. Many studies have shown that circRNAs play an important role in the development of tumors by interacting with miRNAs or transcription factors to regulate gene expression.

Based on the background, if the key circRNAs influencing the occurrence and development of glioma can be found, the circular RNAs can possibly become a new target point for treating glioma, and a breakthrough is brought to the treatment of glioma.

Disclosure of Invention

The invention aims to provide a new medical application of knocking down circHECTD1, and particularly relates to an application of knocking down circHECTD1 in preparation of a drug for treating glioma.

The technical scheme is as follows:

in order to achieve the purpose, the invention adopts the following technical scheme:

use of knockdown circHECTD1 in the preparation of a medicament for the treatment of glioma, wherein the RNA sequence of circHECTD1 is: GUCAACUGCAACGUGGCCACUUGACCCAGCAAAGGAUGAAAAACAAGGAUGGCGGCAUGUGAGGCUGAAGCAGAUGGGAAAGAACGCAAGCGGACAGACACACUACCUCUCCCUCUCUGGCUUUGAGCUCUAUGGCACUGUAAAUGGCGUGUGUGAAGACCAACUCGGGAAAGCAGCUAAAGAAGCAGAAGCUAAUCUUAGAAGGCAGAGGCGCCUGGUGCGUUCUCAAGUCCUGAAGUACAUGGUUCCAGGAGCACGUGUUAUCAGAGGCCUUGACUGGAAGUGGCGAGAUCAGGAUGGCAGCCCACAGGGAGAAGGCACAGUCACAGGAGAGCUGCACAAUG are provided.

Further, knock-down circHECTD1 inhibited glioma growth.

Further, knock-down circHECTD1 inhibited the proliferation and migration of glioma cells.

The application also discloses application of the agent capable of knocking down circHECTD1 in preparation of a medicament for treating glioma.

Further, the agent capable of knocking down circHECTD1 comprises a lentivirus expressing a short hairpin rna (shrna).

Further, the agent capable of knocking down circHECTD1 comprises one or more of a direct chemically synthesized single-stranded small interfering RNA (siRNA), a plasmid expressing short hairpin RNA (shRNA) and a viral vector.

Has the advantages that: the invention proves that knocking down circHECTD1 can inhibit the proliferation (P < 0.05) and migration (P < 0.05) of glioma cells in vitro through in vitro proliferation and migration experiments; furthermore, in vivo tumor formation experiments show that the knock-down circHECTD1 can inhibit the growth of glioma in vivo, and the weight of glioma with low expression of circHECTD1 is obviously lighter than that of glioma with normal expression of circHECTD 1. Therefore, the knockdown circHECTD1 can be used for preparing a medicament for treating glioma and has good application prospect.

Drawings

FIG. 1 is a graph showing the results of the proliferation assay in example 1. Wherein: a is the EdU doping experiment result 48 hours after the C6 cell line stably expressing sh-NC or sh-circHECTD1 is cultured in vitro, Hoechst stains nuclei, and a ruler =200 microns; b is the statistics of the fraction of EdU positive cells (mean ± sem, × P < 0.001); c is the flow cell cycle result 24 hours after the C6 cell line stably expressing sh-NC or sh-circHECTD1 is cultured in vitro; d is the statistics of the proportion of cells at S + G2 phase (mean ± sem,. P < 0.001).

FIG. 2 is a graph showing the results of the migration test in example 2. Wherein: a is the result of a Trans-well experiment 24 hours after in vitro culture of a C6 cell line stably expressing sh-NC or sh-circHECTD1, with scale =200 μm; b is the cell count through the chamber (mean ± sem, × P < 0.001); c is scratch test results 0, 24, 48 and 72 hours after culture and fabrication of scratches for C6 cell lines stably expressing sh-NC or sh-circHECTD1, scale =400 μm; d is the score healing rate statistic (mean ± sem,. P < 0.001).

FIG. 3 is a graph showing the results of an in vivo tumor formation experiment in example 3. Wherein: a is a photograph of nude mice 3 weeks after transplantation of C6 cells normally expressing or low expressing circHECTD1 and a photograph of tumor taken out; b is the statistics of tumor weight (mean ± sem,. P < 0.05).

Detailed Description

The following examples are provided to illustrate specific embodiments of the present invention. It should be emphasized that these examples are only intended to illustrate the present invention and are not intended to limit the scope of the present invention.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. These techniques are fully described in the following documents: for example, Sambrook molecular cloning, A laboratory Manual, 2 nd edition (1989); DNA cloning, volumes I and II (D.N. Glover editor 1985); oligonucleotide Synthesis (M.J. Gait eds., 1984); nucleic acid hybridization (B.D. Hames and S.J. Higgins eds. 1984); protein purification: principles and practice, 2 nd edition (Springer-Verlag, N. Y.), and A handbook of Experimental immunology, volumes I-IV (D. C. Weir and C. C. Blackwell, eds. 1986). Alternatively, the procedure may be followed according to the instructions provided by the reagent manufacturer.

The rat glioma cell line C6 was used for in vitro proliferation and migration experiments, and immunodeficient BA L B/C nude mice were used for in vivo tumorigenesis experiments.

According to the invention, lentiviruses expressing sh-NC or sh-circHECTD1 are respectively infected with C6 cells and then screened to obtain a C6 cell line stably and normally expressing or expressing circHECTD1 at a low level, and the C6 cells are cultured in vitro and whether the proliferation and migration of the C6 cells are changed or not is observed.

According to the invention, lentiviruses expressing sh-NC or sh-circHECTD1 are respectively infected with C6 cells and then screened to obtain a C6 cell line stably and normally expressing or expressing circHECTD1 at a low level, the cell line is injected into the skin of a nude mouse to carry out a tumor formation experiment, and the growth conditions of tumors under two conditions are observed.

The invention may be practiced in a variety of ways to administer to a subject: injecting slow virus expressing sh-circHECTD1, injecting liposome-coated circHECTD1 siRNA, etc.

The rat glioma cell line C6 used in the following examples was obtained from the American type cell preservation center (ATCC) and cultured in 5% CO₂In a 37-degree incubator, the culture medium was DMEM (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin.

The lentiviruses expressing sh-NC or sh-circHECTD1 in the following examples are from GmbH, Shanghai.

Lentiviral message expressing sh-circHECTD 1:

carrier name: GV 248;

the element sequence is as follows: hU 6-MCS-Ubiquitin-EGFP-IRES-puromycin;

target sequence: GAGAGCTGCACAATGTCAAGCACAATGTCAACTGCAACGGAGAGCTGCACAATGTCA are provided.

Example 1

Proliferation detection: 5-ethynyl-2' -deoxyuridine (EdU) incorporation assay, flow assay cell cycle

1. Constructing a C6 cell line for stably expressing sh-NC or sh-circHECTD 1: c6 cells were plated onto 24-well plates (2X 10)⁴Cell/well), when 80% of the cell is full, lentivirus expressing sh-NC or sh-circHECTD1 is infected, fresh culture solution is changed 12 hours after infection, fresh culture solution containing 2 microgram/milliliter puromycin is changed 72 hours after infection for screening, and the screened cell is subjected to circHECTD1 expression detection, so that the establishment of a C6 cell line of normally expressed or low expressed circHECTD1 is proved to be successful.

2. EdU incorporation experiments: EdU is a thymidine analog that can be incorporated into replicating DNA molecules and thus can be used to detect cellular DNA replication activity. C6 cells stably expressing sh-NC or sh-circHECTD1 were seeded onto 24-well plates (2X 104 cells/well), cultured in vitro for 48 hours, EdU was added to the cell culture broth (final concentration 50. mu. mol), incubated at 37 ℃ for 2 hours, and the EdU-positive cell ratio was obtained by counting the number of positive signal cells and the total number of cells for at least 3 fields, as per the EdU assay kit instructions.

As shown in FIGS. 1A-B, sh-circHECTD1 significantly reduced the proportion of EdU-positive cells, indicating that cellular DNA replication, i.e., proliferation, was inhibited.

3. Flow detection of cell cycle: c6 cells stably expressing sh-NC or sh-circHECTD1 were cultured in vitro for 48 hours, C6 cells were collected by digestion with 0.25% pancreatin, washed with precooled PBS, fixed with precooled 75% ethanol for 24 hours, stained with Pharmingen PI/RNase stain from BD company for 30 minutes, and finally cell cycle distribution was examined by a flow cytometer.

As shown in FIGS. 1C-D, sh-circHECTD1 can significantly reduce the proportion of cells in S phase (DNA replication phase) + G2 phase (late phase of DNA synthesis), i.e., can inhibit cell proliferation.

Example 2

Migration detection: trans-well experiment and scratch experiment

1. Trans-well experiments: mix 3x10⁴C6 cells stably expressing sh-NC or sh-circHECTD1 were seeded on the upper layer of a Tran-well chamber (Corning Co.) and cultured in serum-free DMEM, 600. mu.l of DMEM containing 10% fetal bovine serum was added to the lower layer of the chamber, and after 24 hours, the cells on the upper layer were removed, and the cells migrated to the lower layer were fixed with 4% paraformaldehyde and stained with 0.2% crystal violet, and the number of migrated cells was counted.

As shown in FIGS. 2A-B, the sh-circHECTD1 group migrated significantly less C6 cells than the control group, demonstrating that knock-down circHECTD1 could inhibit cell migration.

2. Scratch test: c6 cells stably expressing sh-NC or sh-circHECTD1 are planted into a 6-well plate, DMEM containing 5% fetal calf serum is used for culturing for 24 hours, a 1 ml sterile gun head is used for marking a trace in the cells, PBS is used for washing three times to remove floating cells, DMEM containing 1% fetal calf serum is added for culturing, pictures are taken at 0 hour, 24 hour, 48 hour and 72 hour after scratching, the scratching distance is measured, the proportion of the scratching healing distance to the original scratching distance is calculated, and the scratching healing condition is revealed.

As shown in fig. 2C-D, the sh-circHECTD1 group had slower healing of the scratch than the control group, demonstrating that knock-down of circHECTD1 could inhibit cell migration.

Example 3

C6 cell injection tumor of stable expression sh-NC or sh-circHECTD1

1. The tumor formation experiment is carried out on immunodeficient BAB L/C nude mice (week age is 4-6 weeks), the nude mice are randomly divided into 2 groups, after anesthesia, 200 microliter of C6 cells with normal expression or low expression circHECTD1 are respectively injected subcutaneously on the right back, after 3 weeks, the tumor of the injection part of the nude mice is taken out, and the tumor is taken and weighed.

As shown in fig. 3A-B, injection of C6 cells, which underexpress circHECTD1, produced smaller and lighter tumors than the control group, demonstrating that knockdown of circHECTD1 can inhibit glioma growth.

Sequence listing

<110> university of southeast Tong

Application of <120> knock-down circHECTD1 in preparation of drug for treating glioma

<160>2

<170>SIPOSequenceListing 1.0

<210>2

<211>344

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

gucaacugca acguggccac uugacccagc aaaggaugaa aaacaaggau ggcggcaugu 60

gaggcugaag cagaugggaa agaacgcaag cggacagaca cacuaccucu cccucucugg 120

cuuugagcuc uauggcacug uaaauggcgu gugugaagac caacucggga aagcagcuaa 180

agaagcagaa gcuaaucuua gaaggcagag gcgccuggug cguucucaag uccugaagua 240

caugguucca ggagcacgug uuaucagagg ccuugacugg aaguggcgag aucaggaugg 300

cagcccacag ggagaaggca cagucacagg agagcugcac aaug 344

<210>2

<211>57

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

gagagctgca caatgtcaag cacaatgtca actgcaacgg agagctgcac aatgtca 57

Claims (6)

1. The application of the knock-down circHECTD1 in preparing the drug for treating glioma is characterized in that: the RNA sequence of circHECTD1 is: GUCAACUGCAACGUGGCCACUUGACCCAGCAAAGGAUGAAAAACAAGGAUGGCGGCAUGUGAGGCUGAAGCAGAUGGGAAAGAACGCAAGCGGACAGACACACUACCUCUCCCUCUCUGGCUUUGAGCUCUAUGGCACUGUAAAUGGCGUGUGUGAAGACCAACUCGGGAAAGCAGCUAAAGAAGCAGAAGCUAAUCUUAGAAGGCAGAGGCGCCUGGUGCGUUCUCAAGUCCUGAAGUACAUGGUUCCAGGAGCACGUGUUAUCAGAGGCCUUGACUGGAAGUGGCGAGAUCAGGAUGGCAGCCCACAGGGAGAAGGCACAGUCACAGGAGAGCUGCACAAUG are provided.

2. Use according to claim 1, characterized in that: the knockdown circHECTD1 inhibited glioma growth.

3. Use according to claim 1, characterized in that: the knockdown circHECTD1 inhibits the proliferation and migration of glioma cells.

4. Application of an agent capable of knocking down circHECTD1 in preparation of a medicament for treating glioma.

5. Use according to claim 4, characterized in that: the agent capable of knocking down circHECTD1 comprises a lentivirus expressing a short hairpin rna (shrna).

6. Use according to claim 5, characterized in that: the agent capable of knocking down circHECTD1 comprises one or more of direct chemically synthesized single-stranded small interfering RNA (siRNA), plasmid expressing short hairpin RNA (shRNA) and viral vector.

Images