CN111333722A - SARS-CoV-2 inhibitor and its application - Google Patents

Abstract

The invention relates to a SARS-CoV-2 inhibitor and its application, in particular to a neutralizing antibody aiming at SARS-CoV-2 and its application. The invention adopts the phage display technology to construct a high-capacity human immune phage antibody library, and takes SARS-CoV-2-S protein as a target to screen human antibody single-chain antibody fragments and obtain an antibody with stronger neutralization function on SARS-CoV-2 virus. The antibody of the invention can be used for treating diseases caused by novel coronavirus infection, and has important clinical application value.

Description

SARS-CoV-2 inhibitor and its application

Technical Field

The invention belongs to the field of cellular immunology, and particularly relates to a neutralizing antibody for SARS-CoV-2 and application thereof.

Background

The novel coronavirus pneumonia (Corona Virus Disease 2019, COVID-19) is called new coronavirus pneumonia for short, and is pneumonia caused by SARS-CoV-2 Virus infection, respiratory droplet propagation is a main propagation path, the possibility of aerosol propagation exists under the condition of long-time exposure to high-concentration aerosol in a relatively closed environment, and other propagation paths are yet to be determined; the population is generally susceptible, and the incubation period is 1-14 days, generally 3-7 days. Clinical types include asymptomatic infected, light, normal, heavy and critical, with a poorer prognosis in the elderly and in the cases with underlying disease, and with relatively mild symptoms in children. 78630 and 2747 confirmed cases and 2747 death cases are reported in the national accumulation manner by 2, 27 and 11 in 2020; at present, there are also reports on Japan, Korea, Iran, Italy, the United states, etc., and COVID-19 has posed a serious threat to human health worldwide.

The SARS-CoV-2 as the pathogen of coronavirus pneumonia belongs to the family of coronavirus β, and is linear positive-strand RNA virus, it is found that SARS-CoV-2 is adjacent to SARS-CoV and SARS-CoV-like groups at the position of evolutionary tree, and there are 4 main structural proteins of the novel coronavirus, spike protein (S protein), nucleocapsid protein (N protein), membrane protein (M protein), envelope protein (E protein), S protein contains two subunits, S1 and S2, S1 includes N-terminal domain and C-terminal RBD domain, S-RBD interacts with human ACE2 to infect human respiratory epithelial cells, which plays an important role for virus infection, is an important site of action of neutralizing antibody in host and key point of designing CoVial-19, spreading rapidly, emergency, no effective control case, no effective vaccine is used for human ACE2 to infect human respiratory epithelial cells, and no effective therapeutic effect is achieved by clinical therapy of human CoVID-19, and no effective therapeutic effect is achieved by clinical therapy of CoVID-19.

The patent adopts phage display technology to construct a high-capacity humanized immune phage antibody library, and uses SARS-CoV-2-S protein as a target to screen humanized antibody single-chain antibody fragments (ScFv) to obtain several humanized ScFv antibody molecules. Further experimental research shows that the monoclonal antibody has strong neutralizing effect on SARS-CoV-2 virus, and the application provides candidate antibody for immunotherapy of new coronary pneumonia, and has important clinical application value.

Disclosure of Invention

The invention aims to provide a neutralizing antibody or an antigen binding fragment thereof of SARS-CoV-2 virus, wherein the antibody or the antigen binding fragment thereof takes SARS-CoV-2-S protein of the virus as a target, and the sequence of the SARS-CoV-2-S protein is SEQ ID NO. 1.

Further, the neutralizing antibody or antigen binding fragment thereof comprises a light chain CDR1, a light chain CDR2, a light chain CDR3, a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR 3;

the amino acid sequence of heavy chain CDR1 is selected from one of the following sequences: SEQ ID No.2, SEQ ID No.3, SEQ ID No.4 or SEQ ID No. 5;

the amino acid sequence of heavy chain CDR2 is selected from one of the following sequences: SEQ ID No.6, SEQ ID No.7, SEQ ID No.8 or SEQ ID No. 9;

the amino acid sequence of heavy chain CDR3 is selected from one of the following sequences: SEQ ID No.10, SEQ ID No.11, SEQ ID No.12 or SEQ ID No. 13;

the amino acid sequence of light chain CDR1 is selected from one of the following sequences: SEQ ID No.14, SEQ ID No.15, SEQ ID No.16 or SEQ ID No. 17;

the amino acid sequence of light chain CDR2 is selected from one of the following sequences: SEQ ID No.18, SEQ ID No.19, SEQ ID No.20 or SEQ ID No. 21;

the amino acid sequence of light chain CDR3 is selected from one of the following sequences: SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24 or SEQ ID NO. 25.

Preferably, the amino acid sequences of the heavy chain CDR1, CDR2 and CDR3 are respectively SEQ ID NO.2, SEQ ID NO.6 and SEQ ID NO.10, and the amino acid sequences of the light chain CDR1, CDR2 and CDR3 are respectively SEQ ID NO.14, SEQ ID NO.18 and SEQ ID NO. 22;

or the amino acid sequences of the heavy chain CDR1, CDR2 and CDR3 are respectively SEQ ID NO.3, SEQ ID NO.7 and SEQ ID NO.11, and the amino acid sequences of the light chain CDR1, CDR2 and CDR3 are respectively SEQ ID NO.15, SEQ ID NO.19 and SEQ ID NO. 23;

or the amino acid sequences of the heavy chain CDR1, CDR2 and CDR3 are respectively SEQ ID NO.4, SEQ ID NO.8 and SEQ ID NO.12, and the amino acid sequences of the light chain CDR1, CDR2 and CDR3 are respectively SEQ ID NO.16, SEQ ID NO.20 and SEQ ID NO. 24;

or the amino acid sequences of the heavy chain CDR1, the CDR2 and the CDR3 are respectively SEQ ID NO.5, SEQ ID NO.9 and SEQ ID NO.13, and the amino acid sequences of the light chain CDR1, the CDR2 and the CDR3 are respectively SEQ ID NO.17, SEQ ID NO.21 and SEQ ID NO. 25.

Further, the amino acid sequence of the heavy chain variable region of the neutralizing antibody or antigen-binding fragment thereof is selected from one of the following sequences: SEQ ID No.26, SEQ ID No.28, SEQ ID No.30 or SEQ ID No. 32; the amino acid sequence of the light chain variable region is selected from one of the following sequences: SEQ ID NO.27, SEQ ID NO.29, SEQ ID NO.31 or SEQ ID NO. 33.

Preferably, the amino acid sequence of the heavy chain variable region of the neutralizing antibody or antigen binding fragment thereof is SEQ ID No.26, and the amino acid sequence of the light chain variable region is SEQ ID No. 27; or the amino acid sequence of the heavy chain variable region of the neutralizing antibody is SEQ ID NO.28, and the amino acid sequence of the light chain variable region of the neutralizing antibody is SEQ ID NO. 29; the amino acid sequence of the heavy chain variable region of the neutralizing antibody is SEQ ID NO.30, and the amino acid sequence of the light chain variable region is SEQ ID NO. 31; the amino acid sequence of the heavy chain variable region of the neutralizing antibody is SEQ ID NO.32, and the amino acid sequence of the light chain variable region is SEQ ID NO. 33.

Antibodies that include conservative sequence variants of the amino acid sequence of the antibody are also included within the scope of the invention. Conservative amino acid sequence variants include modifications to the amino acid sequence that do not significantly alter the properties of the neutralizing antibodies of the invention, such as variants resulting from similar amino acid substitutions, deletions of amino acids, or additions as are well known in the art.

The neutralizing antibody of the present invention also includes human and non-human antibodies, and all antibodies having the same function as the above neutralizing antibody or modified and optimized.

Further, the antigen-binding fragment of the neutralizing antibody includes Fab, Fab ', F (ab') 2, Fv, or single chain antibody.

Fab refers to the portion of an antibody molecule that contains one light chain variable and constant region and one heavy chain variable and constant region that are disulfide bonded.

Fab' refers to a Fab fragment that contains part of the hinge region.

F (ab ') 2 refers to a dimer of Fab'.

Fv refers to the smallest antibody fragment containing the variable regions of the antibody heavy and light chains and having all antigen binding sites.

The single-chain antibody refers to an engineered antibody formed by connecting a light chain variable region and a heavy chain variable region directly or through a peptide chain.

The disclosed neutralizing antibodies of the present invention may comprise one or more glycosylation sites in the heavy and light chain variable regions, as is well known in the art, and the presence of one or more glycosylation sites in the variable regions may result in enhanced immunogenicity of the antibody, or alter the pharmacokinetics of the antibody due to altered antigen binding.

The neutralizing antibodies of the invention can be designed to contain modifications within the Fc region, typically to alter 1 or more functional properties of the antibody, such as serum half-life, complement fixation, Fc receptor binding, and/or antigen-dependent cellular cytotoxicity. In addition, the antibodies of the invention may be chemically modified (e.g., one or more chemical groups may be attached to the antibody), or modified to alter glycosylation thereof, thereby altering one or more functional properties of the antibody.

Another modification that the neutralizing antibodies of the present invention may be designed to be pegylated. Antibodies can be pegylated, for example, to increase the biological (e.g., serum) half-life of the antibody. To pegylate an antibody, the antibody or fragment thereof is typically reacted with polyethylene glycol (PEG), such as an active ester or aldehyde derivative of polyethylene glycol, under conditions suitable for attachment of one or more PEG groups to the antibody or antibody fragment. Preferably, the pegylation is achieved by acylation or alkylation with a reactive PEG molecule (or similar reactive water-soluble polymer).

The invention also provides a nucleic acid molecule encoding a neutralizing antibody or antigen-binding fragment thereof as described above, comprising a nucleotide sequence encoding a light chain variable region of the neutralizing antibody, a nucleotide sequence encoding a heavy chain of the neutralizing antibody, or a nucleotide sequence encoding a light chain of the neutralizing antibody.

The nucleic acid molecules of the invention encoding the neutralizing antibodies or antigen-binding fragments thereof described above include nucleic acid molecules having conservative nucleotide sequence variants of preferred nucleotide sequences. So-called conservative nucleotide sequence variants arise from degenerate and silent variants of the genetic code, and substitutions, deletions and additions of nucleotides are also included.

Specifically, the nucleic acid sequence encoding heavy chain CDR1 is selected from one of the following sequences: SEQ ID No.34, SEQ ID No.35, SEQ ID No.36 or SEQ ID No. 37;

the nucleic acid sequence encoding heavy chain CDR2 is selected from one of the following sequences: SEQ ID No.38, SEQ ID No.39, SEQ ID No.40 or SEQ ID No. 41;

the nucleic acid sequence encoding heavy chain CDR3 is selected from one of the following sequences: SEQ ID No.42, SEQ ID No.43, SEQ ID No.44 or SEQ ID No. 45;

the nucleic acid sequence encoding the light chain CDR1 is selected from one of the following sequences: SEQ ID No.54, SEQ ID No.55, SEQ ID No.56 or SEQ ID No. 57;

the nucleic acid sequence encoding the light chain CDR2 is selected from one of the following sequences: SEQ ID No.58, SEQ ID No.59, SEQ ID No.60 or SEQ ID No. 61;

the nucleic acid sequence encoding the light chain CDR3 is selected from one of the following sequences: SEQ ID NO.62, SEQ ID NO.63, SEQ ID NO.64 or SEQ ID NO. 65.

Preferably, the nucleic acid sequences encoding the heavy chain CDR1, CDR2, CDR3 are SEQ ID No.34, SEQ ID No.38, SEQ ID No.42, respectively, and the nucleic acid sequences encoding the light chain CDR1, CDR2, CDR3 are SEQ ID No.54, SEQ ID No.58, SEQ ID No.62, respectively;

or the nucleic acid sequences of the heavy chain CDR1, CDR2 and CDR3 are respectively SEQ ID NO.35, SEQ ID NO.39 and SEQ ID NO.43, and the nucleic acid sequences of the light chain CDR1, CDR2 and CDR3 are respectively SEQ ID NO.55, SEQ ID NO.59 and SEQ ID NO. 63;

or the nucleic acid sequences of the heavy chain CDR1, CDR2 and CDR3 are respectively SEQ ID NO.36, SEQ ID NO.40 and SEQ ID NO.44, and the nucleic acid sequences of the light chain CDR1, CDR2 and CDR3 are respectively SEQ ID NO.56, SEQ ID NO.60 and SEQ ID NO. 64;

or the nucleic acid sequences of the heavy chain CDR1, CDR2 and CDR3 are respectively SEQ ID NO.37, SEQ ID NO.41 and SEQ ID NO.45, and the nucleic acid sequences of the light chain CDR1, CDR2 and CDR3 are respectively SEQ ID NO.57, SEQ ID NO.61 and SEQ ID NO. 65.

Further, the nucleic acid sequence of the heavy chain variable region of the neutralizing antibody or antigen-binding fragment thereof is selected from one of the following sequences: SEQ ID No.46, SEQ ID No.48, SEQ ID No.50 or SEQ ID No. 52; the variable region of the light chain has a nucleic acid sequence selected from one of the following sequences: SEQ ID NO.47, SEQ ID NO.49, SEQ ID NO.51 or SEQ ID NO. 53.

Preferably, the nucleic acid sequence of the heavy chain variable region of the neutralizing antibody or antigen binding fragment thereof is SEQ ID No.46, and the nucleic acid sequence of the light chain variable region is SEQ ID No. 47; or the nucleic acid sequence of the heavy chain variable region of the neutralizing antibody is SEQ ID NO.48, and the nucleic acid sequence of the light chain variable region is SEQ ID NO. 49; the nucleic acid sequence of the heavy chain variable region of the neutralizing antibody is SEQ ID NO.50, and the nucleic acid sequence of the light chain variable region is SEQ ID NO. 51; the nucleic acid sequence of the heavy chain variable region of the neutralizing antibody is SEQ ID NO.52, and the nucleic acid sequence of the light chain variable region is SEQ ID NO. 53.

The present invention also provides a recombinant vector comprising the nucleic acid molecule as described above, and further comprising an expression control sequence operably linked to the sequence of the nucleic acid molecule.

The term "vector" as used herein refers to a nucleic acid delivery vehicle into which a polynucleotide encoding a protein can be inserted to allow expression of the protein. The vector may be transformed, transduced or transfected into a host cell so that the genetic material elements it carries are expressed within the host cell. By way of example, the carrier includes: a plasmid; phagemid; a cosmid; artificial chromosomes such as Yeast Artificial Chromosomes (YACs), Bacterial Artificial Chromosomes (BACs), or artificial chromosomes (PACs) derived from P1; bacteriophage such as lambda phage or M13 phage, animal virus, etc. Animal virus species used as vectors are retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papilloma viruses, papilloma vacuolium viruses (e.g., SV 40). A vector may contain a variety of elements that control expression, including promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector may contain a replication initiation site. The vector may also include components which assist its entry into the cell, such as viral particles, liposomes or protein coats, but not exclusively.

The present invention also provides a recombinant cell into which the nucleic acid molecule or the recombinant vector as described above has been introduced.

The term "recombinant cell" as used herein refers to a cell into which a nucleic acid molecule or vector is introduced, and includes many cell types, such as prokaryotic cells of Escherichia coli or Bacillus subtilis, fungal cells such as yeast cells or Aspergillus, insect cells such as S2 Drosophila cells or Sf9, or animal cells such as fibroblast, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells, HEK293 cells or human cells.

The invention also provides a method of producing an antibody or antigen-binding fragment using a recombinant cell as hereinbefore described, the method comprising culturing a recombinant cell as hereinbefore described under suitable conditions and recovering the antibody.

The invention also provides an antibody or antigen-binding fragment produced by the above method.

The invention also provides a product for detection comprising a neutralising antibody or antigen-binding fragment thereof as hereinbefore described.

The product for detection includes, but is not limited to, a detection reagent, a kit, a chip or a test paper. All products capable of detecting SARS-CoV-2-S are included within the scope of the invention.

The invention also provides a pharmaceutical composition comprising a therapeutically effective amount of the aforementioned neutralizing antibody or antigen-binding fragment thereof of the invention.

Further, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or diluent. The pharmaceutical compositions according to the invention may be administered for therapy with any suitable pharmaceutical carrier.

For parenteral and topical administration, the pharmaceutical compositions of the present invention include sterile aqueous or nonaqueous solvents, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils, fish oils, and injectable organic esters. Aqueous carriers include water, water-ethanol solutions, including saline and buffered, typical parenteral carriers, including sodium chloride solution, ringer's dextrose solution, dextrose plus sodium chloride solution, ringer's solution with lactose, or nonvolatile oils. Intravenous vehicles include fluid and nutritional supplements, electrolyte supplements such as those based on ringer's dextrose and the like. The composition may include other excipients, such as stabilizing agents or preservatives. Useful stabilizing excipients include surfactants (polysorbate 20&80, poloxamer 407), polymers (polyethylene glycol, povidone), sugars (sucrose, mannitol, glucose, lactose), alcohols (sorbitol, glycerol propylene glycol, ethylene glycol), appropriate proteins (albumin), appropriate amino acids (glycine, glutamic acid), fatty acids (ethanolamine), antioxidants (ascorbic acid, cysteine, etc.), chelating agents (EDTA salts, histidine, aspartic acid) or metal ions (calcium, nickel, magnesium, manganese). Useful preservatives are benzyl alcohol, chlorobutanol, benzalkonium chloride, and also parabens.

The pharmaceutical composition according to the invention may be provided in a concentrated form or in the form of a powder to be reconstituted as desired. Such powders may use the excipients mentioned above. In the case of freeze-drying, certain cryoprotectants are preferred, including polymers (povidone, polyethylene glycol, dextran), sugars (sucrose, glucose, lactose), amino acids (glycine, arginine, glutamic acid) and albumin.

The invention also provides the use of a neutralising antibody or antigen-binding fragment thereof as hereinbefore described, which comprises any one of:

(1) use in the preparation of a test product as hereinbefore described;

(2) use in the preparation of a pharmaceutical composition as hereinbefore described;

(3) the application in preparing the medicine for neutralizing the toxicity of SARS-CoV-2;

(4) the application in preparing the medicine for resisting SARS-CoV-2 infection;

(5) the application in preparing medicine for treating SARS-CoV-2 infection caused diseases.

The invention also provides the use of the pharmaceutical composition as described above, which comprises any one of the following:

(1) the application in preparing the medicine for neutralizing the toxicity of SARS-CoV-2;

(2) the application in preparing the medicine for resisting SARS-CoV-2 infection;

(3) the application in preparing medicine for treating SARS-CoV-2 infection caused diseases.

The neutralizing antibodies or antigen-binding fragments thereof of the present invention described above may be conjugated to other agents chemically or by genetic engineering. These factors provide the function of targeting the antibody to a desired functional site or enhance or provide other properties to the antibody.

The neutralizing antibodies according to the invention may be labeled chemically or by genetic engineering to provide detectable antibodies.

"treatment" of the invention is intended to include administration of an antibody that specifically binds to SARS-CoV-2 to a subject for the purpose of improving, treating or preventing the disease.

A "therapeutically effective amount" according to the present invention is a level at which at least an improvement in the detrimental effects of the disease is achieved. The skilled artisan can readily determine the amount and regimen of administration of the monoclonal antibodies of the invention.

The invention has the advantages and beneficial effects that:

the invention provides a new monoclonal antibody for treating new coronary pneumonia, which takes SARS-CoV-2-S protein of virus as a target, has high affinity and neutralization capacity, can realize production standardization, has simple quality control and other competitive advantages.

Drawings

FIG. 1 is a diagram showing the binding specificity of a single-chain antibody for identifying anti-SARS-CoV-2-S protein by Phage-ELISA;

FIG. 2 is a graph showing the results of a microneutralization experiment for candidate antibodies.

Detailed Description

Embodiments of the present invention will be described in detail with reference to examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples do not show the specific techniques or conditions, and the techniques or conditions are described in the literature in the art (for example, refer to molecular cloning, a laboratory Manual, third edition, scientific Press, written by J. SammBruker et al, Huang Petang et al) or according to the product instructions. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

EXAMPLE 1 cultivation of Virus and Material preparation

SARS-CoV-2 virus was isolated from the acute peripheral blood of one Jiangsu patient in 2020 by the patent applicant. The virus was inoculated into Vero cells and then incubated at 37 ℃ with 5% CO₂Was cultured for 5 days under the conditions of (1), and the supernatant was collected and 50% of the tissue infection amount (50% tissue culture in) was determinedfective dose，TCID₅₀). All manipulations were performed in the BSL-3 laboratory.

Recombinant S protein (SARS-CoV-2-S), purchased commercially, and the sequence is shown in SEQ ID NO. 1.

Example 2 ScFv human antibody library construction and screening of anti-SARS-CoV-2-S protein Single chain antibody

2.1 materials

Primer: family-specific light chain (V.kappa.and V.lambda.), IgG heavy chain (VH) and overlap-PCR primers were designed according to the book Phage Display, wherein V.kappa.12, V.lambda.24, VH 6 and overlap-PCR1 were used.

Primers for constructing a human single-chain antibody library:

Vκforward primers：

5'GGGCCCAGGCGGCCGAGCTCCAGATGACCCAGTCTCC 3'(SEQ ID NO.66)

5'GGGCCCAGGCGGCCGAGCTCGTGATGACYCAGTCTCC 3'(SEQ ID NO.67)

5'GGGCCCAGGCGGCCGAGCTCGTGWTGACRCAGCTCC 3'(SEQ ID NO.68)

Vκreverse primers:

5'GGAAGATCTAGAGGAACCACCTTTGATYTCCACCTTGGTCCC 3'(SEQ ID NO.69)

5'GGAAGATCTAGAGGAACCACCTTTGATCTCCAGCTTGGTCCC 3'(SEQ ID NO.70)

5'GGAAGATCTAGAGGAACCACCTTTAATCTCCAGTCGTGTCCC 3'(SEQ ID NO.71)

5'GGAAGATCTAGAGGAACCACCTTTGATATCCACTTTGGTCCC 3'(SEQ ID NO.72)

Vλforward primers:

5'GGGCCCAGGCGGCCGAGCTCGTGBTGACGCAGCCGCCCTC3’(SEQ ID NO.73)

5'GGGCCCAGGCGGCCGAGCTCGTGCTGACTCAGCCACCCTC3’(SEQ ID NO.74)

5'GGGCCCAGGCGGCCGAGCTCGCCCTGACTCAGCCTCCCTCCGT3’(SEQ ID NO.75)

5'GGGCCCAGGCGGCCGAGCTCGTGCTGACTCAATCGCCCTC3’(SEQ ID NO.76)

5'GGGCCCAGGCGGCCGAGCTCATGCTGACTCAGCCCCACTC3’(SEQ ID NO.77)

5'GGGCCCAGGCGGCCGAGCTCGTGGTGACYCAGGAGCCMTC3’(SEQ ID NO.78)

5'GGGCCCAGGCGGCCGAGCTCGTGCTGACTCAGCCACCTTC3’(SEQ ID NO.79)

5'GGGCCCAGGCGGCCGAGCTCGGGCAGACTCAGCAGCTCTC3’(SEQ ID NO.80)

Vλreverse primers:

5'GGAAGATCTAGAGGAACCACCGCCTAGGACGGTCASCTTGGTS3’(SEQ ID NO.81)

5'GGAAGATCTAGAGGAACCACCGCCTAAAATGATCAGCTGGGTT3’(SEQ ID NO.82)

5'GGAAGATCTAGAGGAACCACCGCCGAGGACGGTCAGCTSGGTS3’(SEQ ID NO.83)

VH forward primers:

5’GGTGGTTCCTCTAGATCTTCCTCCTCTGGGGCGGTGGCTCGGGC3'(SEQ ID NO.84)

5’GGTGGTTCCTCTAGATCTTCCTCCTCTGGTGGCGGTGGCTCGGG3'(SEQ ID NO.85)

5’GGTGGTTCCTCTAGATCTTCCTCCTCTGTGGCGGTGGCTCGGGC3’(SEQ ID NO.86)

5’GGTGGTTCCTCTGATCTTCCTCCTCGGTGGCGGTGGCTCGGGCG3’(SEQ ID NO.87)

5’GGTGGTTCCTCTAGATCTTCCTCCTCTGGTGGCGGTGGCTCGGC3’(SEQ ID NO.88)

5’GGTGGTTCCTCTAGATCTTCCTCCTCTGGTGGCGGTGGTCGGGC3’(SEQ ID NO.89)

VH reverse Primers:

5'CCTGGCCGGCCTGGCCACTAGTGACCGATGGGCCCTTGGTGGAR3'(SEQ ID NO.90)

overlap-PCR forward primers:

5'GAGGAGGAGGAGGAGGAGGCGGGGCCCAGGCGGCCGAGCTC3’(SEQ ID NO.91)

overlap-PCR reverse primers:

5'GAGGAGGAGGAGGAGGAGCCTGGCCGGCCTGGCCACTAGTG3’(SEQ ID NO.92)

2.2 methods

2.2.1 isolation of peripheral blood lymphocytes and Total RNA extraction

Peripheral blood of 2 COVID-19 patients in recovery period is mixed with equal amount of normal saline respectively, then mononuclear cells are sucked according to the instruction of lymphocyte separating medium, and after the mononuclear cells are washed three times by the normal saline, RNA is extracted according to the instruction of a total RNA extraction kit.

2.2.2 PCR amplification of antibody variable region genes

Mixing the extracted 2 parts of total RNA, and carrying out reverse transcription to obtain a first cDNA chain, wherein the reverse transcription conditions are as follows: 30min at 55 ℃, 5min at 85 ℃ and 30min at 4 ℃. Then using cDNA as template to make PCR amplification of humanized antibody V kappa, V lambda and VH gene, and the PCR reaction condition is as follows: pre-denaturation at 94 deg.C for 10min, then at 94 deg.C for 20s, at 57 deg.C for 45s, at 72 deg.C for 1min, for 25 cycles, finally at 72 deg.C for 20min extension, gel electrophoresis and gel cutting, purification and recovery.

2.2.3 splicing of ScFv Gene

Mixing the purified V kappa gene fragment and the V lambda gene fragment in an equimolar way, then mixing the mixture with the VH gene fragment in an equivalent way, splicing the scFv gene by utilizing overlap-PCR, wherein the reaction conditions of the overlap-PCR are as follows: pre-denaturation at 94 deg.C for 10min, then at 94 deg.C for 20s, at 57 deg.C for 45s, at 72 deg.C for 1min, for 25 cycles, finally at 72 deg.C for 20min extension, gel electrophoresis and gel cutting, purification and recovery.

2.2.4 construction and quality identification of phage Single chain antibody library

The purified scFv gene and pComb3XSS plasmid are respectively subjected to sfII enzyme digestion, the target fragment obtained after gel connection purification and recovery is transferred into competent escherichia coli XL1-Blue, the competent escherichia coli XL1-Blue is added into 20mL of 2YT culture solution to be cultured for 45min at 37 ℃, then centrifugation is carried out, the precipitate is smeared on a 2YT plate to be cultured overnight at 30 ℃, all lawn growing on the plate is collected in the 2YT culture medium on the next day, the culture is carried out at 37 ℃ until OD600 is 0.8, and the final concentration is added to be 1 × 10⁹PFU/mL helper phage VCSM at 1337 ℃ for 1h, adding kanamycin with the final concentration of 50 mug/mL, continuing to culture at 37 ℃ for 8h, centrifuging at 900g for 20min, discarding the precipitate, adding 5 × PEG/NaCl into the supernatant, mixing uniformly, placing on ice for 6h, centrifuging at 900g for 45min, resuspending the precipitate in 3mL PBS, filtering through a 0.22μm filter membrane, obtaining the filtrate which is the human phage single-chain antibody library, and calculating the library capacity and diversity.

2.2.5 screening of anti-SARS-CoV-2-S protein-specific Single chain antibody

Incubating 200 μ L of amplified phage library with solid-phase coated SARS-CoV-2-S protein, performing 4 rounds of affinity screening of adsorption-elution-amplification, and infecting Escherichia coli XL1-Bl in logarithmic growth phase with 4 th round of eluateAfter ue, spread 2 × YT plate, 37 degrees C culture overnight, random pick 200 single colony inoculation 96 hole deep hole plate (containing 100 u g/mL ampicillin, 12.5 u g/mL tetracycline and 1g/mL glucose), 37 degrees C overnight shaking culture, the next day 1: 10 respectively inoculated to the new 96 hole deep hole plate (containing 100 u g/mL ampicillin and 30 u g/mL tetracycline) in 37 degrees C shaking culture for 6h, added with the auxiliary phage VCSM13 (the final concentration is 1 × 10 concentration)⁹PFU/mL), incubation for 1h at 37 ℃, adding kanamycin (with the final concentration of 50 mug/mL) and shaking for culture at 30 ℃ overnight to prepare Phage single-chain antibody, coating an enzyme label plate with SARS-CoV-2-S protein with 0.1 mug/hole, using HRP labeled anti-M13 antibody diluted by PBS buffer solution (containing 5g/mL skimmed milk powder) according to the ratio of 1:2000 as secondary antibody, carrying out Phage-ELISA identification and determining OD450 value, determining as Positive when Positive/Negative is more than or equal to 2.1, and sending the bacterium liquid of the Positive clone to a commercial company for sequencing.

2.3 results

Screening of anti-SARS-CoV-2-S protein single chain antibody

The humanized SARS-CoV-2 virus single-chain antibody library was subjected to 4 rounds of affinity screening using SARS-CoV-2-S protein as an antigen, and the anti-SARS-CoV-2-S protein specific single-chain antibody was selectively enriched, and the output/input ratio was increased by nearly 30 times (Table 1). 200 Phage single clones were randomly picked for Phage-ELISA assay and OD450 values were determined, showing that 43 single chain antibodies specifically bind to SARS-CoV-2-S protein (FIG. 1). Sequencing analysis is carried out on 43 positive clone bacterial liquids to obtain 15 scFv antibodies with different amino acid sequences, which are named as B11, 1TB2, G6, D4, C7, B8, E12, H1, F11, G10, B10, H2, G8, A7 and D5 respectively.

TABLE 1 enrichment Effect of affinity screening against ScFv antibody specific for SARS-CoV-2-S protein

EXAMPLE 3 Microneutralization of candidate scFv monoclonal antibody clones (all manipulations were performed in the BSL-3 laboratory)

3.1 preparation of phage antibodies

The 15 single colonies positive to the Phage-ELISA experiment were picked up into 2mL 2 × YT medium (containing 100. mu.g/mL ampicillin, 12.5. mu.g/mL tetracycline and 1g/mL glucose), shake-cultured overnight at 37 ℃, inoculated into 10mL 2 × YT medium (containing 100. mu.g/mL ampicillin and 30. mu.g/mL tetracycline) at 1: 10 the next day, shake-cultured for 6h at 37 ℃, and added with the helper Phage VCSM13 (final concentration of 1 × 10)⁹PFU/mL), incubation for 1h at 37 ℃, adding kanamycin (with the final concentration of 50 mug/mL) for 30 ℃, shaking overnight for culturing, centrifuging for 30 minutes at 900g, discarding the precipitate, adding 5 × PEG/NaCl into the supernatant, mixing uniformly, placing on ice for 6 hours, centrifuging for 30 minutes at 900g, discarding the supernatant, resuspending the precipitate with 1mL PBS, centrifuging for 30 minutes at 900g, adding the supernatant into a dialysis bag, dialyzing for 3 days in PBS buffer, filtering with a 0.22 mug filter membrane, and storing at 4 ℃.

3.2 micro-neutralization Experimental procedures

(1) Vero cells were seeded in 96-well plates and cultured to logarithmic phase.

(2) Will 5TCID₅₀The virus (50. mu.l total) was mixed with an equal volume of phage antibody and incubated at 37 ℃ for 1 h.

(3) Add 100. mu.l of antigen-antibody complex into the cell culture well, and set multiple wells, and set positive control group (serum of convalescent patient), negative control group (2 × YT medium) and blank control group (cell only, no virus).

(4) The cell culture was incubated at 37 ℃ with 5% CO₂The cells were cultured in an incubator for 5 days, and Cytopathic effect (CPE) was observed every day. Monoclonal antibodies that inhibit the appearance of more than 50% of CPE are considered to have neutralizing inhibitory effects.

3.3 results

Micro neutralization experiment

The experimental results show that B8, B10, C7 and G10 in 15 ScFv monoclonal antibodies have good neutralizing and inhibiting effects on SARS-CoV-2-S virus (figure 2), and the sequences of B8, B10, C7 and G10 antibodies are obtained by sequencing, and the specific sequences are as follows:

the amino acid sequence of the heavy chain variable region of the B8 antibody is shown as SEQ ID NO.26, and the nucleic acid sequence is shown as SEQ ID NO. 46; the amino acid sequence of the heavy chain variable region CDR1 is shown in SEQ ID NO.2, and the nucleic acid sequence is shown in SEQ ID NO. 34; the amino acid sequence of the heavy chain variable region CDR2 is shown in SEQ ID NO.6, and the nucleic acid sequence is shown in SEQ ID NO. 38; the amino acid sequence of the heavy chain variable region CDR3 is shown in SEQ ID NO.10, and the nucleic acid sequence is shown in SEQ ID NO. 42; the amino acid sequence of the light chain variable region is shown as SEQ ID NO.27, and the nucleic acid sequence is shown as SEQ ID NO. 47; the amino acid sequence of the light chain variable region CDR1 is shown in SEQ ID NO.14, and the nucleic acid sequence is shown in SEQ ID NO. 54; the amino acid sequence of the light chain variable region CDR2 is shown in SEQ ID NO.18, and the nucleic acid sequence is shown in SEQ ID NO. 58; the amino acid sequence of CDR3 in the variable region of light chain is shown in SEQ ID NO.22, and the nucleic acid sequence is shown in SEQ ID NO. 62.

The amino acid sequence of the heavy chain variable region of the B10 antibody is shown as SEQ ID NO.28, and the nucleic acid sequence is shown as SEQ ID NO. 48; the amino acid sequence of the heavy chain variable region CDR1 is shown in SEQ ID NO.3, and the nucleic acid sequence is shown in SEQ ID NO. 35; the amino acid sequence of the heavy chain variable region CDR2 is shown in SEQ ID NO.7, and the nucleic acid sequence is shown in SEQ ID NO. 39; the amino acid sequence of the heavy chain variable region CDR3 is shown in SEQ ID NO.11, and the nucleic acid sequence is shown in SEQ ID NO. 43; the amino acid sequence of the light chain variable region is shown as SEQ ID NO.29, and the nucleic acid sequence is shown as SEQ ID NO. 49; the amino acid sequence of the light chain variable region CDR1 is shown in SEQ ID NO.15, and the nucleic acid sequence is shown in SEQ ID NO. 55; the amino acid sequence of the light chain variable region CDR2 is shown in SEQ ID NO.19, and the nucleic acid sequence is shown in SEQ ID NO. 59; the amino acid sequence of CDR3 in the variable region of light chain is shown in SEQ ID NO.23, and the nucleic acid sequence is shown in SEQ ID NO. 63.

The amino acid sequence of the heavy chain variable region of the C7 antibody is shown as SEQ ID NO.30, and the nucleic acid sequence is shown as SEQ ID NO. 50; the amino acid sequence of the heavy chain variable region CDR1 is shown in SEQ ID NO.4, and the nucleic acid sequence is shown in SEQ ID NO. 36; the amino acid sequence of the heavy chain variable region CDR2 is shown in SEQ ID NO.8, and the nucleic acid sequence is shown in SEQ ID NO. 40; the amino acid sequence of the heavy chain variable region CDR3 is shown in SEQ ID NO.12, and the nucleic acid sequence is shown in SEQ ID NO. 44; the amino acid sequence of the light chain variable region is shown as SEQ ID NO.31, and the nucleic acid sequence is shown as SEQ ID NO. 51; the amino acid sequence of the light chain variable region CDR1 is shown in SEQ ID NO.16, and the nucleic acid sequence is shown in SEQ ID NO. 56; the amino acid sequence of the light chain variable region CDR2 is shown in SEQ ID NO.20, and the nucleic acid sequence is shown in SEQ ID NO. 60; the amino acid sequence of CDR3 in the variable region of light chain is shown in SEQ ID NO.24, and the nucleic acid sequence is shown in SEQ ID NO. 64.

The amino acid sequence of the heavy chain variable region of the G10 antibody is shown as SEQ ID NO.32, and the nucleic acid sequence is shown as SEQ ID NO. 52; the amino acid sequence of the heavy chain variable region CDR1 is shown in SEQ ID NO.5, and the nucleic acid sequence is shown in SEQ ID NO. 37; the amino acid sequence of the heavy chain variable region CDR2 is shown in SEQ ID NO.9, and the nucleic acid sequence is shown in SEQ ID NO. 41; the amino acid sequence of the heavy chain variable region CDR3 is shown in SEQ ID NO.13, and the nucleic acid sequence is shown in SEQ ID NO. 45; the amino acid sequence of the light chain variable region is shown as SEQ ID NO.33, and the nucleic acid sequence is shown as SEQ ID NO. 53; the amino acid sequence of the light chain variable region CDR1 is shown in SEQ ID NO.17, and the nucleic acid sequence is shown in SEQ ID NO. 57; the amino acid sequence of the light chain variable region CDR2 is shown in SEQ ID NO.21, and the nucleic acid sequence is shown in SEQ ID NO. 61; the amino acid sequence of CDR3 in the variable region of light chain is shown in SEQ ID NO.25, and the nucleic acid sequence is shown in SEQ ID NO. 65.

Although only specific embodiments of the present invention have been described above, it will be understood by those skilled in the art that these are by way of illustration only, and that the scope of the invention is defined by the appended claims. Various changes or modifications to these embodiments may be made by those skilled in the art without departing from the principle and spirit of the invention, and these changes or modifications are within the scope of the invention.

Sequence listing

<110> Jiangsu province disease prevention and control center (Jiangsu province public health research institute)

<120> SARS-CoV-2 inhibitor and its use

<160>92

<170>SIPOSequenceListing 1.0

<210>1

<211>693

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Met Phe Leu Leu Thr Thr Lys Arg Thr Met Phe Val Phe Leu Val Leu

1 5 10 15

Leu Pro Leu Val Ser Ser Gln Cys Val Asn Leu Thr Thr Arg Thr Gln

20 25 30

Leu Pro Pro Ala Tyr Thr Asn Ser Phe Thr Arg Gly Val Tyr Tyr Pro

35 40 45

Asp Lys Val Phe Arg Ser Ser Val Leu His Ser Thr Gln Asp Leu Phe

50 55 60

Leu Pro Phe Phe Ser Asn Val Thr Trp Phe His Ala Ile His Val Ser

65 70 75 80

Gly Thr Asn Gly Thr Lys Arg Phe Asp Asn Pro Val Leu Pro Phe Asn

85 90 95

Asp Gly Val Tyr Phe Ala Ser Thr Glu Lys Ser Asn Ile Ile Arg Gly

100 105 110

Trp Ile Phe Gly Thr Thr Leu Asp Ser Lys Thr Gln Ser Leu Leu Ile

115 120 125

Val Asn Asn Ala Thr Asn Val Val Ile Lys Val Cys Glu Phe Gln Phe

130 135 140

Cys Asn Asp Pro Phe Leu Gly Val Tyr Tyr His Lys Asn Asn Lys Ser

145 150 155 160

Trp Met Glu Ser Glu Phe Arg Val Tyr Ser Ser Ala Asn Asn Cys Thr

165 170 175

Phe Glu Tyr Val Ser Gln Pro Phe Leu Met Asp Leu Glu Gly Lys Gln

180 185 190

Gly Asn Phe Lys Asn Leu Arg Glu Phe Val Phe Lys Asn Ile Asp Gly

195 200 205

Tyr Phe Lys Ile Tyr Ser Lys His Thr Pro Ile Asn Leu Val Arg Asp

210 215 220

Leu Pro Gln Gly Phe Ser Ala Leu Glu Pro Leu Val Asp Leu Pro Ile

225 230 235 240

Gly Ile Asn Ile Thr Arg Phe Gln Thr Leu Leu Ala Leu His Arg Ser

245 250 255

Tyr Leu Thr Pro Gly Asp Ser Ser Ser Gly Trp Thr Ala Gly Ala Ala

260 265 270

Ala Tyr Tyr Val Gly Tyr Leu Gln Pro Arg Thr Phe Leu Leu Lys Tyr

275 280 285

Asn Glu Asn Gly Thr Ile Thr Asp Ala Val Asp Cys Ala Leu Asp Pro

290 295 300

Leu Ser Glu Thr Lys Cys Thr Leu Lys Ser Phe Thr Val Glu Lys Gly

305 310 315 320

Ile Tyr Gln Thr Ser Asn Phe Arg Val Gln Pro Thr Glu Ser Ile Val

325 330 335

Arg Phe Pro Asn Ile Thr Asn Leu Cys Pro Phe Gly Glu Val Phe Asn

340 345 350

Ala Thr Arg Phe Ala Ser Val Tyr Ala Trp Asn Arg Lys Arg Ile Ser

355 360 365

Asn Cys Val Ala Asp Tyr Ser Val Leu Tyr Asn Ser Ala Ser Phe Ser

370 375 380

Thr Phe Lys Cys Tyr Gly Val Ser Pro Thr Lys Leu Asn Asp Leu Cys

385 390 395 400

Phe Thr Asn Val Tyr Ala Asp Ser Phe Val Ile Arg Gly Asp Glu Val

405 410 415

Arg Gln Ile Ala Pro Gly Gln Thr Gly Lys Ile Ala Asp Tyr Asn Tyr

420 425 430

Lys Leu Pro Asp Asp Phe Thr Gly Cys Val Ile Ala Trp Asn Ser Asn

435 440 445

Asn Leu Asp Ser Lys Val Gly Gly Asn Tyr Asn Tyr Leu Tyr Arg Leu

450 455 460

Phe Arg Lys Ser Asn Leu Lys Pro Phe Glu Arg Asp Ile Ser Thr Glu

465 470 475 480

Ile Tyr Gln Ala Gly Ser Thr Pro Cys Asn Gly Val Glu Gly Phe Asn

485 490 495

Cys Tyr Phe Pro Leu Gln Ser Tyr Gly Phe Gln Pro Thr Asn Gly Val

500 505 510

Gly Tyr Gln Pro Tyr Arg Val Val Val Leu Ser Phe Glu Leu Leu His

515 520 525

Ala Pro Ala Thr Val Cys Gly Pro Lys Lys Ser Thr Asn Leu Val Lys

530 535 540

Asn Lys Cys Val Asn Phe Asn Phe Asn Gly Leu Thr Gly Thr Gly Val

545 550 555 560

Leu Thr Glu Ser Asn Lys Lys Phe Leu Pro Phe Gln Gln Phe Gly Arg

565 570 575

Asp Ile Ala Asp Thr Thr Asp Ala Val Arg Asp Pro Gln Thr Leu Glu

580 585 590

Ile Leu Asp Ile Thr Pro Cys Ser Phe Gly Gly Val Ser Val Ile Thr

595 600 605

Pro Gly Thr Asn Thr Ser Asn Gln Val Ala Val Leu Tyr Gln Asp Val

610 615 620

Asn Cys Thr Glu Val Pro Val Ala Ile His Ala Asp Gln Leu Thr Pro

625 630 635 640

Thr Trp Arg Val Tyr Ser Thr Gly Ser Asn Val Phe Gln Thr Arg Ala

645 650 655

Gly Cys Leu Ile Gly Ala Glu His Val Asn Asn Ser Tyr Glu Cys Asp

660 665 670

Ile Pro Ile Gly Ala Gly Ile Cys Ala Ser Tyr Gln Thr Gln Thr Asn

675 680 685

Ser Pro Arg Arg Ala

690

<210>2

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Gly Leu Asn Phe Gly Thr Ser Val

1 5

<210>3

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>3

Gly Phe Thr Phe Ser Ser Ser Ala

1 5

<210>4

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>4

Gly Phe Thr Phe Ala Asp Tyr Thr

1 5

<210>5

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>5

Gly Phe Asn Phe Ser Ser Tyr Ala

1 5

<210>6

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>6

Ile Asp Ser Gly Gly Thr Ser Ile

1 5

<210>7

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>7

Ile Arg Ser Lys Pro Asn Ser Tyr Ala Thr

1 5 10

<210>8

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>8

Ile Arg Ser Lys Thr Tyr Gly Gly Thr Ala

1 5 10

<210>9

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>9

Ile Ser Ser Asp Gly Ser Val Thr

1 5

<210>10

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>10

Ser Thr Asp Ser Gly Ser Ile Gly Glu Phe

1 5 10

<210>11

<211>11

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>11

Thr Ser Val Cys Ser Gly Gly Ser Cys Tyr Gln

1 5 10

<210>12

<211>17

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>12

Thr Arg Ile Ser Gly Tyr Tyr Gly Ala Gly Ser Gly Gly Ala Met Asp

1 5 10 15

Val

<210>13

<211>11

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>13

Ala Arg Ser Gly Trp Asp Asp Ala Phe Asp Ile

1 5 10

<210>14

<211>6

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>14

Gln Asn Ile Arg Gly Tyr

1 5

<210>15

<211>12

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>15

Arg Asn Val Leu Tyr Ser Pro Asn Asn Lys Asn Tyr

1 5 10

<210>16

<211>7

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>16

Gln Ser Val Ser Ser Ser Tyr

1 5

<210>17

<211>6

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>17

Asn Ile Gly Arg Lys Tyr

1 5

<210>18

<211>3

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>18

His Ala Ser

1

<210>19

<211>3

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>19

Trp Ala Ser

1

<210>20

<211>3

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>20

Asp Ala Ser

1

<210>21

<211>3

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>21

Asp Asn Asp

1

<210>22

<211>10

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>22

Gln Gln Ser His Asp Thr Leu Thr Trp Thr

1 5 10

<210>23

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>23

His Gln Tyr Phe Ser Thr Leu Trp Thr

1 5

<210>24

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>24

Gln Gln Arg Ser Asn Trp Pro Leu Thr

1 5

<210>25

<211>12

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>25

Gln Val Trp Asp Thr Thr Tyr Ser Arg Pro Val Ile

1 5 10

<210>26

<211>132

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>26

Glu Val Lys Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Leu Asn Phe Gly Thr Ser

20 25 30

Val Met His Trp Val Arg Gln Val Gln Gly Thr Gly Leu Leu Trp Val

35 40 45

Ser Arg Ile Asp Ser Gly Gly Thr Ser Ile Thr Tyr Ala Asp Ser Val

50 55 60

Arg Gly Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Val Glu Asp Thr Gly Val Tyr Tyr Cys

85 90 95

Ser Thr Asp Ser Gly Ser Ile Gly Glu Phe Trp Gly Gln Gly Thr Leu

100 105 110

Val Thr Val Ser Ser Ala Ser Pro Thr Ser Pro Lys Val Thr Ser Gly

115 120 125

Gln Ala Gly Gln

130

<210>27

<211>108

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>27

Glu Leu Gln Met Thr Gln Ser Pro Ser Pro Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Gly Gln Asn Ile Arg Gly Tyr

20 25 30

Val Asn Trp Tyr Gln His Lys Ala Gly Glu Ala Pro Lys Leu Leu Ile

35 40 45

Tyr His Ala Ser Asn Leu Gln Ser Gly Leu Pro Leu Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Thr Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Ile Tyr Tyr Cys Gln Gln Ser His Asp Thr Leu Thr

85 90 95

Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105

<210>28

<211>135

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>28

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Glu

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Ser

20 25 30

Ala Met His Trp Val Arg Gln Ala Ser Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Arg Ile Arg Ser Lys Pro Asn Ser Tyr Ala Thr Ala Tyr Ala Ala

50 55 60

Ser Val Thr Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr

65 70 75 80

Ala Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr

85 90 95

Tyr Cys Thr Ser Val Cys Ser Gly Gly Ser Cys Tyr Gln Trp Gly Gln

100 105 110

Gly Thr Leu Val Thr Val Ser Ser Ala Ser Pro Thr Ser Pro Lys Val

115 120 125

Thr Ser Gly Gln Ala Gly Gln

130 135

<210>29

<211>113

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>29

Glu Leu Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Arg Asn Val Leu Tyr Ser

20 25 30

Pro Asn Asn Lys Asn Tyr Leu Gly Trp Tyr Gln Gln Lys Pro Gly Gln

35 40 45

Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Ser Arg Glu Ser Gly Val

50 55 60

Pro Asp Arg Phe Ser Gly Ser Gly Ser Glu Thr Asp Phe Thr Leu Thr

65 70 75 80

Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys His Gln

85 90 95

Tyr Phe Ser Thr Leu Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile

100 105 110

Lys

<210>30

<211>126

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>30

Glu Val Gln Leu ValGlu Ser Gly Gly Gly Leu Val Met Pro Gly Arg

1 5 10 15

Ser Leu Arg Leu Ser Cys Arg His Ser Gly Phe Thr Phe Ala Asp Tyr

20 25 30

Thr Met Asn Trp Phe Arg Gln Val Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Phe Ile Arg Ser Lys Thr Tyr Gly Gly Thr Ala Glu Tyr Ala Ala

50 55 60

Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Ser Ile

65 70 75 80

Ala Tyr Leu Glu Met Asn Ser Leu Asn Thr Glu Asp Thr Gly Val Tyr

85 90 95

Arg Cys Thr Arg Ile Ser Gly Tyr Tyr Gly Ala Gly Ser Gly Gly Ala

100 105 110

Met Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser

115 120 125

<210>31

<211>108

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>31

Glu Leu Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly

1 510 15

Glu Arg Ala Thr Leu Ser Tyr Arg Ala Ser Gln Ser Val Ser Ser Ser

20 25 30

Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu

35 40 45

Ile Tyr Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser

50 55 60

Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu

65 70 75 80

Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Arg Ser Asn Trp Pro

85 90 95

Leu Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys

100 105

<210>32

<211>118

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>32

Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Asn Phe Ser Ser Tyr

20 25 30

Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Pro Glu Trp Val

35 40 45

Ala Leu Ile Ser Ser Asp Gly Ser Val Thr Tyr Phe Thr Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Ser Gly Trp Asp Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr

100 105 110

Met Val Thr Val Ser Ser

115

<210>33

<211>110

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>33

Ser Gln Ser Val Leu Thr Gln Pro Pro Ser Met Ser Leu Ala Pro Gly

1 5 10 15

Gln Thr Ala Thr Ile Thr Cys Ala Gly Thr Asn Ile Gly Arg Lys Tyr

20 25 30

Val His Trp Tyr Gln Gln Arg Pro Gly Gln Ala Pro Val Leu Val Met

35 40 45

Ser Asp Asn Asp Asp Arg Pro Ser Gly Ile Pro GluArg Phe Ser Ala

50 55 60

Ser Asn Ser Gly His Thr Ala Thr Leu Ile Ile Asn Arg Val Glu Val

65 70 75 80

Asp Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp Asp Thr Thr Tyr Ser

85 90 95

Arg Pro Val Ile Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

100 105 110

<210>34

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>34

ggattaaact tcggtacttc tgta 24

<210>35

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>35

gggttcacct tcagtagctc tgct 24

<210>36

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>36

ggattcacgt ttgctgatta cact 24

<210>37

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>37

ggattcaatt tcagtagcta tgct 24

<210>38

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>38

attgatagtg gagggactag tata 24

<210>39

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>39

attagaagca aacctaacag ttacgcgaca 30

<210>40

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>40

attagaagca aaacttatgg tgggacagca 30

<210>41

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>41

atatcctctg atgggagtgt taca 24

<210>42

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>42

tccaccgatt ctgggtcgat cggagaattc 30

<210>43

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>43

acatctgttt gtagtggtgg tagctgctac caa 33

<210>44

<211>51

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>44

actaggatat ctggctacta tggtgcgggg tcgggcgggg ctatggacgt c 51

<210>45

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>45

gcgagatctg ggtgggacga tgcttttgat atc 33

<210>46

<211>396

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>46

gaggtgaagc tgttggagtc tgggggcggc ttagttcagc ctggggggtc cctgagactc 60

tcctgtacag cctctggatt aaacttcggt acttctgtaa tgcattgggt ccgccaagtt 120

caagggacgg ggctgctgtg ggtctcacgt attgatagtg gagggactag tataacctac 180

gcggactccg tgaggggccg attcaccgtc tccagagaca acgccaagaa cacactgtat 240

ctgcaaatga acagtctgag agtcgaggac acgggtgtgt attactgctc caccgattct 300

gggtcgatcg gagaattctg gggccaggga accctggtca ccgtgtcctc ggcatccccg 360

accagcccca aggtcactag tggccaggcc ggccag 396

<210>47

<211>324

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>47

gagctccaga tgacccagtc tccatcgccc ctgtctgcat ctgtcggaga cagagtcacc 60

atcacttgcc gggcaggtca gaacattcgc ggttatgtaa attggtatca gcacaaagca 120

ggggaagccc ctaagctcct gatctatcat gcctctaatt tgcaaagtgg actcccgtta 180

agattcagtg gcagtggatc agggacagat ttcactctca ccatcaccag tctgcaacct 240

gaagattttg caatttacta ctgtcaacag agtcacgaca cccttacgtg gacgttcggc 300

caagggacca aggtggagat caaa 324

<210>48

<211>405

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>48

caggtgcagc tgcaggagtc ggggggaggc ttggtccagc ctggggaatc cctgaaactc 60

tcctgtgcag cctctgggtt caccttcagt agctctgcta tgcactgggt ccgccaggct 120

tccgggaaag ggctggagtg gattggccgt attagaagca aacctaacag ttacgcgaca 180

gcatatgctg cgtcggtgac aggcaggttc accatctcca gagatgattc aaagaacacg 240

gcgtatctgc aaatgaacag cctgaaaacc gaggacacgg ccgtgtatta ttgtacatct 300

gtttgtagtg gtggtagctg ctaccaatgg ggccagggaa ccctggtcac cgtctcctca 360

gcatccccga ccagccccaa ggtcactagt ggccaggccg gccag 405

<210>49

<211>339

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>49

gagctcgtga tgactcagtc tccagactcc ctggctgtgt ctctgggcga gagggccacc 60

atcaactgca agtccagccg gaatgtttta tacagtccca ataataagaa ctacttaggt 120

tggtaccagc agaaaccagg acagcctcct aagctgctca tttactgggc atcttcccgg 180

gaatccgggg tccctgaccg attcagtggc agcgggtctg agacagattt cactctcacc 240

atcagcagcc tgcaggctga agatgtggca gtttattact gtcaccaata ttttagtact 300

ctgtggacgt tcggccaagg gaccaaggtg gaaatcaaa 339

<210>50

<211>378

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>50

gaggtgcagc tggtggagtc tgggggaggc ttggtaatgc ccgggcggtc tctgagactc 60

tcctgtcgac attctggatt cacgtttgct gattacacta tgaactggtt ccgccaggtc 120

ccagggaagg ggctggagtg gataggtttc attagaagca aaacttatgg tgggacagca 180

gaatacgccg cgtctgtgaa aggcagattc acaatctcaa gagatgattc caaaagcatc 240

gcctatctgg aaatgaacag cctgaacacc gaagacacag gcgtgtatcg gtgtactagg 300

atatctggct actatggtgc ggggtcgggc ggggctatgg acgtctgggg ccaagggacc 360

acggtcaccg tctcctca 378

<210>51

<211>324

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>51

gagctcgtgt tgacgcagtc tccaggcacc ctgtctttgt ctccagggga aagagccacc 60

ctctcctaca gggccagtca gagtgttagc agcagctact tagcctggta ccaacagaaa 120

cctggccagg ctcccaggct cctcatctat gatgcatcca acagggccac tggcatccca 180

gccaggttca gtggcagtgg gtctgggaca gacttcactc tcaccatcag cagcctagag 240

cctgaagatt ttgcagttta ttactgtcag cagcgtagca actggcctct cactttcggc 300

cctgggacca aagtggatat caaa 324

<210>52

<211>354

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>52

gaggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggagggtc cctgagactc 60

tcctgtgcag cctctggatt caatttcagt agctatgcta tgcactgggt ccgccaggct 120

ccaggcaagg ggccggagtg ggtggcacta atatcctctg atgggagtgt tacatacttc 180

acagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat 240

ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gagatctggg 300

tgggacgatg cttttgatat ctggggccaa gggacaatgg tcaccgtctc ttca 354

<210>53

<211>330

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>53

agccaatctg tgctgactca gccaccctcg atgtcgctgg cccccggaca gacggccacc 60

attacctgtg cggggacaaa cattggacgt aaatatgttc actggtacca acagaggcca 120

ggccaggccc ctgtcctggt catgtctgat aatgacgacc ggccctcagg gatccctgag 180

cgattctctg cctccaactc tgggcacacg gctaccctga tcatcaacag ggtcgaagtc 240

gacgatgagg ccgactatta ctgtcaggtg tgggacacta cgtattctcg ccccgtgatt 300

ttcggcggag ggaccaagtt gaccgtccta 330

<210>54

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>54

cagaacattc gcggttat 18

<210>55

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>55

cggaatgttt tatacagtcc caataataag aactac 36

<210>56

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>56

cagagtgtta gcagcagcta c 21

<210>57

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>57

aacattggac gtaaatat 18

<210>58

<211>9

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>58

catgcctct 9

<210>59

<211>9

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>59

tgggcatct 9

<210>60

<211>9

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>60

gatgcatcc 9

<210>61

<211>9

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>61

gataatgac 9

<210>62

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>62

caacagagtc acgacaccct tacgtggacg 30

<210>63

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>63

caccaatatt ttagtactct gtggacg 27

<210>64

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>64

cagcagcgta gcaactggcc tctcact 27

<210>65

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>65

caggtgtggg acactacgta ttctcgcccc gtgatt 36

<210>66

<211>37

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>66

gggcccaggc ggccgagctc cagatgaccc agtctcc 37

<210>67

<211>37

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>67

gggcccaggc ggccgagctc gtgatgacyc agtctcc 37

<210>68

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>68

gggcccaggc ggccgagctc gtgwtgacrc agctcc 36

<210>69

<211>42

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>69

ggaagatcta gaggaaccac ctttgatytc caccttggtc cc 42

<210>70

<211>42

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>70

ggaagatcta gaggaaccac ctttgatctc cagcttggtc cc 42

<210>71

<211>42

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>71

ggaagatcta gaggaaccac ctttaatctc cagtcgtgtc cc 42

<210>72

<211>42

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>72

ggaagatcta gaggaaccac ctttgatatc cactttggtc cc 42

<210>73

<211>40

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>73

gggcccaggc ggccgagctc gtgbtgacgc agccgccctc 40

<210>74

<211>40

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>74

gggcccaggc ggccgagctc gtgctgactc agccaccctc 40

<210>75

<211>43

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>75

gggcccaggc ggccgagctc gccctgactc agcctccctc cgt 43

<210>76

<211>40

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>76

gggcccaggc ggccgagctc gtgctgactc aatcgccctc 40

<210>77

<211>40

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>77

gggcccaggc ggccgagctc atgctgactc agccccactc 40

<210>78

<211>40

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>78

gggcccaggc ggccgagctc gtggtgacyc aggagccmtc 40

<210>79

<211>40

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>79

gggcccaggc ggccgagctc gtgctgactc agccaccttc 40

<210>80

<211>40

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>80

gggcccaggc ggccgagctc gggcagactc agcagctctc 40

<210>81

<211>43

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>81

ggaagatcta gaggaaccac cgcctaggac ggtcascttg gts 43

<210>82

<211>43

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>82

ggaagatcta gaggaaccac cgcctaaaat gatcagctgg gtt 43

<210>83

<211>43

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>83

ggaagatcta gaggaaccac cgccgaggac ggtcagctsg gts 43

<210>84

<211>44

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>84

ggtggttcct ctagatcttc ctcctctggg gcggtggctc gggc 44

<210>85

<211>44

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>85

ggtggttcct ctagatcttc ctcctctggt ggcggtggct cggg 44

<210>86

<211>44

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>86

ggtggttcct ctagatcttcctcctctgtg gcggtggctc gggc 44

<210>87

<211>44

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>87

ggtggttcct ctgatcttcc tcctcggtgg cggtggctcg ggcg 44

<210>88

<211>44

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>88

ggtggttcct ctagatcttc ctcctctggt ggcggtggct cggc 44

<210>89

<211>44

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>89

ggtggttcct ctagatcttc ctcctctggt ggcggtggtc gggc 44

<210>90

<211>44

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>90

cctggccggc ctggccacta gtgaccgatg ggcccttggt ggar 44

<210>91

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>91

gaggaggagg aggaggaggc ggggcccagg cggccgagct c 41

<210>92

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>92

gaggaggagg aggaggagcc tggccggcct ggccactagt g 41

Claims (10)

1. A neutralizing antibody or an antigen-binding fragment thereof against SARS-CoV-2 virus, wherein the antibody or the antigen-binding fragment thereof targets SARS-CoV-2-S protein of the virus, and the sequence of the SARS-CoV-2-S protein is SEQ ID NO. 1.

2. The neutralizing antibody or antigen binding fragment thereof of claim 1 comprising a light chain CDR1, a light chain CDR2, a light chain CDR3, a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR 3; it is characterized in that the preparation method is characterized in that,

the amino acid sequence of heavy chain CDR1 is selected from one of the following sequences: SEQ ID No.2, SEQ ID No.3, SEQ ID No.4 or SEQ ID No. 5;

the amino acid sequence of heavy chain CDR2 is selected from one of the following sequences: SEQ ID No.6, SEQ ID No.7, SEQ ID No.8 or SEQ ID No. 9;

the amino acid sequence of heavy chain CDR3 is selected from one of the following sequences: SEQ ID No.10, SEQ ID No.11, SEQ ID No.12 or SEQ ID No. 13;

the amino acid sequence of light chain CDR1 is selected from one of the following sequences: SEQ ID No.14, SEQ ID No.15, SEQ ID No.16 or SEQ ID No. 17;

the amino acid sequence of light chain CDR2 is selected from one of the following sequences: SEQ ID No.18, SEQ ID No.19, SEQ ID No.20 or SEQ ID No. 21;

the amino acid sequence of light chain CDR3 is selected from one of the following sequences: SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24 or SEQ ID NO. 25.

3. The neutralizing antibody or antigen-binding fragment thereof according to claim 1, wherein the amino acid sequence of the heavy chain variable region of said neutralizing antibody or antigen-binding fragment thereof is selected from one of the following sequences: SEQ ID No.26, SEQ ID No.28, SEQ ID No.30 or SEQ ID No. 32; the amino acid sequence of the light chain variable region is selected from one of the following sequences: SEQ ID NO.27, SEQ ID NO.29, SEQ ID NO.31 or SEQ ID NO. 33.

4. A nucleic acid molecule encoding the neutralizing antibody or antigen-binding fragment thereof of claim 2 or 3.

5. The nucleic acid molecule of claim 4, wherein the nucleic acid sequence encoding the heavy chain CDR1 is selected from one of the following sequences: SEQ ID No.34, SEQ ID No.35, SEQ ID No.36 or SEQ ID No. 37;

the nucleic acid sequence encoding heavy chain CDR2 is selected from one of the following sequences: SEQ ID No.38, SEQ ID No.39, SEQ ID No.40 or SEQ ID No. 41;

the nucleic acid sequence encoding heavy chain CDR3 is selected from one of the following sequences: SEQ ID No.42, SEQ ID No.43, SEQ ID No.44 or SEQ ID No. 45;

the nucleic acid sequence encoding the light chain CDR1 is selected from one of the following sequences: SEQ ID No.54, SEQ ID No.55, SEQ ID No.56 or SEQ ID No. 57;

the nucleic acid sequence encoding the light chain CDR2 is selected from one of the following sequences: SEQ ID No.58, SEQ ID No.59, SEQ ID No.60 or SEQ ID No. 61;

the nucleic acid sequence encoding the light chain CDR3 is selected from one of the following sequences: SEQ ID No.62, SEQ ID No.63, SEQ ID No.64 or SEQ ID No. 65;

or neutralizing the heavy chain variable region of the antibody or antigen binding fragment thereof with a nucleic acid sequence selected from one of the following sequences: SEQ ID NO.46, SEQ ID NO.48, SEQ ID NO.50 or SEQ ID NO. 52;

the variable region of the light chain has a nucleic acid sequence selected from one of the following sequences: SEQ ID NO.47, SEQ ID NO.49, SEQ ID NO.51 or SEQ ID NO. 53.

6. A recombinant vector comprising the nucleic acid molecule of claim 4 or 5.

7. A recombinant cell into which the nucleic acid molecule of claim 4 or 5 has been introduced or which has been transfected with the recombinant vector of claim 6.

8. A pharmaceutical composition comprising a therapeutically effective amount of the neutralizing antibody or antigen-binding fragment thereof of claim 1.

9. A product for detecting SARS-CoV-2 virus, comprising the neutralizing antibody or antigen-binding fragment thereof of claim 1.

10. The use of the neutralizing antibody or antigen binding fragment thereof of claim 1 comprising any one of:

(1) use in the preparation of a product according to claim 9;

(2) use in the preparation of a pharmaceutical composition according to claim 8;

(3) the application in preparing the medicine for neutralizing the toxicity of SARS-CoV-2;

(4) the application in preparing the medicine for resisting SARS-CoV-2 infection;

(5) the application in preparing medicine for treating SARS-CoV-2 infection caused diseases.

Images