CN111423508A - Separated SARS-CoV-2 protein binding molecule for resisting virus infection - Google Patents

Abstract

The invention discloses an isolated SARS-CoV-2 protein binding molecule for resisting virus infection, which is a monoclonal antibody of S protein of SARS-CoV-2. The amino acid sequence of the heavy chain variable region of the binding molecule is selected from SEQ ID NOs:4, 12, and 20, and the amino acid sequence of the light chain variable region is selected from SEQ ID NOs:8, 16, and 24. The binding molecules of the present invention can specifically bind to the S protein of SARS-CoV-2 and neutralize SARS-CoV-2 to exert antiviral action.

Description

Separated SARS-CoV-2 protein binding molecule for resisting virus infection

Technical Field

The invention belongs to the field of antiviral treatment and molecular immunology, and relates to an isolated SARS-CoV-2 protein binding molecule for resisting virus infection, and the binding molecule is a specific antibody for protein.

Background

The novel coronavirus pneumonia (Corona Virus Disease 2019, COVID-19), referred to as 'New crown pneumonia' for short, is pneumonia caused by SARS-CoV-2 infection, respiratory droplet propagation is a main propagation path, the possibility of aerosol propagation exists under the condition of long-time exposure to high-concentration aerosol in a relatively closed environment, and other propagation paths are yet to be determined; the population is generally susceptible, and the incubation period is 1-14 days, generally 3-7 days. Clinical types include asymptomatic infected, light, normal, heavy and critical, with a poorer prognosis in the elderly and in the cases with underlying disease, and with relatively mild symptoms in children. When the number of patients reaches 17 in 25.3.2020, 81896 confirmed cases and 3287 death cases are cumulatively reported in China; 342244 confirmed cases are reported in a cumulative foreign way, 15747 death cases are reported in a cumulative way, and COVID-19 has already posed a serious threat to human health worldwide.

The SARS-CoV-2 as the causative agent of coronavirus pneumonia is a linear positive-strand RNA virus belonging to the genus of coronavirus family β, and it has been found that SARS-CoV-2 is adjacent to SARS-CoV and SARS-CoV-like groups at the position of the evolutionary tree, and there are 4 major structural proteins of the novel coronavirus, spike protein (S protein), nucleocapsid protein (N protein), membrane protein (M protein), envelope protein (E protein), S protein contains two subunits, S1 and S2, S1 includes N-terminal domain and C-terminal RBD domain, Neutralizing Antibody (Neutralizing Antibody) is a therapeutic Antibody which can protect cells from infection by Neutralizing or inhibiting the biological activity of pathogens (e.g. viruses) and is an important therapeutic Antibody which can be used for the purpose of preventing and curing severe infections of human patients, and also has a significant therapeutic effect on the clinical infection of human patients, such as a high-safety therapeutic effect of human infection, and a high-safety therapeutic effect of human infection prevention and cure of human infection by Neutralizing Antibody by Neutralizing the biological activity of human pathogen (e.g. HIV-CoV-2).

At present, no antibody against SARS-CoV-2 is available on the market at home and abroad, so that the establishment and development of antibody-based detection and diagnosis and treatment products with independent intellectual property rights have important practical significance for the intervention of various related diseases.

Disclosure of Invention

The purpose of the present invention is to provide a SARS-CoV-2 protein binding molecule which exerts an antiviral infection action by neutralizing SARS-CoV-2.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides an isolated SARS-CoV-2 protein binding molecule for resisting virus infection, the binding molecule comprises:

a heavy chain variable region CDR1 comprising an amino acid sequence selected from SEQ ID NOs 1, 9, and 17 and conservatively modified amino acid sequences thereof;

a heavy chain variable region CDR2 comprising an amino acid sequence selected from SEQ ID NOs:2, 10, and 18 and conservatively modified amino acid sequences thereof;

a heavy chain variable region CDR3 comprising an amino acid sequence selected from SEQ ID NOs 3, 11, and 19 and conservatively modified amino acid sequences thereof;

a light chain variable region CDR1 comprising an amino acid sequence selected from SEQ ID NOs 5, 13, and 21 and conservatively modified amino acid sequences thereof;

a light chain variable region CDR2 comprising an amino acid sequence selected from SEQ ID NOs 6, 14, and 22 and conservatively modified amino acid sequences thereof;

a light chain variable region CDR3 comprising an amino acid sequence selected from SEQ ID NOs:7, 15, and 23 and conservatively modified amino acid sequences thereof.

A preferred combination comprises:

(a) a heavy chain variable region CDRL comprising the amino acid sequence set forth in SEQ ID NO: 1;

(b) a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO. 2;

(c) a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO. 3;

(d) a light chain variable region CDRL comprising the amino acid sequence set forth in SEQ ID NO: 5;

(e) a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO. 6; and

(f) light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO. 7.

Another preferred combination comprises:

(a) a heavy chain variable region CDRL comprising the amino acid sequence set forth in SEQ ID NO: 9;

(b) a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO. 10;

(c) a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO. 11;

(d) a light chain variable region CDRL comprising the amino acid sequence set forth in SEQ ID NO: 13;

(e) a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO. 14; and

(f) light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO. 15.

Another preferred combination comprises:

(a) a heavy chain variable region CDRL comprising the amino acid sequence shown in SEQ ID NO: 17;

(b) a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO. 18;

(c) a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO. 19;

(d) a light chain variable region CDRL comprising the amino acid sequence set forth in SEQ ID NO: 21;

(e) a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO. 22; and

(f) light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 23.

Further, the binding molecules of the present invention comprise:

a heavy chain variable region comprising an amino acid sequence at least 80% homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs:4, 12, and 20;

a light chain variable region comprising an amino acid sequence at least 80% homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs 8, 16, and 24.

A preferred combination comprises:

a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO 4;

a light chain variable region comprising the amino acid sequence shown in SEQ ID NO. 8.

Another preferred combination comprises:

a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO 12;

a light chain variable region comprising the amino acid sequence shown in SEQ ID NO 16.

Another preferred combination comprises:

a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 20;

a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 24.

The binding molecule of the invention may be, for example, a full length antibody, or alternatively, the binding molecule may be an antibody fragment, such as a Fab or Fab'2 fragment, or a single chain antibody.

The invention also encompasses nucleic acids encoding the binding molecules of the invention, as well as recombinant vectors comprising such nucleic acids and host cells comprising such nucleic acids or recombinant vectors.

The recombinant vector may be linear or circular, and may be a non-viral vector such as a plasmid, or a viral vector, or may be a transposon-based vector, and examples of the vector include Sendai virus vectors, retrovirus (including lentivirus) vectors, adenovirus vectors, adeno-associated virus vectors, herpes virus vectors, vaccinia virus vectors, poxvirus vectors, poliovirus vectors, Hilbers virus vectors, rhabdovirus vectors, paramyxovirus vectors, orthomyxovirus vectors, and the like, and examples of the plasmid vector include pA1-11, pXT1, pRc/CMV, pRc/RSV, DNAc/Neo, and the like, and examples of the vector for animal cell expression use, and the vector for episomal vectors capable of autonomous replication outside the chromosome include Bac-type vectors, such as a baccific vector containing a replication origin sequence derived from EBV, a replication origin such as EBSorsoprotein-40, and the like, and the vector for controlling the replication origin of the replication of the artificial vector, and the artificial vector for binding to the cDNA-transcriptional gene (EBico-39 1).

Host cells useful in the present invention include, but are not limited to, microorganisms such as bacteria (e.g., escherichia coli, bacillus subtilis) transformed with recombinant phage DNA, plasmid DNA, or cosmid DNA expression vectors containing antibody coding sequences; yeast such as Saccharomyces (Saccharomyces), Pichia (Pichia)) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant viral expression vectors (e.g., baculovirus) containing antibody coding sequences; plant cell systems infected with recombinant viral expression vectors (e.g., cauliflower mosaic virus (CaMV); Tobacco Mosaic Virus (TMV); or transformed with recombinant plasmid expression vectors containing antibody coding sequences (e.g., Ti plasmid), or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3 cells) carrying recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., the metallothionein promoter) or promoters derived from mammalian viruses (e.g., the adenovirus late promoter, the vaccinia virus 7.5K promoter).

The invention also provides compositions comprising the binding molecules of the invention.

The compositions may include pharmaceutical compositions, immunoconjugates, bispecific molecules.

The pharmaceutical compositions comprise a binding molecule of the invention formulated with a pharmaceutically acceptable carrier.

The pharmaceutical compositions of the present invention may also be administered in combination therapy, i.e., in combination with other agents.

As used herein, "pharmaceutically acceptable carrier" includes any and all physiologically compatible carriers of solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. Preferably, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion).

The pharmaceutical compounds of the present invention may comprise one or more pharmaceutically acceptable salts. "pharmaceutically acceptable salt" refers to a salt that retains the desired biological activity of the parent compound and does not produce any adverse toxicological effects. Examples of such salts include acid addition salts and base addition salts. Acid addition salts include those derived from non-toxic inorganic acids such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous, and the like, as well as those derived from non-toxic organic acids such as aliphatic mono-and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxyalkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids, and the like. Base addition salts include those derived from alkaline earth metals, such as sodium, potassium, magnesium, calcium, and the like, as well as salts derived from non-toxic organic amines, such as N, N' -dibenzylethylenediamine, N-methylglucamine, chloroprocaine, choline, diethanolamine, ethylenediamine, procaine, and the like.

The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable antioxidant. Examples of pharmaceutically acceptable antioxidants include: (1) water-soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, and the like; (2) oil-soluble antioxidants such as ascorbyl palmitate, Butylated Hydroxyanisole (BHA), Butylated Hydroxytoluene (BHT), lecithin, propyl gallate, a-tocopherol, and the like; and (3) metal chelating agents such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

Examples of suitable aqueous and nonaqueous carriers that can be used in the pharmaceutical compositions of the invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of a coating material, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

These compositions may also contain adjuvants such as preserving, wetting, emulsifying, and dispersing agents. Prevention of the presence of microorganisms can be ensured by sterilization procedures, see above, and by the addition of various antibacterial and antifungal agents, such as parabens (parabens), chlorobutanol, phenol, sorbic acid, and the like. It may also be desirable to add isotonic agents, such as sugars, sodium chloride and the like to the compositions. In addition, prolonged absorption of the injectable pharmaceutical form can be brought about by the addition of agents delaying absorption, such as aluminum monostearate and gelatin.

Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The use of such media and agents for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in the pharmaceutical compositions of the invention is contemplated. Supplementary active compounds may also be incorporated into the compositions.

Therapeutic compositions must generally be sterile and stable under the conditions of manufacture and storage. The compositions may be formulated as solutions, microemulsions, liposomes, or other ordered structures suitable for high drug concentrations. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the desired particle size in the case of dispersions, and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the compositions agents delaying absorption, for example, monostearate salts and gelatin.

Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β -galactosidase, or acetylcholinesterase, using techniques known in the art, detectable substances can be coupled or conjugated directly to the binding molecule, or indirectly via an intermediate (e.g., a linker as known in the art), examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin, and examples of suitable fluorescent materials include umbelliferone, fluorescein, isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin, luminescent materials, and the likeExamples of (a) include luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin; examples of suitable radioactive materials include¹²⁵I、¹³¹I、¹¹¹In or⁹⁹Tc。

The binding molecules of the invention can be derivatized or linked to another functional molecule, such as another peptide or protein to generate bispecific molecules that bind to at least two different binding sites or target molecules. The binding molecules of the invention may in fact be derivatized or linked to one or more other functional molecules to generate multispecific molecules that bind to two or more different binding sites and/or target molecules; such multispecific molecules are also intended to be encompassed by the term "bispecific molecule" as used herein. To create a bispecific molecule of the invention, a binding molecule of the invention can be functionally linked (e.g., by chemical coupling, genetic fusion, non-covalent binding, or otherwise) to one or more other binding molecules, such as another antibody, antibody fragment, peptide, or binding mimetic, thereby producing a bispecific molecule.

The bispecific molecules of the invention may be single chain molecules comprising a single chain antibody and a binding determinant, or single chain bispecific molecules comprising two binding determinants. The bispecific molecule may comprise at least two single chain molecules.

The invention provides a method of modulating an immune response in a subject comprising administering to the subject a binding molecule of the invention such that the immune response in the subject is modulated. Preferably, the binding molecules of the invention enhance, stimulate or increase an immune response in a subject.

In another aspect, the invention provides a method of treating SARS-CoV-2 comprising administering to a patient a therapeutically effective amount of a binding molecule of the invention.

In addition, the present invention provides a method of enhancing an immune response to SARS-CoV-2 in a subject, comprising administering to the subject: the binding molecules of the invention allow for an enhanced immune response of a subject against SARS-CoV-2.

The term "immune response" refers to the action of, for example, lymphocytes, antigen presenting cells, phagocytic cells, granulocytes, and soluble macromolecules produced by the above cells or liver (including antibodies, cytokines, and complement), which results in the damage, destruction, or elimination of pathogens invading the human body, cells or tissues infected with pathogens, cancerous cells, or normal human cells or tissues in autoimmune or pathological inflammation.

The term "antibody" as used herein includes whole antibodies and any antigen-binding fragment (i.e., "antigen-binding portion") or single chain thereof, "antibody" refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains, or antigen-binding portions thereof, interconnected by disulfide bonds.

The term "antibody portion" (also referred to as an antigen-binding portion) of an antibody, as used herein, refers to one or more antibody fragments that retain the ability to specifically bind to an antigen it has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody examples of binding fragments encompassed by the term "antigen-binding portion" of an antibody include (i) a Fab fragment, (ii) a F (ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a hinge region disulfide bridge, (iii) a Fd fragment, (iv) an Fv fragment, (V) a dAb fragment, and (vi) an isolated complementarity determining region.

The term "monoclonal antibody" as used herein refers to a preparation of antibody molecules of a single molecular composition. Monoclonal antibody compositions exhibit a single binding specificity and affinity for a particular epitope.

The term "humanized antibody" is intended to refer to an antibody obtained by grafting CDR sequences derived from the germline of another mammalian species, such as a mouse, onto human framework sequences. Additional framework region modifications can be made in the human framework sequences.

The term "chimeric antibody" is intended to refer to an antibody in which the variable region sequences are derived from one species and the constant region sequences are derived from another species, such as an antibody in which the variable region sequences are derived from a mouse antibody and the constant region sequences are derived from a human antibody.

The term "treating" refers to administering an active agent in order to treat, cure, alleviate, alter, remedy, ameliorate, improve or affect a condition (e.g., disease), a symptom of a condition in a statistically significant manner, or to prevent or delay the onset of a symptom, complication, biochemical indicator, or otherwise retard or inhibit further development of a disease, condition, or disorder.

As used herein, the term "subject" includes any human or non-human animal. The term "non-human animal" includes all vertebrates, e.g., mammals and non-mammals, such as non-human primates, sheep, dogs, cats, horses, cows, chickens, amphibians, reptiles, and the like.

The invention also provides a test product comprising a binding molecule as hereinbefore described.

The detection product includes, but is not limited to, a detection reagent, a kit, a chip or a test paper. Any assay product capable of detecting SFTSV which includes the binding molecules described above is included within the scope of the present invention.

The invention also provides a method for detecting SARS-CoV-2 for non-diagnostic purposes, which method comprises the following steps:

(1) obtaining a sample containing SARS-CoV-2;

(2) contacting the sample obtained in step (1) with a binding molecule as described previously;

(3) detecting the binding reaction of the sample with the binding molecule.

The invention also provides the use of a binding molecule as hereinbefore described, said use comprising any one of:

(1) use in the preparation of a test product as hereinbefore described;

(2) use in the preparation of a composition as hereinbefore described;

(3) the application in preparing the medicine for regulating the activity or level of SARS-CoV-2;

(4) the application in preparing the medicine for neutralizing the toxicity of SARS-CoV-2;

(5) the application in preparing the medicine for resisting SARS-CoV-2 infection;

(6) the application in preparing medicine for treating SARS-CoV-2 infection caused diseases.

The invention also provides the use of a composition as hereinbefore described, said use comprising any one of:

(1) the application in preparing the medicine for regulating the activity or level of SARS-CoV-2;

(2) the application in preparing the medicine for neutralizing the toxicity of SARS-CoV-2;

(3) the application in preparing the medicine for resisting SARS-CoV-2 infection;

(4) the application in preparing medicine for treating SARS-CoV-2 infection caused diseases.

The diseases caused by SARS-CoV-2 infection include novel coronavirus pneumonia.

Drawings

FIG. 1 is a graph showing the results of identifying the binding specificity of an anti-SARS-CoV-2-S protein single-chain antibody using Phage-E L ISA;

FIG. 2 is a graph showing the results of the micro-neutralization experiment.

Detailed Description

Embodiments of the present invention will be described in detail with reference to examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples do not show the specific techniques or conditions, and the techniques or conditions are described in the literature in the art (for example, refer to molecular cloning, a laboratory Manual, third edition, scientific Press, written by J. SammBruker et al, Huang Petang et al) or according to the product instructions. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

EXAMPLE 1 screening of anti-SARS-CoV-2 Single chain antibody

Viral culture (all manipulations were carried out in the BS L-3 laboratory)

BetacoV/JS03/human/2020 strain was isolated by the applicant in 2020 from a throat swab of a COVID-19 patient from Jiangsu province. The virus is inoculated with Vero E6 cells and 5% CO after being diluted in a gradient way₂50% tissue infection (50% tissue culture infection dose, TCID50) was determined by incubation at 37 ℃.

II, the S protein (SARS-CoV-2-S protein) of the recombinant expression SARS-CoV-2 is purchased commercially, and the sequence is shown as SEQ ID NO. 49.

Third, ScFv humanized antibody library construction and anti-SARS-CoV-2-S protein single chain antibody screening

1. Material

Primer: family-specific light chain (V κ and V λ), IgG heavy chain (VH) and overlap-PCR primers were designed according to the book Phage Display, with V κ 12, V λ 24, VH 6 and overlap-PCR 1 pairs.

V κ forward primer:

5’-GGGCCCAGGCGGCCGAGCTCCAGATGACCCAGTCTCC-3’；

5’-GGGCCCAGGCGGCCGAGCTCGTGATGACYCAGTCTCC-3’；

5’-GGGCCCAGGCGGCCGAGCTCGTGWTGACRCAGCTCC-3’；

v κ reverse primer:

5’-GGAAGATCTAGAGGAACCACCTTTGATYTCCACCTTGGTCCC-3’；

5’-GGAAGATCTAGAGGAACCACCTTTGATCTCCAGCTTGGTCCC-3’；

5’-GGAAGATCTAGAGGAACCACCTTTAATCTCCAGTCGTGTCCC-3’；

5’-GGAAGATCTAGAGGAACCACCTTTGATATCCACTTTGGTCCC-3’；

v λ forward primer:

5’-GGGCCCAGGCGGCCGAGCTCGTGBTGACGCAGCCGCCCTC-3’；

5’-GGGCCCAGGCGGCCGAGCTCGTGCTGACTCAGCCACCCTC-3’；

5’-GGGCCCAGGCGGCCGAGCTCGCCCTGACTCAGCCTCCCTCCGT-3’；

5’-GGGCCCAGGCGGCCGAGCTCGTGCTGACTCAATCGCCCTC-3’；

5’-GGGCCCAGGCGGCCGAGCTCATGCTGACTCAGCCCCACTC-3’；

5’-GGGCCCAGGCGGCCGAGCTCGTGGTGACYCAGGAGCCMTC-3’；

5’-GGGCCCAGGCGGCCGAGCTCGTGCTGACTCAGCCACCTTC-3’；

5’-GGGCCCAGGCGGCCGAGCTCGGGCAGACTCAGCAGCTCTC-3’；

v λ reverse primer:

5’-GGAAGATCTAGAGGAACCACCGCCTAGGACGGTCASCTTGGTS-3’；

5’-GGAAGATCTAGAGGAACCACCGCCTAAAATGATCAGCTGGGTT-3’；

5’-GGAAGATCTAGAGGAACCACCGCCGAGGACGGTCAGCTSGGTS-3’；

VH forward primer:

5’-GGTGGTTCCTCTAGATCTTCCTCCTCTGGGGCGGTGGCTCGGGC-3’；

5’-GGTGGTTCCTCTAGATCTTCCTCCTCTGGTGGCGGTGGCTCGGG-3’；

5’-GGTGGTTCCTCTAGATCTTCCTCCTCTGTGGCGGTGGCTCGGGC-3’；

5’-GGTGGTTCCTCTGATCTTCCTCCTCGGTGGCGGTGGCTCGGGCG-3’；

5’-GGTGGTTCCTCTAGATCTTCCTCCTCTGGTGGCGGTGGCTCGGC-3’；

5’-GGTGGTTCCTCTAGATCTTCCTCCTCTGGTGGCGGTGGTCGGGC-3’；

VH reverse primer:

5’-CCTGGCCGGCCTGGCCACTAGTGACCGATGGGCCCTTGGTGGAR-3’；

overlap-PCR forward primer:

5’-GAGGAGGAGGAGGAGGAGGCGGGGCCCAGGCGGCCGAGCTC-3’；

overlap-PCR reverse primer:

5’-GAGGAGGAGGAGGAGGAGCCTGGCCGGCCTGGCCACTAGTG-3’；

2. method of producing a composite material

2.2.1 isolation of peripheral blood lymphocytes and Total RNA extraction

Peripheral blood of 2 COVID-19 patients in recovery period is mixed with equal amount of normal saline respectively, then mononuclear cells are sucked according to the instruction of lymphocyte separating medium, and after the mononuclear cells are washed three times by the normal saline, RNA is extracted according to the instruction of a total RNA extraction kit.

2.2.2 PCR amplification of antibody variable region genes

Mixing the extracted 2 parts of total RNA, and carrying out reverse transcription to obtain a first cDNA chain, wherein the reverse transcription conditions are as follows: 30min at 55 ℃, 5min at 85 ℃ and 30min at 4 ℃. Then using cDNA as template to make PCR amplification of humanized antibody V kappa, V lambda and VH gene, under the PCR reaction condition of 94 deg.C pre-denaturation for 10min, then 94 deg.C for 20s,57 deg.C for 45s,72 deg.C for 1min, 25 cycles, finally 72 deg.C extension for 20min, gel electrophoresis and gel cutting, purification and recovery.

2.2.3 splicing of ScFv Gene

Mixing the purified V kappa gene segment and V lambda gene segment in the same molar ratio, mixing with VH gene segment in the same amount, splicing scFv gene by overlap-PCR reaction at 94 deg.c for 10min, pre-denaturing at 94 deg.c for 20s, 45s at 57 deg.c for 1min at 72 deg.c for 25 cycles, extending at 72 deg.c for 20min, gel electrophoresis, cutting gel, purifying and recovering.

2.2.4 construction and quality identification of phage Single chain antibody library

The purified scFv gene and pComb3XSS plasmid are respectively subjected to sfII enzyme digestion, the target fragment obtained after the purification and recovery of the connecting gel is transferred into competent Escherichia coli X L1-Blue, added into 20m L2 YT culture solution to be cultured for 45min at 37 ℃, then centrifuged, the precipitate is smeared on a 2YT plate to be cultured overnight at 30 ℃, the lawn grown on the plate is completely collected in the 2YT culture medium the next day, the culture is carried out at 37 ℃ until the OD600 is 0.8, and the final concentration is added to be 1 × 10⁹Culturing helper phage VCSM of PFU/m L at 1337 deg.C for 1h, adding kanamycin with final concentration of 50 μ g/m L, culturing at 37 deg.C for 8h, centrifuging at 900g for 20min, discarding precipitate, adding 5 × PEG/NaCl into supernatant, mixing, placing on ice for 6h, centrifuging at 900g for 45min, resuspending the precipitate in 3m L PBS, filtering with 0.22 μm filter membrane, collecting filtrate as human phage single chain antibody library, and calculating library capacity and diversity.

2.2.5 screening of anti-SARS-CoV-2-S protein-specific Single chain antibody

Incubating phage library amplified by 200 mu L with SARS-CoV-2-S protein coated by solid phase, performing 4 rounds of 'adsorption-elution-amplification' affinity screening, infecting Escherichia coli X L1-Blue in logarithmic growth phase with eluent in round 4, coating 2 × YT culture plate, culturing overnight at 37 ℃, randomly selecting 100 single colonies, respectively inoculating to 96-well deep-well plate (containing 100 mu g/m L ampicillin, 12.5 mu g/m L tetracycline and 1g/m L glucose), shaking and culturing at 37 ℃ overnight, inoculating to new 96-well deep-well plate (containing 100 mu g/m L ampicillin and 30 mu g/m L tetracycline) at 1: 10 the next day, shaking and culturing at 37 ℃ for 6h, adding auxiliary phage VCSM13 (final concentration of 1 × 10)⁹PFU/M L), incubation for 1h at 37 ℃, adding kanamycin (the final concentration is 50 mug/M L) and shaking for culture at 30 ℃ overnight to prepare Phage single-chain antibody, coating an enzyme label plate with SARS-CoV-2-S protein of 0.1 mug/hole, using PBS buffer (containing 5g/M L skimmed milk powder) to label anti-M13 antibody with HRP diluted by 1:2000 for Phage-E L ISA identification and determination of OD450 value, when Positive/Negative is more than or equal to 2.1, determining as Positive, and sending the Positive cloned bacterial liquid to commercial companies for sequencing.

3. Results

The SARS-CoV-2-S protein is used as antigen to carry out 4 rounds of affinity screening on humanized SARS-CoV-2 single-chain antibody library, anti-SARS-CoV-2-S protein specificity single-chain antibody is selectively enriched, the output/input ratio is improved by nearly 40 times (table 1), 100 Phage single-clones are randomly picked to carry out Phage-E L ISA test and determine OD450 value, the result shows that 20 single-chain antibodies and SARS-CoV-2-S protein can be specifically combined (figure 1), 20 positive clone bacterial liquids are subjected to sequencing analysis to obtain 7 scFv antibodies with different amino acid sequences, which are respectively named as B2, E3, A2, A10, H1, A8 and B6.

The amino acid sequence of the heavy chain variable region CDR1 of the B2 antibody is shown as SEQ ID NO. 1, and the nucleotide sequence is shown as SEQ ID NO. 25; the amino acid sequence of the heavy chain variable region CDR2 is shown in SEQ ID NO. 2, and the nucleotide sequence is shown in SEQ ID NO. 26; the amino acid sequence of CDR3 in the heavy chain variable region is shown in SEQ ID NO. 3, and the nucleotide sequence is shown in SEQ ID NO. 27. The amino acid sequence of CDR1 in the variable region of the light chain is shown as SEQ ID NO. 5, and the nucleotide sequence is shown as SEQ ID NO. 29; the amino acid sequence of CDR2 in the variable region of the light chain is shown as SEQ ID NO. 6, and the nucleotide sequence is shown as SEQ ID NO. 30; the amino acid sequence of CDR3 in the variable region of the light chain is shown in SEQ ID NO. 7, and the nucleotide sequence is shown in SEQ ID NO. 31. The amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 4, the nucleotide sequence is shown as SEQ ID NO. 28, the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 8, and the nucleotide sequence is shown as SEQ ID NO. 32.

The amino acid sequence of CDR1 in the heavy chain variable region of the A10 antibody is shown as SEQ ID NO. 9, and the nucleotide sequence is shown as SEQ ID NO. 33; the amino acid sequence of the heavy chain variable region CDR2 is shown in SEQ ID NO. 10, and the nucleotide sequence is shown in SEQ ID NO. 34; the amino acid sequence of CDR3 in the heavy chain variable region is shown in SEQ ID NO. 11, and the nucleotide sequence is shown in SEQ ID NO. 35. The amino acid sequence of CDR1 in the variable region of the light chain is shown as SEQ ID NO. 13, and the nucleotide sequence is shown as SEQ ID NO. 37; the amino acid sequence of the light chain variable region CDR2 is shown in SEQ ID NO. 14, and the nucleotide sequence is shown in SEQ ID NO. 38; the amino acid sequence of CDR3 in the variable region of the light chain is shown in SEQ ID NO. 15, and the nucleotide sequence is shown in SEQ ID NO. 39. The amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 12, the nucleotide sequence is shown as SEQ ID NO. 36, the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 16, and the nucleotide sequence is shown as SEQ ID NO. 40.

The amino acid sequence of CDR1 in the heavy chain variable region of the E3 antibody is shown as SEQ ID NO. 17, and the nucleotide sequence is shown as SEQ ID NO. 41; the amino acid sequence of the heavy chain variable region CDR2 is shown in SEQ ID NO. 18, and the nucleotide sequence is shown in SEQ ID NO. 42; the amino acid sequence of CDR3 in the heavy chain variable region is shown in SEQ ID NO. 19, and the nucleotide sequence is shown in SEQ ID NO. 43. The amino acid sequence of CDR1 in the variable region of the light chain is shown as SEQ ID NO. 21, and the nucleotide sequence is shown as SEQ ID NO. 45; the amino acid sequence of CDR2 in the variable region of the light chain is shown as SEQ ID NO. 22, and the nucleotide sequence is shown as SEQ ID NO. 46; the amino acid sequence of CDR3 in the variable region of the light chain is shown in SEQ ID NO. 23, and the nucleotide sequence is shown in SEQ ID NO. 47. The amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 20, the nucleotide sequence is shown as SEQ ID NO. 44, the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 24, and the nucleotide sequence is shown as SEQ ID NO. 48.

TABLE 1 enrichment Effect of affinity screening against ScFv antibody specific for SARS-CoV-2-S protein

EXAMPLE 2 detection of neutralizing Activity of Single chain antibody obtained by screening

7 scFv monoclonal antibody micro-neutralization experiments (all manipulations were performed in BS L-3 laboratory).

1. Preparation of phage antibodies

Respectively picking 7 single colonies positive to Phage-E L ISA experiment into 2ml 2 × YT culture medium (containing 100 ug/m L ampicillin, 12.5 ug/m L tetracycline and 1g/m L glucose), shaking and culturing at 37 deg.C overnight, inoculating 1: 10 of the next day into 10ml 2 × YT culture medium (containing 100 ug/m L ampicillin and 30 ug/m L tetracycline), shaking and culturing at 37 deg.C for 6h, adding auxiliary Phage VCSM13 (final concentration is 1 × 10)⁹PFU/m L), incubation for 1h at 37 ℃, adding kanamycin (with the final concentration of 50 mu g/m L), shaking and culturing at 30 ℃ overnight, centrifuging for 30 minutes at 900g, removing the precipitate, adding 5 × PEG/NaCl into the supernatant, mixing uniformly, placing on ice for 6 hours, centrifuging for 30 minutes at 900g, removing the supernatant, resuspending the precipitate with 1ml of PBS, centrifuging for 30 minutes at 900g, adding the supernatant into a dialysis bag, dialyzing for 3 days in PBS buffer solution, filtering with a 0.22 mu m filter membrane, and storing at 4 ℃.

2. Micro-neutralization experimental procedure

(1) Vero cells were seeded in 96-well plates and cultured to logarithmic phase.

(2) 50TCID50 virus (50. mu.l total) was mixed with an equal volume of phage antibody and incubated at 37 ℃ for 1 h.

(3) Add 100. mu.l of antigen-antibody complex into the cell culture well, and set multiple wells, and set positive control group (serum of convalescent patient), negative control group (2 × YT medium) and blank control group (cell only, no virus).

(4) The cell culture was incubated at 37 ℃ with 5% CO₂The cells were cultured in an incubator for 5 days, and Cytopathic effect (CPE) was observed every day. Monoclonal antibodies that inhibit the appearance of more than 50% of CPE are considered to have neutralizing inhibitory effects.

3. Results

The experimental results show that B2, A10 and E3 of 7 ScFv monoclonal antibodies have neutralization inhibition effect on SARS-CoV-2 (figure 2).

Although only specific embodiments of the present invention have been described above, it will be understood by those skilled in the art that these are by way of illustration only, and that the scope of the invention is defined by the appended claims. Various changes or modifications to these embodiments may be made by those skilled in the art without departing from the principle and spirit of the invention, and these changes or modifications are within the scope of the invention.

Sequence listing

<110> Jiangsu province disease prevention and control center (Jiangsu province public health research institute)

<120> an isolated SARS-CoV-2 protein binding molecule for resisting viral infection

<160>49

<170>SIPOSequenceListing 1.0

<210>1

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Gly Phe Thr Phe Asp Asp Tyr Ala

1 5

<210>2

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Ile Ser Trp Asn Gly Gly Ile Ile

1 5

<210>3

<211>16

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>3

Ala Lys Val Gly Glu Val Gly Ser Arg Glu Trp Ser Ala Phe Asp Val

1 5 10 15

<210>4

<211>123

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>4

Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg

1 5 1015

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr

20 25 30

Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ser Gly Ile Ser Trp Asn Gly Gly Ile Ile Gly Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu Tyr Tyr Cys

85 90 95

Ala Lys Val Gly Glu Val Gly Ser Arg Glu Trp Ser Ala Phe Asp Val

100 105 110

Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser

115 120

<210>5

<211>6

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>5

Asn Ile Gly Ser Lys Ser

1 5

<210>6

<211>3

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>6

Asp Asp Ser

1

<210>7

<211>11

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>7

Gln Leu Trp Asp Gly Ser Ser Asp Arg Ala Ile

1 5 10

<210>8

<211>129

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>8

Leu Pro Val Leu Thr Gln Pro Pro Ser Val Ser Val Thr Pro Gly Gln

1 5 10 15

Thr Ala Arg Ile Thr Cys Gly Gly Ser Asn Ile Gly Ser Lys Ser Val

20 25 30

His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Val Tyr

35 40 45

Asp Asp Ser Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser

50 55 60

Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Val Glu Ala Gly

65 70 75 80

Asp Glu Ala Asp Tyr Tyr Cys Gln Leu Trp Asp Gly Ser Ser Asp Arg

85 90 95

Ala Ile Phe Gly Gly Gly Thr Lys Leu Ala Val Leu Gly Gln Pro Lys

100 105 110

Ala Ala Pro Ser Ala Ala Ala Glu Gln Lys Leu Ile Ser Glu Glu Asp

115 120 125

Leu

<210>9

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>9

Gly Tyr Ser Phe Asn Lys Tyr Gly

1 5

<210>10

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>10

Met Asn Pro Asn Ser Gly Asn Thr

1 5

<210>11

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>11

Ala Arg Gly Gly Asn Gly Gly Met Asp Val

1 5 10

<210>12

<211>117

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>12

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Thr Ser Gly Tyr Ser Phe Asn Lys Tyr

20 25 30

Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Met Asn Pro Asn Ser Gly Asn Thr Gly Tyr Ala Gln Lys Phe

50 55 60

Gln Gly Arg Val Thr Met Thr Arg Asn Thr Ser Ile Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Gly Gly Asn Gly Gly Met Asp Val Trp Gly Gln Gly Thr Leu

100 105 110

Val Thr Val Ser Ser

115

<210>13

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>13

Ser Ser Asn Ile Gly Asn Asn Leu

1 5

<210>14

<211>3

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>14

Tyr Asp Asp

1

<210>15

<211>11

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>15

Ala Ala Trp Asp Asp Ile Leu Ser Ala Tyr Val

1 5 10

<210>16

<211>131

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>16

Ser Tyr Glu Leu Thr Gln Pro Pro Ser Val Ser Gly Ala Pro Gly Gln

1 5 10 15

Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Asn Asn

20 25 30

Leu Val Asn Trp Tyr Gln Gln Leu Pro Gly Lys Thr Pro Arg Leu Leu

35 40 45

Ile Tyr Tyr Asp Asp Ile Val Ala Ser Gly Val Ser Asp Arg Phe Ser

50 55 60

Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln

65 70 75 80

Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Asp Ile Leu

85 90 95

Ser Ala Tyr Val Phe Gly Pro Gly Thr Lys Val Thr Val Leu Ser Gln

100 105 110

Pro Lys Ala Ala Pro Ser Ala Ala Ala Glu Gln Lys Leu Ile Ser Glu

115 120 125

Glu Asp Leu

130

<210>17

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>17

Gly Asp Ser Ile Ser Ser Ser Asn Trp

1 5

<210>18

<211>7

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>18

Ile Tyr His Ser Gly Ser Thr

1 5

<210>19

<211>19

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>19

Ala Arg His Asn Ala Gln Phe Gly Glu Leu Leu Val Pro Gln Asp Ala

1 5 10 15

Phe Asp Met

<210>20

<211>141

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>20

Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly

1 5 10 15

Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Asp Ser Ile Ser Ser Ser

20 25 30

Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu

50 55 60

Lys Ser Arg Val Thr Ile Ser Val Asp Met Ser Lys Asp Gln Phe Ser

65 70 75 80

Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys

8590 95

Ala Arg His Asn Ala Gln Phe Gly Glu Leu Leu Val Pro Gln Asp Ala

100 105 110

Phe Asp Met Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser Ala Ser

115 120 125

Pro Thr Ser Pro Lys Val Thr Ser Gly Gln Ala Gly Gln

130 135 140

<210>21

<211>6

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>21

Gln Gln Ile Ser Asn Trp

1 5

<210>22

<211>3

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>22

Asp Ala Ser

1

<210>23

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>23

Gln Gln Tyr Ser Asn Tyr Pro Pro Trp Thr

1 5 10

<210>24

<211>108

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>24

Glu Leu Gln Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gln Ile Ser Asn Trp

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Asn Leu Leu Ile

35 40 45

Tyr Asp Ala Ser Ser Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala

65 70 75 80

Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Ser Asn Tyr Pro Pro

85 90 95

Trp Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys

100 105

<210>25

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>25

ggattcacct ttgatgatta tgcc 24

<210>26

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>26

attagttgga atggtggtat cata 24

<210>27

<211>48

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>27

gcgaaagttg gcgaagtggg tagtagggag tggagtgctt ttgatgtc 48

<210>28

<211>369

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>28

caggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60

tcctgtgcag cctctggatt cacctttgat gattatgcca tgcactgggt ccggcaagct 120

ccagggaagg gcctggagtg ggtctcaggt attagttgga atggtggtat cataggctat 180

gcggactctg tgaagggccg attcaccatc tccagagaca acgccaagaa ctccctgtat 240

ctgcaaatga acagtctgag agctgaggac acggccctat attactgtgc gaaagttggc 300

gaagtgggta gtagggagtg gagtgctttt gatgtctggg gccaagggac cacggtcacc 360

gtctcctca 369

<210>29

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>29

aacattggaa gtaaaagt 18

<210>30

<211>9

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>30

gatgatagc 9

<210>31

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>31

cagctgtggg atggaagcag tgatcgtgcc ata 33

<210>32

<211>387

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>32

ctgcctgtgc tgactcagcc accctcggtg tcagtgaccc caggacagac ggccaggatt 60

acctgtgggg gaagcaacat tggaagtaaa agtgtgcact ggtaccagca gaagccaggc 120

caggcccctg tgctggtcgt ctatgatgat agcgaccggc cctcagggat ccctgagcga 180

ttctctggct ccaactctgg gaacacggcc accctgacca tcagcggagt tgaggccggg 240

gatgaggccg actattactg tcagctgtgg gatggaagca gtgatcgtgc catattcggg 300

ggagggacga agctggccgt cttaggtcag cccaaggctg ccccctcggc ggccgcagaa 360

caaaaactca tctcagagga agatctg 387

<210>33

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>33

ggttacagct ttaacaaata tggc 24

<210>34

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>34

atgaacccta acagtggtaa caca 24

<210>35

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>35

gcgagaggcg gtaacggggg tatggacgtc 30

<210>36

<211>351

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>36

caggtgcagc tggtgcagtc tggagctgag gtgaagaagc ctggggcctc agtgaaggtc 60

tcctgtaaga cttctggtta cagctttaac aaatatggca tcagctgggt gcgacaggcc 120

cctggacaag gacttgagtg gatgggatgg atgaacccta acagtggtaa cacaggctat 180

gcacagaagt tccagggcag agtcaccatg accaggaaca cctccataag cacagcctac 240

atggagctga gcagcctgag atctgaggac acggccgtgt attactgtgc gagaggcggt 300

aacgggggta tggacgtctg gggccaaggc accctggtca ccgtctcctc a 351

<210>37

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>37

agctccaaca tcggaaataa tctt 24

<210>38

<211>9

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>38

tatgatgat 9

<210>39

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>39

gcggcatggg atgacatcct gagtgcttat gtc 33

<210>40

<211>393

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>40

tcctatgagc tgactcagcc accctcggtg tctggggccc ccgggcagag ggtcaccatc 60

tcctgttctg gaagcagctc caacatcgga aataatcttg ttaactggta ccagcagctc 120

ccaggaaaga ctcccagact cctcatctat tatgatgata tcgtggcctc aggggtctct 180

gaccgattct ctggctccaa gtctggcacc tcagcctccc tggccatcag tgggctccag 240

tctgaggatg aggctgatta ttactgtgcg gcatgggatg acatcctgag tgcttatgtc 300

ttcggacctg ggaccaaggt caccgtcctg agtcagccca aggccgcccc ctcggcggcc 360

gcagaacaaa aactcatctc agaggaagat ctg 393

<210>41

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>41

ggtgactcca tcagcagtag caactgg 27

<210>42

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>42

atctatcata gtgggagcac c 21

<210>43

<211>57

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>43

gcgagacata acgcgcaatt cggggaatta ttggttccac aggatgcatt tgatatg 57

<210>44

<211>423

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>44

caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggggac cctgtccctc 60

acctgcgctg tctctggtga ctccatcagc agtagcaact ggtggagttg ggtccgccag 120

cccccaggga aggggctgga gtggattggg gaaatctatc atagtgggag caccaactac 180

aacccgtccc tcaagagccg agtcaccata tcagtagaca tgtccaagga ccagttctcc 240

ctgaagctga gctctgtgac cgccgcggac acggccgtgt attactgtgc gagacataac 300

gcgcaattcg gggaattatt ggttccacag gatgcatttg atatgtgggg ccaggggaca 360

atggtcaccg tctcttcagc atccccgacc agccccaagg tcactagtgg ccaggccggc 420

cag 423

<210>45

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>45

cagcagatta gtaactgg 18

<210>46

<211>9

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>46

gatgcctcc 9

<210>47

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>47

caacagtaca gtaattatcc tccgtggacg 30

<210>48

<211>324

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>48

gagctccaga tgacccagtctccttccacc ctgtctgcat ctgtaggaga cagagtcacc 60

atcacttgcc gggccagtca gcagattagt aactggttgg cctggtatca gcagaaacca 120

gggaaagccc ctaacctcct gatctatgat gcctccagtt tggaaactgg ggtcccgtca 180

aggttcagcg gcagtggatc tgggacagaa ttcactctca ccatcagcag cctgcaggct 240

gatgattttg caacttatta ctgccaacag tacagtaatt atcctccgtg gacgttcggc 300

caagggacca agctggagat caaa 324

<210>49

<211>693

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>49

Met Phe Leu Leu Thr Thr Lys Arg Thr Met Phe Val Phe Leu Val Leu

1 5 10 15

Leu Pro Leu Val Ser Ser Gln Cys Val Asn Leu Thr Thr Arg Thr Gln

20 25 30

Leu Pro Pro Ala Tyr Thr Asn Ser Phe Thr Arg Gly Val Tyr Tyr Pro

35 40 45

Asp Lys Val Phe Arg Ser Ser Val Leu His Ser Thr Gln Asp Leu Phe

50 55 60

Leu Pro Phe Phe Ser Asn Val Thr Trp Phe His Ala Ile His Val Ser

65 70 75 80

Gly Thr Asn Gly Thr Lys Arg Phe Asp Asn Pro Val Leu Pro Phe Asn

85 90 95

Asp Gly Val Tyr Phe Ala Ser Thr Glu Lys Ser Asn Ile Ile Arg Gly

100 105 110

Trp Ile Phe Gly Thr Thr Leu Asp Ser Lys Thr Gln Ser Leu Leu Ile

115 120 125

Val Asn Asn Ala Thr Asn Val Val Ile Lys Val Cys Glu Phe Gln Phe

130 135 140

Cys Asn Asp Pro Phe Leu Gly Val Tyr Tyr His Lys Asn Asn Lys Ser

145 150 155 160

Trp Met Glu Ser Glu Phe Arg Val Tyr Ser Ser Ala Asn Asn Cys Thr

165 170 175

Phe Glu Tyr Val Ser Gln Pro Phe Leu Met Asp Leu Glu Gly Lys Gln

180 185 190

Gly Asn Phe Lys Asn Leu Arg Glu Phe Val Phe Lys Asn Ile Asp Gly

195 200 205

Tyr Phe Lys Ile Tyr Ser Lys His Thr Pro Ile Asn Leu Val Arg Asp

210 215 220

Leu Pro Gln Gly Phe Ser Ala Leu Glu Pro Leu Val Asp Leu Pro Ile

225 230 235 240

Gly Ile Asn Ile Thr Arg Phe Gln Thr Leu Leu Ala Leu His Arg Ser

245 250 255

Tyr Leu Thr Pro Gly Asp Ser Ser Ser Gly Trp Thr Ala Gly Ala Ala

260 265 270

Ala Tyr Tyr Val Gly Tyr Leu Gln Pro Arg Thr Phe Leu Leu Lys Tyr

275 280 285

Asn Glu Asn Gly Thr Ile Thr Asp Ala Val Asp Cys Ala Leu Asp Pro

290 295 300

Leu Ser Glu Thr Lys Cys Thr Leu Lys Ser Phe Thr Val Glu Lys Gly

305 310 315 320

Ile Tyr Gln Thr Ser Asn Phe Arg Val Gln Pro Thr Glu Ser Ile Val

325 330 335

Arg Phe Pro Asn Ile Thr Asn Leu Cys Pro Phe Gly Glu Val Phe Asn

340 345 350

Ala Thr Arg Phe Ala Ser Val Tyr Ala Trp Asn Arg Lys Arg Ile Ser

355 360 365

Asn Cys Val Ala Asp Tyr Ser Val Leu Tyr Asn Ser Ala Ser Phe Ser

370 375 380

Thr Phe Lys Cys Tyr Gly Val Ser Pro Thr Lys Leu Asn Asp Leu Cys

385 390 395 400

Phe Thr Asn Val Tyr Ala Asp Ser Phe Val Ile Arg Gly Asp Glu Val

405 410 415

Arg Gln Ile Ala Pro Gly Gln Thr Gly Lys Ile Ala Asp Tyr Asn Tyr

420 425 430

Lys Leu Pro Asp Asp Phe Thr Gly Cys Val Ile Ala Trp Asn Ser Asn

435 440 445

Asn Leu Asp Ser Lys Val Gly Gly Asn Tyr Asn Tyr Leu Tyr Arg Leu

450 455 460

Phe Arg Lys Ser Asn Leu Lys Pro Phe Glu Arg Asp Ile Ser Thr Glu

465 470 475 480

Ile Tyr Gln Ala Gly Ser Thr Pro Cys Asn Gly Val Glu Gly Phe Asn

485 490 495

Cys Tyr Phe Pro Leu Gln Ser Tyr Gly Phe Gln Pro Thr Asn Gly Val

500 505 510

Gly Tyr Gln Pro Tyr Arg Val Val Val Leu Ser Phe Glu Leu Leu His

515 520 525

Ala Pro Ala Thr Val Cys Gly Pro Lys Lys Ser Thr Asn Leu Val Lys

530 535 540

Asn Lys Cys Val Asn Phe Asn Phe Asn Gly Leu Thr Gly Thr Gly Val

545 550 555 560

Leu Thr Glu Ser Asn Lys Lys Phe Leu Pro Phe Gln Gln Phe Gly Arg

565570 575

Asp Ile Ala Asp Thr Thr Asp Ala Val Arg Asp Pro Gln Thr Leu Glu

580 585 590

Ile Leu Asp Ile Thr Pro Cys Ser Phe Gly Gly Val Ser Val Ile Thr

595 600 605

Pro Gly Thr Asn Thr Ser Asn Gln Val Ala Val Leu Tyr Gln Asp Val

610 615 620

Asn Cys Thr Glu Val Pro Val Ala Ile His Ala Asp Gln Leu Thr Pro

625 630 635 640

Thr Trp Arg Val Tyr Ser Thr Gly Ser Asn Val Phe Gln Thr Arg Ala

645 650 655

Gly Cys Leu Ile Gly Ala Glu His Val Asn Asn Ser Tyr Glu Cys Asp

660 665 670

Ile Pro Ile Gly Ala Gly Ile Cys Ala Ser Tyr Gln Thr Gln Thr Asn

675 680 685

Ser Pro Arg Arg Ala

690

Claims (10)

1. An isolated SARS-CoV-2 protein binding molecule that is resistant to viral infection, said binding molecule comprising:

a heavy chain variable region CDR1 comprising an amino acid sequence selected from SEQ ID NOs 1, 9, and 17 and conservatively modified amino acid sequences thereof;

a heavy chain variable region CDR2 comprising an amino acid sequence selected from SEQ ID NOs:2, 10, and 18 and conservatively modified amino acid sequences thereof;

a heavy chain variable region CDR3 comprising an amino acid sequence selected from SEQ ID NOs 3, 11, and 19 and conservatively modified amino acid sequences thereof;

a light chain variable region CDR1 comprising an amino acid sequence selected from SEQ ID NOs 5, 13, and 21 and conservatively modified amino acid sequences thereof;

a light chain variable region CDR2 comprising an amino acid sequence selected from SEQ ID NOs 6, 14, and 22 and conservatively modified amino acid sequences thereof;

a light chain variable region CDR3 comprising an amino acid sequence selected from SEQ ID NOs:7, 15, and 23 and conservatively modified amino acid sequences thereof.

2. The binding molecule of claim 1, wherein the binding molecule comprises:

a heavy chain variable region comprising an amino acid sequence at least 80% homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs:4, 12, and 20;

a light chain variable region comprising an amino acid sequence at least 80% homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs 8, 16, and 24.

3. The binding molecule of claim 1, wherein the binding molecule comprises a chimeric, humanized or fully human antibody or portion thereof; preferably, the portion of the antibody comprises a Fab, a F (ab')2, an Fv fragment, or an scFv.

4. A nucleic acid encoding the binding molecule of any one of claims 1-3; preferably, the nucleic acid sequence is as shown in SEQ ID NOs: 25-48.

5. A recombinant vector comprising the nucleic acid of claim 4.

6. A host cell comprising the nucleic acid of claim 4 or the recombinant vector of claim 5.

7. A composition or assay product comprising the binding molecule of any one of claims 1-3.

8. A method for detecting SARS-CoV-2 virus for non-diagnostic purposes, said method comprising the steps of:

(1) obtaining a sample containing SARS-CoV-2 virus;

(2) contacting the sample obtained in step (1) with a binding molecule according to any one of claims 1 to 3;

(3) detecting binding of a sample to the binding molecule of any one of claims 1 to 3.

9. Use of the binding molecule of any one of claims 1 to 3, comprising any one of:

(1) use in the preparation of a composition or assay product according to claim 7;

(2) the application in preparing the medicine for regulating the activity or level of SARS-CoV-2;

(3) the application in preparing the medicine for neutralizing the toxicity of SARS-CoV-2;

(4) the application in preparing the medicine for resisting SARS-CoV-2 infection;

(5) the application in preparing medicine for treating SARS-CoV-2 infection caused diseases.

10. Use of the composition of claim 7, comprising any one of:

(1) the application in preparing the medicine for regulating the activity or level of SARS-CoV-2;

(2) the application in preparing the medicine for neutralizing the toxicity of SARS-CoV-2;

(3) the application in preparing the medicine for resisting SARS-CoV-2 infection;

(4) the application in preparing medicine for treating SARS-CoV-2 infection caused diseases.

Images