CN111424038A - Cymbidium CgWRKY40 gene and application thereof - Google Patents
Cymbidium CgWRKY40 gene and application thereof Download PDFInfo
- Publication number
- CN111424038A CN111424038A CN202010298688.1A CN202010298688A CN111424038A CN 111424038 A CN111424038 A CN 111424038A CN 202010298688 A CN202010298688 A CN 202010298688A CN 111424038 A CN111424038 A CN 111424038A
- Authority
- CN
- China
- Prior art keywords
- cgwrky40
- gene
- column
- cymbidium
- ser
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Physiology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a Chinese cymbidiumCgWRKY40A coding gene and an application thereof,CgWRKY40the nucleotide sequence of the gene is shown as SEQ ID NO.1, and the amino acid sequence of the expressed protein is shown as SEQ ID NO. 2. The invention relates to a cymbidium goeringii cultivated variety 'Songmei'CgWRKY40Cloning and identification of genes, analysis of gene expression, and verification of their function, discoveryCgWRKY40Compared with WT, the transgenic plant has obviously larger and more leaves, is accompanied by obvious macroscopic character hair, has vigorous vegetative growth,and flowering is later than that of wild Arabidopsis thaliana, which showsCgWRKY40Promotes the vegetative growth of the transgenic plant, thereby delaying the flowering, and the gene can be widely used in the aspect of orchid character improvement.
Description
Technical Field
The invention belongs to the technical field of plant genetic engineering, and particularly relates to cymbidium goeringiiCgWRKY40Genes and their use.
Background
The orchid family (Orchidaceae) is one of the largest of the flowering plants, and contains 25000 or more species worldwide, accounting for about 10% of all flowering plants. Goering cymbidium (A. fern)Cymbidium goeringii) Belongs to the species of floret type Geshenlan in orchid family, and has peculiar flower type, light flower color, delicate flower fragrance, beautiful leaf appearance and high ornamental value and economic value. The cymbidium goeringii has high requirements on the growth environment, is very easily influenced by severe environments such as high temperature, low temperature, drought and the like in the growth process, and can cause the reduction of the ornamental quality of gardening and even the death of plants in severe cases. Therefore, the research on the molecular mechanism of plants for coping with abiotic stress and the identification of genes with stress resistance function are of great significance to the breeding and production of cymbidium goeringii. In a plant cell signal transduction pathway, the WRKY transcription factor is considered as a key pivot of plant growth and various stress responses, and provides an important basis for genetic improvement of plants.
WRKY transcription factors are one of the largest families of regulatory proteins in plants, involved in a variety of physiological processes, the most prominent of which are stress responses to biotic and abiotic stresses. The WRKY gene is reported to enhance the tolerance of plants to adversity stress. The sunflower HaWRKY76 transgenic plant shows stronger stress resistance to waterlogging stress, and the yield is also obviously increased.AtWRKY25The overexpression of (a) enhances the salt tolerance of Arabidopsis thaliana.AtWRKY57The over-expression in rice not only improves the drought resistance of rice, but also enhances the tolerance of the rice to salt and PEG. Therefore, it is obtained by cloning from cymbidium goeringii by using genetic engineering technologyCgWRKY40The gene has obvious expression difference under ABA stress, so the gene will be expressedCgWRKY40The gene is transferred into plants, and has great application prospect.
Different plants have different gene sequences even if they are of the same gene family, and even if more than 80% of the gene sequences are identical, the functions of transferring some genes into plants are different because of different insertion sites. When a foreign gene enters a chromosome, a foreign protein encoded by the gene is generated, the foreign protein or enzyme causes the activity of other enzymes or proteins to be enhanced or reduced through a series of reactions, and when the foreign gene is embedded in a certain segment of the chromosome, the whole chromosome is influenced, so that the activity or the regulation mechanism of other genes is influenced.
Even if the same gene is inserted, the same gene is inevitably influenced on the chromosome due to different insertion sites or different chromosome groups, and further influences the gene on the chromosome, and slight changes of the gene can influence the regulation mechanism, so that the changes of gene inactivation, activity reduction, activity enhancement and the like can be caused, and the gene action is different, and the gene action can be obtained only by verification and can not be obtained by inference.
Disclosure of Invention
The purpose of the invention is as follows: aiming at the defects in the prior breeding technology, the invention aims to provide the cymbidium goeringiiCgWRKY40A gene. Another object of the present invention is to provide cymbidium goeringiiCgWRKY40The application of the gene in orchid breeding.
The technical scheme is as follows: in order to achieve the purpose of the invention, the technical scheme adopted by the invention is as follows:
a kind of Chinese cymbidiumCgWRKY40The nucleotide sequence of the gene is shown in SEQ ID NO. 1.
The cymbidium goeringiiCgWRKY40The amino acid sequence of the gene expression protein is shown in SEQ ID NO. 2.
The cymbidium goeringiiCgWRKY40The use of genes in plant production and breeding.
Contains the cymbidium goeringiiCgWRKY40A vector for the gene.
Contains the cymbidium goeringiiCgWRKY40A host cell for the gene.
Has the advantages that: compared with the prior art, the invention has the advantages that the cymbidium goeringii is treatedCgWRKY40Cloning and identification of gene, expression analysis of gene, verification of its function, finding over-expressionCgWRKY40Mimicry of genesThe Arabidopsis plants are in the seedling stage,CgWRKY40compared with WT, the transgenic plant has obviously larger and more leaves, is accompanied by obvious macroscopic character hair, has vigorous vegetative growth and flowers later than wild Arabidopsis thaliana, and shows thatCgWRKY40Promotes the vegetative growth of transgenic plants, thereby delaying the flowering, and the gene has wide application in the production and breeding of orchids and other plants.
Drawings
FIG. 1 is cymbidium goeringiiCgWRKY40Gene cloning and constructed over-expression vector map;
in FIG. 2, a isCgWRKY40Expression in various tissues of cymbidium goeringii, wherein R represents root, P represents pseudobulb, L represents leaf, F represents flower, and b represents cymbidium goeringii under ABA stressCgWRKY40The expression of the gene;
FIG. 3a is a diagram showing the results of the cleavage, wherein M is D L2000 Marker;CgWRKY40b, performing double enzyme digestion with SmaI and SnaBI after connection with pBI121, wherein the B is a screening picture of a positive recombinant, M is D L2000 Marker, and the size of a target band is 939 bp;
FIG. 4 is a diagram showing the PCR results of transgenic Arabidopsis plants, wherein M is D L2000 Marker, 1 is vector plasmid DNA as positive control, and 2 is wild type DNA as negative control;
FIG. 5 is a view of a rotary tableCgWRKY40The plant types of the gene plant and the wild type arabidopsis thaliana plant are compared, wherein WT and the wild type arabidopsis thaliana are shown in the figure; 40-1, 40-2, 40-3, 40-4, turnCgWRKY40Different strains of genes;
FIG. 6 is a view of a rotary tableCgWRKY40The expression quantity of the gene plant and the wild type arabidopsis thaliana under the stress of ABA;
FIG. 7 is a view of a rotary drumCgWRKY40The root length variation graph of the gene plant; WT: common wild type Arabidopsis thaliana; the abscissa represents the gene number; the ordinate represents the root length (cm); concentration units of ABA (. mu.M).
Detailed Description
The present invention will be further described with reference to the following specific examples.
Example 1
The material used in this example was the "songmei" leaf of cymbidium goeringii, which was snap frozen in liquid nitrogen after harvesting and stored in an ultra-low temperature freezer (-80 ℃).
1) Extraction of total RNA from cymbidium goeringii leaves
The method is carried out according to the instruction of a TaKaRa plant total RNA extraction kit, and comprises the following specific operations:
rapidly transferring cryopreserved cymbidium leaves into a mortar precooled with liquid nitrogen, grinding the tissue with a pestle while continuously adding liquid nitrogen until the tissue is ground into powder, adding the ground sample into a 1.5m L sterilized Tube containing 450. mu.l Buffer PE, repeatedly blowing the Tube with a pipette until no obvious precipitate is formed in the lysate, centrifuging the lysate at 4 ℃ for 5min at 12,000 rpm, carefully sucking the supernatant into a new 1.5m L sterilized Tube, adding 1/10 volumes of Buffer NB to the supernatant, mixing with Vortex oscillation at 12,000 rpm, centrifuging at 4 ℃ for 5min, carefully sucking the supernatant into a new 1.5m L0 sterilized Tube, adding 450. mu.6. mu.1 Buffer R L, mixing the solutions uniformly using a pipetting gun, adding 1/2 volumes of absolute ethanol, transferring the solutions uniformly into a pipette gun, immediately transferring the solutions into a RNA Column at 4835 rpm, placing the filtrate at 450. mu.1 min, settling the filtrate in 300. mu.2 rpm, adding the filtrate into a 5 μm Column RNA Column Buffer DNA Column, adding the filtrate, centrifuging the filtrate at 500. mu.000 rpm, adding 2. mu.000 rpm, adding RNA to a Column RNA Column DNA Column of the filtrate, centrifuging the mixture, adding 2 Column DNA of the filtrate, adding 2 to a Column DNA Column of Column DNA Column of Column DNA Column of Column DNA Column of Column 2, adding the Column DNA Column of Column DNA, adding the Column DNA Column of Column DNA, adding 2, centrifuging at 500 rpm, adding the Column DNA Column of Column DNA Column of Column DNA Column of Column DNA, adding 2, adding the Column DNA Column of Column DNA2O is left to stand at room temperature for 5min and centrifuged at 12,000 rpm for 2min to elute RNA. The obtained RNA is stored in a refrigerator at minus 80 ℃ for later use after concentration and purity detection.
The 2 mu L RNA is absorbed and detected by 1 percent agarose gel electrophoresis, the result shows that 28S and 18S bands are clearer, the brightness of the 28S band is about twice of 18S, the RNA quality is better, the RNA purity is detected by a micro-computerization protein analyzer,OD260/OD280is 2.04, OD260/OD2302.02, the integrity is better, and the reverse transcription can be performed.
2) Synthesis of first Strand cDNA
The total RNA obtained was used as a template, reverse transcription was performed using a TaKaRa reverse transcription kit, and oligo (dT) was used as an anchor primer, and first strand cDNA was synthesized by reverse transcription. The specific operation is as follows:
the mix was prepared in the order of template RNA/Primer in a centrifuge tube at a total of 10. mu. L for template 1. mu.g, oligo (dT) Primer (50. mu.M) 1. mu. L mix (10mM reach) 1. mu. L, and the remaining volume was treated with RNase-freeddH2After completion of the O addition, the mixture was kept at 65 ℃ for 5min and rapidly cooled on ice, the tube was centrifuged to deposit the mixture in the tube at the bottom, and a reverse transcription reaction solution (20. mu. L) was prepared in a new tube, which was denatured, 10. mu. L, 5 × PrimeScriptBuffer 4. mu. L Inhibitor (40U/. mu.l) 0.5. mu. L RTase (200U/. mu.l) 1. mu. L FreedH2And O is supplemented by 20 mu L, the mixture is slowly shaken up, and is put on a PCR instrument for heat preservation for 10min at the temperature of 30 ℃, for heat preservation for 30min at the temperature of 42 ℃ and for heat preservation for 5min at the temperature of 95 ℃ to inactivate the enzyme, and the cDNA solution is obtained after the mixture is placed on ice.
3) Design and cloning of target gene primer
Based on existing sequencing data for the cymbidium transcriptome, using other speciesWRKYBlast homology alignment is carried out on related gene sequences. Corresponding primers are designed by utilizing Oligo6.0 and Prime5.0, and the sequences of the primers are as follows:
CgWRKY40-F:5'- ATGGAACCGTCCCCTC -3',
CgWRKY40-R:5'- TCAATTATGAGAAGATGGGAGTT -3'。
performing cymbidium goeringii by using PrimerStar Max high fidelity enzyme by using cDNA first strand as templateCgWRKY40The PCR amplification system (50. mu. L) was 25. mu.l L PrimerStar Max, 2. mu. L Forward Primer, 2. mu. L Reverseprimer, 2. mu. L Template DNA, 19. mu. L ddH2And O. The PCR procedure was: the reaction conditions are pre-denaturation at 94 ℃ for 3min, denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 5s, extension at 72 ℃ for 30s, 32 cycles, total extension at 72 ℃ for 5min and heat preservation at 16 ℃.
After the PCR reaction is completed, taking all PCR products, detecting by 1.5% agarose gel electrophoresis, cutting target fragments, recovering and purifying PCR target amplification products by gel, adopting DNA gel recovery kit of Tiangen company to purify and recover target fragments, specifically, adding 500 mu L equilibrium liquid B L into an adsorption column CA2 (the adsorption column is placed into a collecting tube), centrifuging at 12000rpm for 1min, pouring off waste liquid in the collecting tube, placing the adsorption column back into the collecting tube again, cutting a single target strip from agarose gel, placing the cut strip into a clean centrifugal tube, weighing the weight of the cut strip, adding an isovolumetric solution PN (if the gel is 0.1g and the volume of the cut strip can be regarded as 100 mu L, adding 100 mu L PN solution), placing in a water bath at 50 ℃, turning over the centrifugal tube up and down gently until the gel block is completely dissolved, adding the obtained in the previous step into a CA2, placing the centrifugal tube at room temperature for 2min, 12000rpm for 1min, pouring off the collecting tube, placing CA 5631 into the adsorption column, placing the adsorption column into the collecting tube, placing the centrifugal tube at L min, adding a rinsing liquid, placing the centrifugal tube into a centrifugal tube, placing the centrifugal tube at 12000rpm, removing the centrifugal tube, placing the centrifugal tube for 2min, placing the centrifugal tube at the centrifugal tube, placing the centrifugal2O, standing at room temperature for 2min, centrifuging at 12000rpm for 2min to collect DNA solution, collecting purified product of 2 μ L, and detecting by gel electrophoresis using 1% agarose.
4) Ligation of the fragment of interest to the vector
The cloning Vector was pEASY-Blunt Vector from the entire gold company, and the ligation reaction was carried out in a ligation system (5. mu. L) of 4. mu. L PCR purified product and 1. mu. L pEASY-Blunt Vector, which were gently pipetted and mixed, and then the mixture was left at room temperature for 5min, and the tube was placed on ice.
5) Conversion of ligation products
The competent cell Trans5 α strain was taken out from the ultra-low temperature refrigerator, placed on ice to melt, 5. mu. L of overnight ligation product was taken up and added to 100. mu. L of competent cells, the centrifuge tube was placed on ice for 30min, water bath was carried out in a 42 ℃ water bath kettle with heat shock for 90s without shaking, immediately placed on ice for 2min, 800. mu. L of antibiotic-free liquid medium was added to the super clean bench, thawed by shaking at 37 ℃ and 180 rpm for 1h, centrifuged at 4000rpm for 3min, 800. mu. L supernatant was aspirated, and the precipitated cells were resuspended and smeared on L B plates (Amp concentration 100 mg/L) and cultured overnight at 37 ℃.
6) Screening and validation of recombinant plasmids
Single colonies grown overnight on L B solid medium containing antibiotic (Amp) were picked and inoculated into L B liquid medium containing 750. mu. L of the same antibiotic at 200 rpm and 37 ℃ overnight.
The PCR amplification system comprises 10u L Green TaqMix, 1 mu l M13-F/R, 1 mu L bacterial liquid and 7 mu L ddH2O was replenished to 20. mu. L.
The PCR procedure was: 10min at 94 ℃; 30 cycles at 94 ℃ for 30s, 55 ℃ for 30s, and 72 ℃ for 1 min; 5min at 72 ℃; at 16 ℃ forever.
And absorbing a PCR product of 5 mu L for agarose gel electrophoresis detection analysis, verifying, entrusting the bacterial liquid sample with correct strip size to sequencing by Nanjing Kingsry Biotechnology Co., Ltd, and performing comparative analysis on the sequencing result on NCBI by using a sequencing primer which is a universal primer M13F/R.
According to the analysis of the sequencing result, 1 cymbidium can be finally obtained by determining the cloneWRKYThe coding gene is namedCgWRKY40The nucleotide sequence of the gene is shown as SEQ ID NO.1,CgWRKY40the gene coding length is 939bp, the ATG start codon and the TGA stop codon are contained, wherein the ORF total length is 939bp, 312 amino acid proteins are coded, and the amino acid sequence of the protein is shown as SEQ ID NO. 2.
Example 2
The research result shows thatWRKY40The gene is expressed in various tissues and organs in cymbidium (FIG. 2 a), but the expression level of the gene is the highest in cymbidium, which indicates that the gene is active in flower function. Expression analysis of cymbidium ABA stress treated leaves (FIG. 2 b) demonstratedCgWRKY40The gene plays an important regulation role in the ABA stress response of the cymbidium goeringii leaves.
The plant material used in this example was Arabidopsis thaliana (Arabidopsis thaliana) Col (Columbia) wild type seeds.
The E.coli strain used in this example was Trans5 α, the Agrobacterium strain was GV3101, which was used to transform Arabidopsis thaliana, respectively, and the plant expression vector used in the experiment was pBI121, which were purchased from holotype gold and prism, respectively.
1)CgWRKY40Construction of Gene overexpression vectors
Obtained in example 1CgWRKY40The full-length sequence of the gene ORF is connected with a plant expression vector pBI121, and the constructed vector is shown in figure 1.
2) And (3) plasmid extraction:
extracting plasmids according to the specification of the small-extraction medium-volume kit of the Tiangen plasmids, and specifically comprising the following steps:
centrifuging 10m L bacteria liquid cultured overnight at 12000rpm for 1min, removing supernatant, adding 500 μ L P1 solution (containing RNaseA) into centrifuge tube with thallus precipitate, suspending thallus precipitate completely with vortex apparatus, adding 500 μ L P2 solution into centrifuge tube, cracking thallus fully when turning up and down gently, adding 700 μ L P3 solution into centrifuge tube, turning up and down gently, mixing well, centrifuging at 12000rpm for 10min after white flocculent precipitate appears, adding 500 μ L equilibrium solution B L into adsorption column CP4, centrifuging at 12000rpm for 1min, discarding waste liquid in collection tube, returning adsorption column to collection tube, adding collected supernatant into filtration column CS in batches, centrifuging at 12000rpm for 2min, adding collected solution into adsorption column CP4 in batches, discarding waste liquid in collection tube at 12000rpm for 4 min, returning PD of adsorption column to L min, adding collected supernatant to adsorption column PD of collection tube, discarding supernatant to centrifugation column, adding collected supernatant to PW column 4, removing supernatant, adding collected supernatant to adsorption column PW column 4, adding collected supernatant to centrifugation column PW column, discarding supernatant, adding collected supernatant to centrifugation column PW column 4, adding collected supernatant to centrifugation column, removing waste liquid, centrifuging, removing waste liquid in centrifugation column, adding supernatant to centrifugation column PW column 4, removing medium PW column, centrifuging, removing waste liquid in centrifugation column, removing medium for 12000rpm, removing medium, adding supernatant, centrifuging, removing waste liquid, removing medium, removing waste liquid in centrifugation column, centrifuging, removing medium column 638, removing medium column, removing medium column, removing medium adsorbing column, removing medium column2O; standing at room temperature for 2min, centrifuging at 12000rpm for 1min, and collecting the solution in the centrifuge tube as plasmid. Finally, the plasmid concentration was determined and prepared for the next experiment.
3) Addition of specific cleavage sites
cDNA is taken as a template, and specific enzyme cutting sites are added on two sides of a target gene by a PCR method. Chinese cymbidiumCgWRKY40SmaI and SnaBI enzyme cutting sites are added on both sides of the gene. The PCR reaction system, procedure and primers used were as follows:
PCR amplification System (50. mu. L) 25. mu. L PrimerStar Max, 2. mu. L Forward Primer, 2. mu. L Reverseprimer, 2. mu. L Template DNA, 19. mu. L ddH2And O. The PCR procedure was: the reaction conditions are pre-denaturation at 94 ℃ for 3min, denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 5s, extension at 72 ℃ for 30s, 32 cycles, total extension at 72 ℃ for 5min and heat preservation at 16 ℃.
The primer sequences used were:
CgWRKY40-SmaI-F:5'-TCACACAAACGGTGATACGTAATTATGAGAAGATGGGAGTTCAAAGA -3',
CgWRKY40-SnaBI-R:5'-GGACTCTAGAGGATCCCCGGGATGGAGGACGTGTTGGATGAAT-3'。
the obtained PCR product was separated by 1.5% agarose gel electrophoresis, recovered and purified using a Tiangen agarose gel DNA recovery kit, and the recovered product was ligated with the pBI121 vector to construct an expression vector.
4) Double enzyme digestion reaction
Digesting the extracted pBI121 plasmid with SmaI and SnaBI at 37 deg.c for 15min, electrophoretically recovering linear vector, and storing at-20 deg.c for further use, wherein the double digestion reaction system is 50 μ L, pBI121 plasmid 20 μ L, 5 × buffer 5 μ L1 μ L1 μ L, ddH2O23 mu L, the enzyme cutting result is shown in figure 3a, wherein M is D L2000 Marker, 1:CgWRKY40after ligation with pBI121, SmaI and SnaBI were used for double digestion.
5) Ligation reaction
Agarose gel electrophoresis is used for detecting a target gene and a vector pBI121 recovered after enzyme digestion, and according to the detected purity and concentration, all reagents are added according to a connection system, wherein the number of target fragment molecules is =3:1-5:1, the connection reaction system is a linearized pBI121 vector 7 mu L, an insert fragment 3 mu L, a 5 × CE II buffer 4 mu l, an Exnase II 2 mu l and a ddH2OUp to 20 mu L, the reaction is carried out for 30min at 37 ℃, and the reaction is placed on ice for cooling.
6) Transfer of the ligation product into E.coli
The product of the ligation of the desired fragment with the vector pBI121 was transferred into competent cells of E.coli Trans5 α in the same manner as in example 1.
7) Identification of recombinants
The single colony on the plate is selected and inoculated into L B liquid culture medium containing antibiotic (kanamycin), shaking culture is carried out at 37 ℃ and 200 rpm for overnight, bacterial liquid PCR is carried out by using a target gene full-length primer, positive clones are screened, the screened positive clones are sent to Nanjing Kingsry company for sequencing, plasmid is extracted by using a Tiangen plasmid extraction kit, enzyme digestion verification is carried out, whether the sizes of fragments after enzyme digestion are consistent or not is judged, the result is shown in figure 3B, the target primer PCR result is the target primer, and the size of a strip is 939 bp.
8) Preparation and transformation of Agrobacterium-infected competent cells
The agrobacterium is used for preparing agrobacterium-induced competence for carrying out an infection experiment of arabidopsis thaliana by using agrobacterium GV3101, and the agrobacterium-induced competence preparation process comprises the steps of selecting an activated agrobacterium single colony, inoculating the agrobacterium-induced competence in a 5m L liquid L B culture medium, carrying out shake culture at 28 ℃ and 250rpm for 20-24 h, absorbing 2m L bacterial liquid, inoculating the agrobacterium-induced competence in a triangular flask containing a 50m L liquid L B culture medium, carrying out shake culture at 28 ℃ and 250rpm to OD600The value is about 0.8, the bacterial liquid after the propagation is put on ice and iced for 30min, the temperature is 4 ℃, the centrifugal speed is 5000 rpm for 5min, the supernatant is discarded, 10m L precooled 0.1 mo 1/L CaCl is added2Suspending the precipitated thallus thoroughly, centrifuging at 4 deg.C and 5000 rpm for 5min, discarding supernatant, adding 1m L precooled 20 mm O1/L CaCl2The solution fully suspends the thalli to obtain GV3101 competent cells to be prepared, the competent cells are subpackaged into 100 mu L/tube by a centrifuge tube, 20% of sterile glycerol is rapidly added, and the competent cells are placed and stored at minus 80 ℃.
Agrobacterium transformation of recon, namely, thawing agrobacterium competent cells by ice bath, adding 1 to 5 mul of recovered and purified plasmid into 200 mul of agrobacterium competent cells, lightly mixing uniformly, performing ice bath for 30min, quickly freezing for l min by using liquid nitrogen, thermally shocking in a water bath kettle at 37 ℃ for 1 to 5min, quickly placing on ice for 1 to 2min, adding 800 mul of L B culture medium without any antibiotic, recovering for 2 to 4h at 28 ℃ and 100 rpm, centrifuging for 3min at 4000rpm, sucking off part of the culture medium, fully mixing the rest of bacteria liquid by using a liquid transfer gun, smearing on a solid L B culture medium added with 50 mg/L kanamycin and 50 mg/L streptomycin (EHA 105) or 100 mg/L gentamycin (GV 3101), and performing inverted culture for 30 to 48 h at 28 ℃.
Identification of Agrobacterium recombinants: picking out single colony from the plate culture medium, and inoculating the single colony in a liquid culture medium containing corresponding antibiotics; culturing at 28 deg.C and 220 rpm overnight; carrying out PCR on the bacterial liquid by respectively matching 35S-F with the following primers, wherein the sequences of the primers are as follows:
35S-F:5'-GATAGTGGAAAAGGAAGGTG-3',
35S-CgWRKY40-R:5'- GGACTCTAGAGGATCCCCGGGATGGAGGACGTGTTGGATGAAT -3'。
detecting the PCR product by 1% agarose gel electrophoresis to identify whether the PCR product contains a target fragment; identifying positive clones, performing amplification culture, extracting plasmids by an alkaline lysis method, and performing double enzyme digestion verification; and adding a proper amount of sterile glycerol into the identified positive clone, and storing at-80 ℃ for later use.
9) Agrobacterium-mediated transformation of Arabidopsis thaliana
The method comprises the specific operation steps of maintaining healthy growth state of arabidopsis (col wild type) until the arabidopsis flowers, activating agrobacterium EHA105 strain carrying the target gene, selecting a single colony, inoculating the single colony on L B culture medium containing 5m L kanamycin and streptomycin, shaking the bacteria at 28 ℃ and 250rpm until the bacteria become turbid just and the bacteria is about 8-10 hours, sucking 1m L bacteria liquid, inoculating the bacteria liquid into a triangular flask (50m L) for shaking the bacteria for 24 hours until the OD value is about 0.8, centrifuging the bacteria liquid at 5000 rpm for 5min at room temperature, removing supernatant, collecting the bacteria, suspending the bacteria with 5% sucrose solution, adding Silwet L-77 at the concentration of 0.05% (500 mu l/L) before soaking, shaking out foams, soaking the overground part of arabidopsis in agrobacterium suspension solution for 15-30 seconds, slightly shaking, laying the soaked arabidopsis thaliana in a tray covered with a foil, sealing the foil, placing the arabidopsis thaliana in a sealed box, placing the box for 24 hours, and culturing the arabidopsis thaliana in a light-shielding condition, and watering the foil to grow.
The 5% sucrose solution resuspension comprises the following components of MS culture medium, sucrose 50 g/L0.5.5 g/L and Silwet-77500 mu l/L (note: after preparation, pH is adjusted to 5.8, after bacterial liquid is centrifugally resuspended, Silwet L-77 is added, and the conversion relation between resuspension liquid and bacterial liquid is that the dosage of resuspension liquid is bacterial liquid OD bacterial liquid volume =0.8 bacterial liquid resuspension).
10) Screening of transgenic plants
The collected seeds of transgenic Arabidopsis thaliana of T1 generation are sterilized by alcohol and mercuric chloride, and the method comprises placing appropriate amount of the obtained transgenic seeds in a centrifuge tube of 1.5m L, soaking in 75% alcohol for 30s, sterilizing with 10% sodium hypochlorite for 2min for 30s, washing with sterile water for 3-4 times, replacing the sterilized new centrifuge tube after the first washing, and suspending with 0.1% agarose solution.
The sterilized transgenic Arabidopsis seeds were sown on 1/2MS solid medium containing antibiotics (kanamycin 50 mg/L and cefamycin 100 mg/L), cultured at 22 ℃ under light, and after about one week, Arabidopsis seeds which can normally grow on the medium were transplanted into soil and continued to grow.
11) Detection of transgenic plants
Taking a proper amount of young leaves of arabidopsis thaliana and transgenic plants, and extracting DNA by adopting a CTAB method, wherein the specific operation steps comprise placing a proper amount of leaves in a sterilized 2m L centrifuge tube, adding 700 mu l of CTAB solution, thoroughly grinding by using a ball mill, standing for 10min at 65 ℃, adding chloroform isoamylol with the same volume, evenly mixing by reversing for several times, centrifuging for 10min at 14000rpm, transferring supernatant into a new sterile centrifuge tube, adding isopropanol with the same volume, evenly mixing by reversing for several times, standing for 2min at room temperature, centrifuging for 10min at 14000rpm, pouring off supernatant, adding 70% absolute ethyl alcohol, blowing and washing twice by using a liquid transfer gun, centrifuging for 1min at 14000rpm, discarding supernatant, drying surface liquid, adding 20 mu L ddH2And dissolving the O. Taking the DNA of the above-mentioned extracted transgenic and wild type Arabidopsis thaliana, and usingCgWRKY40PCR detection is carried out by specific primers of the gene.
Chinese cymbidiumCgWRKY40After transgenic Arabidopsis thaliana, a total of 5 over-expressions were obtainedCgWRKY40A transgenic Arabidopsis line. Taking the recombinant plasmid as yangThe results of PCR using wild type as negative control and water as blank control and positive control as shown in FIG. 4CgWRKY40As for the result of gene vector PCR, water was used as a template for negative control, and wild type Arabidopsis DNA was used as a template for WT.
12) Phenotypic observations
Obtaining transgenic plants of different generations: the harvested transgenic T1 generation seeds are sterilized, screened and cultured, and then transplanted into nutrient soil to be cultured at 22 ℃ for 16 h in light/8 h in darkness; after detection, retaining the preliminarily confirmed transgenic plants, harvesting seeds of T1 generations after the plants are mature, and numbering to obtain T2 generations; like the T1 generation, seeds of the T2 generation are sterilized and then coated on a screening culture medium containing antibiotics, and the culture medium is placed at 22 ℃ for continuous illumination; performing survival rate statistics on T2 generation seeds with different numbers for about 10 days, selecting plants with 75% survival rate, transplanting the plants into nutrient soil, culturing the plants in the nutrient soil at 22 ℃ for 16 h in light/8 h in dark, and taking leaves for positive detection; continuously numbering positive T2 generation plants, and collecting seeds to obtain T3 generation seeds; sterilizing the seeds, screening by using a screening culture medium, and placing under the light for continuous illumination culture; around 10d, different numbered T3 generation plants were observed, all survived and no segregating homozygous plants for the T3 generation appeared.
The obtained transgenic lines were observed in batches.
(1) Selecting 3 transgenic plants with obvious phenotype for observation, as shown in figure 5, finding that the transgenic arabidopsis plants grow slowly compared with wild arabidopsis,CgWRKY40the transgenic plants are in the seedling stage,CgWRKY40compared with WT, the transgenic plant has obviously larger and more leaves, is accompanied by obvious macroscopic character hair, has vigorous vegetative growth and flowers later than wild Arabidopsis thaliana, and shows thatCgWRKY40Promotes the vegetative growth of the transgenic plants.
(2) Performing ABA stress treatment on transgenic Arabidopsis, sowing the disinfected transgenic Arabidopsis seeds and wild Arabidopsis seeds on 1/2MS culture medium for about 4 days, transferring the seeds to 1/2MS culture medium added with 100 MuM ABA, photographing for about 10 days to observe the root length of Arabidopsis, and recording data, see figure 6If the result is found, the method has the advantages that,CgWRKY40the expression pattern of (A) is reduced firstly and then increased in 1h, while the expression quantity in the common wild type Arabidopsis plant (WT) is almost all 0, and the expression quantity in the transgenic Arabidopsis plant has different expression in different degrees at different times, and the experimental result proves thatCgWRKY40The gene has been successfully transferred into arabidopsis; as shown in figure 7 of the drawings,CgWRKY40the root length of the over-expressed arabidopsis thaliana is slightly longer than that of WT under normal culture conditions, but the root length of the over-expressed arabidopsis thaliana is more than 40mm, and the root length of the over-expressed arabidopsis thaliana is different from that of WT under different ABA concentrationsCgWRKY40The root length reduction of transgenic Arabidopsis is obviously lower than that of WT, which shows thatCgWRKY40Is sensitive to ABA and may slow down the inhibitory effect of ABA on root development.
This example shows cymbidium goeringii to be overexpressedCgWRKY4035S:CgWRKY40the transgenic plants were transformed into Arabidopsis thaliana, and phenotypic observation and analysis were performed. As can be seen from the results, 35S was overexpressed:CgWRKY40the leaves of T2 generation Arabidopsis plants are obviously larger and more, are accompanied by obvious macroscopic character hairs, have vigorous vegetative growth, and flower later than wild Arabidopsis;CgWRKY40overexpression can slow down the inhibition effect of ABA on root development by regulating the expression of ABA signaling pathway related genes.
Sequence listing
<110> Nanjing university of forestry
<120> cymbidium CgWRKY40 gene and application thereof
<160>8
<170>SIPOSequenceListing 1.0
<210>1
<211>939
<212>DNA
<213> Cymbidium goeringii
<400>1
atggaaccgt cccctcggct cggctgctcc actgtaaatc tcgacctcag tgtcggtccg 60
accaacctcc tcctcgaagatccgatcggc tcgagagctt tggcgactaa tccgatacaa 120
attctaatga atccgccaag tagagaagag actgaggata tgaagatgaa gatacaaaag 180
ctaagtgaag agaattggaa gctgaatgag aagctgagtg ccatgactgt gagttacagc 240
actcttcaga accagcttct tgatctcatg atctcatctc cttcggagaa gggagcggga 300
tcccccacga agaaaaggaa gagcgcaagc ctcgaatctg atagccgcaa cgacgacagc 360
agcggctttg tcgcgcacgt ggagagcatg tctagcgacg attctcatca gaagttgagg 420
gttgattcta gatcgactgt atcgaaggtt tgtgtgaagt ctgatccatc tgatcgaatg 480
aacatggttg tgaaagatgg ctatcagtgg aggaaatatg ggcagaaggt tacaagagat 540
aacccttcac cgagagctta tttcagatgc tccttcgccc cttcatgccc agttaagaag 600
aaggtgcaga gaagtgttga tgatttgtcc atcttggttg ccacatatga aggtgagcac 660
aatcacaggc cgccattaca aggtgaagct ccgcctcgtt cgagccacgg tgtaagctcg 720
acgcctaatt tcaccggcca gacagtcacc gtcgatctca gggatgatcg gtggcgcgcg 780
gatttgaata aggttagcac agaggtagct tctctggagt ttcagaaggt catgatcgag 840
caaatggctg tggtcttgac gaaagatccc aactttagaa catcattagc gaatgcaata 900
tctgagagga tctttgaact cccatcttct cataattga 939
<210>2
<211>312
<212>PRT
<213> Cymbidium goeringii
<400>2
Met Glu Pro Ser Pro Arg Leu Gly Cys Ser Thr Val Asn Leu Asp Leu
1 5 10 15
Ser Val Gly Pro Thr Asn Leu Leu Leu Glu Asp Pro Ile Gly Ser Arg
20 25 30
Ala Leu Ala Thr Asn Pro Ile Gln Ile Leu Met Asn Pro Pro Ser Arg
35 40 45
Glu Glu Thr Glu Asp Met Lys Met Lys Ile Gln Lys Leu Ser Glu Glu
50 55 60
Asn Trp Lys Leu Asn Glu Lys Leu Ser Ala Met Thr Val Ser Tyr Ser
65 70 75 80
Thr Leu Gln Asn Gln Leu Leu Asp Leu Met Ile Ser Ser Pro Ser Glu
85 90 95
Lys Gly Ala Gly Ser Pro Thr Lys Lys Arg Lys Ser Ala Ser Leu Glu
100 105 110
Ser Asp Ser Arg Asn Asp Asp Ser Ser Gly Phe Val Ala His Val Glu
115 120 125
Ser Met Ser Ser Asp Asp Ser His Gln Lys Leu Arg Val Asp Ser Arg
130 135 140
Ser Thr Val Ser Lys Val Cys Val Lys Ser Asp Pro Ser Asp Arg Met
145 150 155 160
Asn Met Val Val Lys Asp Gly Tyr Gln Trp Arg Lys Tyr Gly Gln Lys
165 170 175
Val Thr Arg Asp Asn Pro Ser Pro Arg Ala Tyr Phe Arg Cys Ser Phe
180 185 190
Ala Pro Ser Cys Pro Val Lys Lys Lys Val Gln Arg Ser Val Asp Asp
195 200 205
Leu Ser Ile Leu Val Ala Thr Tyr Glu Gly Glu His Asn His Arg Pro
210 215 220
Pro Leu Gln Gly Glu Ala Pro Pro Arg Ser Ser His Gly Val Ser Ser
225 230 235 240
Thr Pro Asn Phe Thr Gly Gln Thr Val Thr Val Asp Leu Arg Asp Asp
245 250 255
Arg Trp Arg Ala Asp Leu Asn Lys Val Ser Thr Glu Val Ala Ser Leu
260 265 270
Glu Phe Gln Lys Val Met Ile Glu Gln Met Ala Val Val Leu Thr Lys
275 280 285
Asp Pro Asn Phe Arg Thr Ser Leu Ala Asn Ala Ile Ser Glu Arg Ile
290 295 300
Phe Glu Leu Pro Ser Ser His Asn
305 310
<210>3
<211>16
<212>DNA
<213> Artificial sequence (artiartiartifical sequence)
<400>3
atggaaccgt cccctc 16
<210>4
<211>23
<212>DNA
<213> Artificial sequence (artiartiartifical sequence)
<400>4
tcaattatga gaagatggga gtt 23
<210>5
<211>47
<212>DNA
<213> Artificial sequence (artiartiartifical sequence)
<400>5
tcacacaaac ggtgatacgt aattatgaga agatgggagt tcaaaga 47
<210>6
<211>43
<212>DNA
<213> Artificial sequence (artiartiartifical sequence)
<400>6
ggactctaga ggatccccgg gatggaggac gtgttggatg aat 43
<210>7
<211>20
<212>DNA
<213> Artificial sequence (artiartiartifical sequence)
<400>7
gatagtggaa aaggaaggtg 20
<210>8
<211>43
<212>DNA
<213> Artificial sequence (artiartiartifical sequence)
<400>8
ggactctaga ggatccccgg gatggaggac gtgttggatg aat 43
Claims (5)
1. A kind of Chinese cymbidiumCgWRKY40The nucleotide sequence of the gene is shown in SEQ ID NO. 1.
2. The cymbidium goeringii of claim 1CgWRKY40The amino acid sequence of the gene expression protein is shown in SEQ ID NO. 2.
3. The cymbidium goeringii of claim 1CgWRKY40The use of genes in plant production and breeding.
4. Contains the cymbidium goeringii of claim 1CgWRKY40A vector for the gene.
5. Contains the cymbidium goeringii of claim 1CgWRKY40A host cell for the gene.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010298688.1A CN111424038B (en) | 2020-04-16 | 2020-04-16 | Cymbidium CgWRKY40 gene and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010298688.1A CN111424038B (en) | 2020-04-16 | 2020-04-16 | Cymbidium CgWRKY40 gene and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN111424038A true CN111424038A (en) | 2020-07-17 |
CN111424038B CN111424038B (en) | 2022-04-26 |
Family
ID=71558016
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202010298688.1A Active CN111424038B (en) | 2020-04-16 | 2020-04-16 | Cymbidium CgWRKY40 gene and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN111424038B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN118726410A (en) * | 2024-09-03 | 2024-10-01 | 青岛农业大学 | Cranberry peanut WRKY40 transcription factor for promoting drought tolerance and early flowering of plants and application thereof |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040045049A1 (en) * | 1998-09-22 | 2004-03-04 | James Zhang | Polynucleotides and polypeptides in plants |
CN107937411A (en) * | 2017-11-10 | 2018-04-20 | 中国林业科学研究院华北林业实验中心 | Chinese white poplar PtoWRKY40 genes, its expression vector and construction method and application |
CN109628467A (en) * | 2019-01-30 | 2019-04-16 | 南京林业大学 | A kind of Chunlan CgWRKY2 gene and its application |
CN110256549A (en) * | 2019-07-29 | 2019-09-20 | 九圣禾种业股份有限公司 | Plant disease-resistant Protein G hWRKY40 and encoding gene and its application |
-
2020
- 2020-04-16 CN CN202010298688.1A patent/CN111424038B/en active Active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040045049A1 (en) * | 1998-09-22 | 2004-03-04 | James Zhang | Polynucleotides and polypeptides in plants |
CN107937411A (en) * | 2017-11-10 | 2018-04-20 | 中国林业科学研究院华北林业实验中心 | Chinese white poplar PtoWRKY40 genes, its expression vector and construction method and application |
CN109628467A (en) * | 2019-01-30 | 2019-04-16 | 南京林业大学 | A kind of Chunlan CgWRKY2 gene and its application |
CN110256549A (en) * | 2019-07-29 | 2019-09-20 | 九圣禾种业股份有限公司 | Plant disease-resistant Protein G hWRKY40 and encoding gene and its application |
Non-Patent Citations (8)
Title |
---|
NCBI: "PREDICTED: Dendrobium catenatum probable WRKY transcription factor 40 (LOC110111426), transcript variant X2, mRNA", 《GENBANK DATABASE》 * |
NCBI: "probable WRKY transcription factor 40 isoform X2 [Dendrobium catenatum]", 《GENBANK DATABASE》 * |
RADHA YADAV等: "Transcriptome sequence analysis and mining of SSRs in Jhar Ber (Ziziphus nummularia (Burm.f.) Wight & Arn) under drought stress", 《SCIENTIFIC REPORTS》 * |
UNIPROTKB: "Putative WRKY transcription factor 40", 《EMBL》 * |
ZHANG G.Q.等: "Dendrobium catenatum putative WRKY transcription factor 40", 《EMBL》 * |
刘戈宇等: "植物WRKY蛋白家族的结构及其功能", 《生命的化学》 * |
刘文英: "《植物逆境与基因》", 31 May 2015, 北京理工大学出版社 * |
张子凤等: "铁皮石斛DoWRKY6转录因子基因的克隆与分析", 《现代生物医学进展》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN118726410A (en) * | 2024-09-03 | 2024-10-01 | 青岛农业大学 | Cranberry peanut WRKY40 transcription factor for promoting drought tolerance and early flowering of plants and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN111424038B (en) | 2022-04-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN113046360A (en) | Maize genes ZMSPL1 and ZMSPL2 and uses thereof | |
CN111424037B (en) | Cymbidium CgWRKY70 gene and application thereof | |
CN113621643A (en) | Application of GhTULP34 in regulation and control of plant resistance to abiotic adversity stress and regulation and control method | |
CN109355297A (en) | Dendrobium candidum DcWOX4 gene and its application in raising axis tiller | |
CN110904106B (en) | Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity | |
CN111424038B (en) | Cymbidium CgWRKY40 gene and application thereof | |
CN111454966B (en) | Cymbidium CgWRKY4 gene and application thereof | |
CN111304220B (en) | Cymbidium CgWRKY3 gene and application thereof | |
CN111304222B (en) | Cymbidium CgWRKY11 gene and application thereof | |
CN111304223B (en) | Cymbidium CgWRKY24 gene and application thereof | |
CN114671932B (en) | EjAGL6 gene for advancing loquat flowering time, encoding protein and application thereof | |
CN110951771B (en) | Chinese cymbidiummiR390aApplication in controlling plant root system development | |
CN111304198B (en) | Application of cymbidium goeringii miR390b in controlling plant vegetative organ development | |
CN115851823A (en) | Cymbidium goeringii CgARF18 gene and application thereof | |
CN108752446B (en) | Myrica rubra MrLFY gene and application thereof | |
CN111424039B (en) | Cymbidium CgWRKY65 gene and application thereof | |
CN111424041B (en) | Cymbidium CgWRKY49 gene and application thereof | |
CN111304221B (en) | Cymbidium CgWRKY31 gene and application thereof | |
CN111424040B (en) | Cymbidium CgWRKY21 gene and application thereof | |
CN109628468A (en) | A kind of Chunlan CgWRKY53 gene and its application | |
CN107586324A (en) | TabZIP15 albumen and its encoding gene and application | |
CN107602679B (en) | TabHLH44 albumen and its encoding gene and application | |
CN115651073B (en) | EjWUSa gene for advancing loquat flowering time, encoding protein and application thereof | |
CN116410985B (en) | Wheat TaNF-YB3D gene, alternative splicing form and application thereof | |
CN116622725B (en) | Hybrid tulip tree LhMFT2 gene and application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |