WO2022001803A1 - Method for reducing viral ade effect - Google Patents

Abstract

Provided is a method for reducing a viral ADE effect. The method achieves the purpose thereof by administering molecules that reduce the viral ADE effect to a subject who is infected by a virus or who is at risk of being infected by a virus. By performing a molecular biology modification on an Fc fragment of an antibody, an Fc fragment having reduced Fc receptor binding/complement binding performance is obtained. The antibody containing the Fc fragment can reduce the viral ADE effect. The antibody is preferably used to prevent and/or treat acute respiratory infections caused by a coronavirus infection.

Description

A method to reduce the effect of viral ADE

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of Chinese patent application 202010598424.8 filed on June 28, 2020, the contents of which are incorporated herein by reference.

technical field

The invention relates to the technical field of cellular immunity, and provides a method for reducing the ADE effect of a virus, and a molecule for reducing the ADE effect of the virus. Specifically, the present invention provides a molecule comprising an Fc fragment with reduced Fc receptor binding/complement binding, thereby achieving a reduction in viral ADE. The present invention also provides a humanized antibody that reduces the ADE effect of the virus, binds and blocks the binding of the SARS-CoV-2 spike protein (S protein) to the ACE2 receptor, and efficiently neutralizes the cells infected by the SARS-CoV-2 virus. As well as reducing the ADE effect of the virus, it can cross-block the binding of SARS-CoV-2 and SARS-CoV spike protein (S protein) to the ACE2 receptor, and efficiently neutralize SARS-CoV-2 and SARS-CoV virus-infected cells. Humanized Antibodies.

Background technique

The neutralization of antibodies to viruses is an important mechanism for the host to resist viral infection. Antibodies can eliminate viruses through the effector functions of their Fc segments, including complement-mediated lysis of virus particles, antibody-mediated cytotoxicity, and phagocytosis. [1]. However, many viruses can use the feature of antibodies to promote the infection of host cells and regulate the signaling pathways of host cells, thereby inhibiting the antiviral immune response, a process called antibody-dependent enhancement (ADE).

The phenomenon of ADE was first discovered in Dengue virus (DENV) [2], followed by many virus types including Ebola virus (Ebola virus), Zika virus (ZIKV), Chikungunya virus (Chikungunya virus), ADE phenomenon has been reported in in vitro experiments such as severe acute respiratory syndrome virus (severe acute respiratory syndrome virus, SARS) [3-5]. Although it is still controversial whether the ADE phenomenon is the main risk in clinical practice, there are many clues that ADE may become one of the important factors that cannot be ignored in the development of antiviral drugs and vaccines.

A retrospective analysis of clinical trials indicated that CYD-TDV, the earliest approved dengue virus vaccine, was renegotiated due to its risk of aggravating infection [6], suggesting that ADE may affect the use of vaccines in the clinic Effect. In addition, in SARS-infected patients, higher titers of anti-SARS immunoglobulin were detected in the serum of severe patients than mild patients [7]. This phenomenon has also been confirmed in several recent studies on the new coronavirus pneumonia virus (SARS-CoV-2): the severity of new coronary pneumonia patients has a certain positive correlation with the titer of total antibody IgG [8-10 ]. Therefore, ADEs that reduce antibodies may improve safety in the process of neutralizing antibodies in the treatment of new coronary infection.

The impact of ADE on the immune system cannot be underestimated, and ADE with reduced antibodies has important guiding significance for vaccines, recovered serum, and neutralizing antibodies to prevent or treat novel coronavirus infection.

SUMMARY OF THE INVENTION

In order to avoid the above-mentioned viral ADE effect on the effect of vaccine use and pursue a safer clinical effect, the inventors modified the corresponding Fc fragment by means of molecular biology, and obtained Fc fragments with reduced Fc receptor binding/complement binding. molecules, thereby achieving a reduction in the ADE effect of the virus. It has been verified that the Fc modified fragment molecules provided by the present invention can express interaction with B cells, monocytes, macrophages, dendritic cells, etc. FcγR-expressing cells, such as dendritic cells, have a reduced ability to bind and thus reduce viral infection. Further, the inventors invented a molecule that reduces the effect of viral ADE, the molecule comprising a) an antigen-binding fragment that recognizes and binds to the viral coat protein or extramembrane domain; and the aforementioned b) reduced Fc receptor binding/complement binding Fc fragment.

Detailed description of the invention

The purpose of the present invention is to provide a method for reducing the effect of viral ADE.

Another object of the present invention is to provide a molecule comprising an Fc fragment with reduced Fc receptor binding/complement binding, thereby reducing viral ADE.

Another object of the present invention is to provide a molecule for reducing the effect of viral ADE, the molecule comprising a) an antigen-binding fragment that recognizes and binds to the viral coat protein or extramembrane domain; and the aforementioned b) Fc receptor binding/complement Binding reduces Fc fragment.

Another object of the present invention is to provide a human source that can reduce the ADE effect of the virus, block the binding of the SARS-CoV-2 spike protein (S protein) to the ACE2 receptor, and efficiently neutralize the cells infected by the SARS-CoV-2 virus. Antibodies.

Another object of the present invention is to provide a cross-blocking SARS-CoV-2 and SARS-CoV spike protein (S protein) binding to the ACE2 receptor that reduces the ADE effect of the virus, and efficiently neutralizes SARS-CoV-2 and SARS-CoV-2. Humanized antibodies to SARS-CoV virus infecting cells.

Accordingly, the present invention provides polynucleotides capable of encoding molecules with reduced Fc receptor binding/complement binding properties.

The present invention also provides a recombinant vector comprising the polynucleotide.

The present invention also provides host cells comprising the polynucleotide and/or the recombinant vector.

The present invention also provides antibodies formed from the polynucleotides expressed by recombinant vectors and/or host cells.

The molecules of the Fc fragments with reduced Fc receptor binding/complement binding provided by the present invention can be further prepared into vaccines, and the vaccines include the molecules of the modified Fc fragments, the polynucleotides, the recombinant vectors, the host cells, and the recombinant bacteria. One or more of , adenovirus, lentivirus, or viral particles as the active ingredient.

In a possible implementation, the vaccine includes one or more of inactivated vaccines, attenuated vaccines, mRNA vaccines, DNA vaccines, adenovirus vector vaccines, other viral vector vaccines, subunit vaccines or virus particles .

In a possible implementation manner of the above vaccine, the vaccine further includes any one or a combination of at least two of pharmaceutically acceptable vehicles, diluents, adjuvants or excipients.

The present invention also provides the above-mentioned Fc receptor-binding/complement-binding-reduced Fc fragment molecules, the above-mentioned antibodies, the above-mentioned polynucleotides, recombinant vectors, host cells, recombinant bacteria, adenoviruses, lentiviruses or virus particles in preparation for prevention and/or vaccines for the treatment of novel coronavirus infections.

The present invention also provides a therapeutic method for preventing or treating a disease or disorder caused by a novel coronavirus, the method comprising administering the molecule of the Fc modified fragment of the present invention, the above-mentioned antibody, the above-mentioned polynucleotide, recombinant Vectors, transgenic cell lines, recombinant bacteria, adenoviruses, lentiviruses or viral particles.

Description of drawings

Figure 1: Flow cytometric identification of the corresponding FcR expression in CHO-K1-CD32A, CHO-K1-CD32B, CHO-K1-CD64 cells

Figure 2: Fd11 engineering reduces binding of CoV2-HB27-IgG1 antibody to Fc receptor protein

Figure 3: Fd11 engineering reduces binding of CoV2-HB27-IgG1 antibody to complement C1q protein

Figure 4: Fd11 engineering reduces ADCC effect of CoV2-HB27-IgG1 antibody

Figure 5: IgG1 subtype and Fd11-IgG4 subtype CoV2-HB27 antibodies have little ADCP effect

Figure 6: IgG1 subtype and Fd11-IgG4 subtype CoV2-HB27 antibodies have little CDC effect

Figure 7: Fd6, Fd11 engineering reduces the ADE effect of CoV2-HB27-IgG1 antibody on CHO-K1-CD32A cells

Figure 8: Fd6, Fd11 engineering reduces the ADE effect of CoV2-HB27-IgG1 antibody on CHO-K1-CD32B cells

Figure 9: Fd11 engineering reduces the ADE effect of SARS-2-H014-IgG1 antibody on CHO-K1-CD64 cells

Figure 10: Fd6, Fd11 engineering reduces the ADE effect of CoV2-HB27-IgG1 antibody on Raji cells

Figure 11: Fd11 engineering reduces the ADE effect of SARS-2-H014-IgG1 antibody on THP-1 cells

Figure 12: Fd11 engineering reduces the ADE effect of SARS-2-H014-IgG1 antibody on U937 cells

detailed description

Antibody-reducing ADE is an important task in the development of antiviral biologics and vaccines.

The present invention establishes a method for reducing the effect of viral ADE. Specifically, the inventor achieves the reduction of viral ADE by modifying the Fc fragment of an antibody to reduce its binding to Fc receptors/complement binding.

Viruses include but are not limited to coronavirus, influenza virus, cold virus, parainfluenza virus, upper respiratory syncytial virus, dengue virus, West Nile virus, Marburg virus, Lassa hemorrhagic fever virus, HIV virus, Ebola virus, Herpes zoster virus, CMV virus, hepatitis virus, human herpes simplex virus, cytomegalovirus, rotavirus, Epstein-Barr virus, measles virus, mumps virus, human papilloma virus, flavivirus or influenza virus; preferably SARS- CoV-2, SARS-CoV, MERS-CoV; influenza A virus (including H10N8, H7N9, H1N1, H5N1, etc.), influenza B virus; Ebola virus; False and true viruses.

"Antibody-dependent enhancement effect (ADE)", or immune enhancement or disease enhancement, refers to the binding of the virus to a non-neutralizing antibody or to a sub-neutralizing concentration of the antibody, the Fc segment of the antibody and the surface-expressed FcR cells bind and mediate the entry of the virus into these cells, thereby enhancing the infectivity of the virus. This phenomenon results in enhanced infectivity and toxicity, and ADEs modulate immune responses and can cause persistent inflammation, lymphopenia, and/or cytokine storms.

The main mechanism of ADE is that the Fc segment of the antibody in the antigen-antibody complex interacts with specific cells such as B cells, monocytes, macrophages, and dendritic cells under conditions of incomplete neutralization or non-neutralization of the virus by antibodies. After the binding of FcγR-expressing cells, endocytosis into target cells is achieved [11,12]. In other words, the antibody helps the virus to enter the target cell leading to an increase in the number of infected cells. This process, referred to as exogenous ADE, is Fcγ receptor (FcyR) dependent and occurs when the organism is secondary to infection with a heterologous serotype virus. Circulating antibodies produced during primary viral infection recognize and bind to the secondary infected virus, enhancing viral infectivity rather than promoting virus neutralization by internalizing virus-antibody immune complexes in FcγR-bearing cells. Once internalized, these immune complexes may modulate innate antiviral cellular responses, resulting in a dramatic increase in viral production per cell, a process known as endogenous ADE. Exogenous and endogenous ADEs together promote the massive release of inflammatory and vasoactive mediators, ultimately leading to disease aggravation [12].

The term "receptor" is a biochemical concept that refers to a class of molecules that can transduce extracellular signals and produce specific effects within cells. The resulting effects may only last for a short period of time, such as altering the metabolism of cells or the movement of cells. It may also be a long-term effect, such as up- or down-regulating the expression of one or more genes.

The term "Fc receptor" or "FcR" refers to a receptor that binds to the Fc region of an antibody. The receptors that bind IgG antibodies are gamma receptors, which include FcyRI, FcyRII, and FcyRIII subtypes. Human Fcγ receptors mainly include FcγRI (CD64), FcγRII (CD32), and FcγRIII (CD16). Different virus types cause ADE-dependent Fc receptors with certain differences. SARS and dengue fever mainly report that ADE is caused by CD32A[11,13], MERS mainly triggers ADE through CD32 and CD64[14], and Chikungunya virus Mainly through CD32, CD16-mediated ADE [5].

As an important cell type for phagocytosing antigen-antibody complexes, macrophages simultaneously express several receptors of CD16, CD32, and CD64. In a rhesus monkey animal model, anti-S protein antibodies can induce more immune cells (especially inflammatory macrophages) to infiltrate the lungs after SARS infection. At the same time, virus-induced macrophage ADE can induce Anti-inflammatory macrophage M2 produces more inflammatory factors such as IL-6, IL-8, MCP-1, etc., resulting in strong lung damage [15].

B cells have strong CD32 expression, and there are relatively few studies on the effect of virus on B cell function after infection by ADE. Antiserum produced by SARS-CoV vaccine can enhance virus infection of B cells [16]. Compared with normal people, the B cell composition of patients after dengue virus infection is quite different. The number of immature B cells, transitional B cells and Breg in severe patients is significantly lower than that in mild patients. Mature B cells cannot produce IL-10, activation markers and the expression of antigen-presenting molecules, so the acute infection phase of dengue has a serious impact on B cell function [17], which may be related to ADE.

The inventors modified the corresponding Fc fragment by means of molecular biology to obtain a molecule of Fc fragment with reduced Fc receptor binding/complement binding, thereby reducing the ADE effect of the virus. Further, the inventors invented a molecule for reducing the effect of viral ADE, the molecule comprising a) an antigen-binding fragment that recognizes and binds to the viral coat protein or extramembrane domain; and the aforementioned b) Fc receptor binding/complement binding Decreased Fc fragments. A molecule comprising a) an antigen-binding fragment that recognizes and binds to a viral coat protein or extramembrane domain; and b) an Fc fragment, wherein b) has been engineered by molecular biological means to have reduced Fc receptor binding and/or complement binding. When the molecule is administered as a therapeutic or prophylactic agent to a subject infected with a virus, or at risk of being infected with a virus, due to its reduced Fc receptor binding and/or complement binding, it interacts with specific cells such as B cells, monocytes, FcγR-expressing cells such as cells, macrophages, dendritic cells, etc. have decreased binding, with the consequence of decreased endocytosis of target cells. Viral infection is thereby reduced.

In one embodiment of the present invention, the inventors engineered antibodies COV2-HB27 and SARS-2-H014. CoV2-HB27 is a humanized antibody that can block the binding of SARS-CoV-2 spike protein (S protein) to the ACE2 receptor and efficiently neutralize SARS-CoV-2 virus-infected cells. For details of its preparation, structure and properties, please refer to patent application 202010349190.3 and PCT/CN2021/089748 (incorporated into this specification by reference in its entirety). SARS-2-H014 is a human that can cross-block the binding of SARS-CoV-2 and SARS-CoV spike protein (S protein) to the ACE2 receptor, and efficiently neutralize SARS-CoV-2 and SARS-CoV virus-infected cells. Antibody. For details of its preparation, structure and properties, please refer to patent application 202010219867.1 and PCT/CN2021/082374 (incorporated into this specification by reference in its entirety).

The term "virus-like particle" (VLP) or "pseudovirus" refers to a polyprotein structure consisting of the corresponding native viral structural proteins, but lacking all or part of the viral genome, especially the replication and infectious components of the viral genome, and therefore not replicable and infectious. The polyprotein structure highly mimics its corresponding natural virus particles in shape and size, and can be formed spontaneously after recombinant expression of viral structural proteins.

The term "antibody" means an immunoglobulin molecule and refers to any form of antibody that exhibits the desired biological activity. Including, but not limited to, monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, and multispecific antibodies (e.g., bispecific antibodies), and even antibody fragments. Typically, a full-length antibody structure preferably comprises 4 polypeptide chains, usually 2 heavy (H) chains and 2 light (L) chains interconnected by disulfide bonds.

Based on the amino acid sequence of their heavy chain constant region, intact antibodies can be assigned to five classes of antibodies: IgA, IgD, IgE, IgG, and IgM, of which IgG and IgA can be further divided into subclasses (isotypes), such as IgG1, IgG2 , IgG3, IgG4, IgA1 and IgA2. Accordingly, the heavy chains of the five classes of antibodies are classified as alpha, delta, epsilon, gamma, and mu chains, respectively. The light chain of an antibody can be classified into kappa and lambda based on the amino acid sequence of its light chain constant region.

Taking an IgG antibody as an example, from its N-terminus to its C-terminus, each heavy chain has a variable region (VH, variable heavy chain domain) followed by 3 constant domains (CH1, CH2 and CH3, also known as heavy chain) constant region). Similarly, from the N-terminus to the C-terminus, each light chain has a variable region (VL, light chain variable domain) followed by a constant region (CL, also known as light chain constant region). IgG antibodies are cleaved by papain to form two "Fab parts" (or "Fab fragments") and an "Fc part" (or "Fc fragments"). The "Fab portion" of an antibody comprises the variable and constant domains of the light chain and the variable and first constant domain (CH1) of the heavy chain. Has antigen binding ability. The "Fc portion" of an antibody, comprising two heavy chains, CH2 and CH3, is not directly involved in the binding of the antibody to antigen, but exhibits various effector functions, such as antibody-dependent cellular cytotoxicity (ADCC) and "antibody-dependent enhancement ( ADE)”.

The term "binding affinity" refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule and its binding partner. Unless otherwise specified, "binding affinity" as used herein refers to the intrinsic binding affinity that reflects a 1:1 interaction between members of a binding pair (eg, antibody and antigen). "KD", "binding rate constant k _on" and "off rate constant k _off" is generally used to describe a molecule (e.g. an antibody) and its binding partner (e.g. antigen) between the affinity, i.e., binding a particular protein ligand tight degree. Binding affinity is affected by non-covalent intermolecular interactions such as hydrogen bonding, electrostatic interactions, hydrophobic and van der Waals forces between two molecules. Additionally, the binding affinity between a ligand and its target molecule may be affected by the presence of other molecules. Affinity can be analyzed by conventional methods known in the art, including the ELISA described herein.

In one embodiment of the present invention, the inventors modified the heavy chain IgG1 constant region of the CoV2-HB27 antibody by means of molecular biology to obtain IgG1 subtype humanized antibodies with reduced Fc function CoV2-HB27-Fd6-IgG1 and CoV2- HB27-Fd11-IgG4; CoV2-HB27-Fd6-IgG1 antibodies have almost no binding to CD32a and CD32b; only weak binding to CD64, and only weak binding to C1q (see patent application 202010349190.3 and PCT/CN2021/ 089748). CoV2-HB27-Fd11-IgG4 antibody has almost no binding to CD32A, CD32B and CD64. Both CoV2-HB27-Fd6-IgG1 and CoV2-HB27-Fd11-IgG4 exhibited reduced ADE effects on CHO-K1-CD32A cells, CHO-K1-CD32B cells and Raji cells.

In another embodiment of the present invention, the inventors modified the heavy chain IgG4 constant region of the SARS-2-H014 antibody by means of molecular biology, and the SARS-2-H014-Fd11-IgG4 antibody was associated with CD32a, CD32b, CD16a and C1q Complement protein has no binding, has a very weak binding level to CD64 under high concentration conditions, and binds to FcRn similar to IgG1 subtype antibody under pH 6.0 conditions (see patent application 202010219867.1 and PCT/CN2021/082374 for details). SARS-2-H014-Fd11-IgG4 antibody showed reduced ADE effect on CHO-K1-CD64, THP-1 and U937 cells.

To express the molecules of the invention, standard recombinant DNA expression methods can be used (see, e.g., Goeddel; Gene Expression Technology. Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990)). For example, a nucleotide sequence encoding the desired molecule of the invention can be inserted into an expression vector, which is then transfected into a suitable host cell. Suitable host cells are prokaryotic cells and eukaryotic cells. Examples of prokaryotic host cells are bacteria and examples of eukaryotic host cells are yeast, insect or mammalian cells. It will be appreciated that the design of an expression vector including selection regulatory sequences is influenced by a variety of factors, such as the choice of host cell, the level of protein expression desired, and whether expression is constitutive or inducible.

Molecules of the invention can be recovered and purified from recombinant cell culture by known methods including, but not limited to, ammonium sulfate or ethanol precipitation, acid extraction, protein A affinity chromatography, protein G affinity chromatography, anionic Or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, and lectin chromatography. High performance liquid chromatography ("HPLC") can also be used for purification. See, eg, Colligan, Current Protocols in Immunology, or Current Protocols in Protein Science, John Wiley & Sons, NY, NY, (1997-2001), eg, Chapters 1, 4, 6, 8, 9, 10, each by reference The full text is incorporated into this article.

Molecules of the present invention include naturally purified products, products of chemical synthetic methods, and products produced by recombinant techniques from prokaryotic and eukaryotic hosts including, for example, yeast, higher plant, insect and mammalian cells. Molecules of the present invention may be glycosylated, or may be non-glycosylated. Such methods are described in a number of standard laboratory manuals, eg, Sambrook, supra, sections 17.37-17.42; Ausubel, supra, chapters 10, 12, 13, 16, 18 and 20.

Accordingly, embodiments of the present invention are also host cells comprising the vectors or nucleic acid molecules described above, wherein the host cells may be higher eukaryotic host cells such as mammalian and insect cells, lower eukaryotic host cells such as yeast cells, and may For prokaryotic cells such as bacterial cells.

use

The method of the present invention can be used to treat, prevent or detect viruses such as SARS-CoV-2, diseases caused by SARS-CoV, such as acute respiratory infectious diseases caused by SARS-CoV-2 and SARS-CoV viruses.

pharmaceutical composition

One or more of the molecules, nucleic acids, and vectors of the present invention, together with at least one other chemical agent, can be formulated into pharmaceutical compositions comprising the above-mentioned active ingredients and one or more pharmaceutically acceptable carriers, diluents, or excipients agent; optionally, one or more other therapeutic agents may also be included.

Reagent test kit

The present invention also relates to pharmaceutical packages and kits comprising one or more containers containing the above-mentioned pharmaceutical compositions of the present invention. Associated with such a container may be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of a drug or biological product, which reflects approval for human administration by the agency of manufacture, use or sale of the product.

preparation and storage

The pharmaceutical compositions of the present invention can be prepared in a manner known in the art, eg, by conventional mixing, dissolving, granulating, grinding, emulsifying, encapsulating, entrapping, or lyophilizing methods.

After pharmaceutical compositions comprising a compound of the present invention formulated in an acceptable carrier have been prepared, they can be placed in a suitable container and labeled for treatment of the indicated condition. Such labels would include the amount, frequency and method of administration.

drug combination

The above-described pharmaceutical compositions comprising the antibodies of the invention are also combined with one or more other therapeutic agents, wherein the resulting combination does not cause unacceptable adverse effects.

The following examples are used to illustrate the present invention, but not to limit the present invention.

Example

Example 1: Construction of CHO-K1 cell line stably expressing FcR

1.1 Transfection of CHO-K1 cells

The pCMV3 vector containing CD32A, CD32B, CD64 and FcRγ-chain (resistance: Hygromycin) (source, Beijing Yiqiao Shenzhou Technology Co., Ltd.) was transfected into CHO-K1 cells (source: ATCC) to prepare CD32A expression respectively (transfected with CD32A vector alone), CD32B (transfected with CD32B vector alone) or CD64 (co-transfected with CD64 and FcRγ-chain vector) CHO-K1 cells. CHO-K1 cells one day in advance digestion, counted and incubated at 3.5x10 ⁶ cells in T25 flask and make up the medium (DMEM + 10% FBS + 69μg / mL proline) to 7 mL, placed in 37 ℃, 5% CO ₂ Plate overnight in the incubator. The next day, take 20 μg of CD32A plasmid, 20 μg of CD32B plasmid, 10 μg of CD64 plasmid and FcRγ-chain plasmid respectively (mix CD64 plasmid and FcRγ-chain plasmid), and then use CHO-K1 medium to dilute the plasmid to 1 mL, take Sinofection Transfection Reagent (Source: Beijing Yiqiao Shenzhou Technology Co., Ltd.) 25 μL, diluted to 1 mL with CHO-K1 medium, added the diluted Sino Transfection Reagent to the diluted plasmid, mixed well, and incubated at room temperature for 10 min. After the transfection mixture was added to each T25 flask were placed 37 ℃, 5% CO ₂ incubator for 4h, the supernatant was removed and placed in fresh medium after 7mL 37 ℃, 5% CO ₂ Cultivated in an incubator.

1.2 Cell screening and screening of high-expressing monoclonal cell lines

Three days after transfection, hygromycin was added to the cells to select transfected positive cells. One week later, the cells were digested, and the cells were diluted to 0.5 cells/mL with hygromycin-containing medium, and 100 μL of the cell suspension was added to each well of a 96-well flat-bottom cell culture plate. Incubate in a 37 °C, 5% CO ₂ incubator. After the monoclonal cells were formed in the culture wells, the monoclonal cells were expanded and cultured, and the CD32 and CD64 antibodies (source: BD) were used to detect the expression of FcR on the cells. -K1-CD32B and CHO-K1-CD64 monoclones were expanded and used for subsequent experiments, and the results of flow cytometry were shown in Figure 1.

Example 2: Pseudovirus preparation

2.1 SARS-CoV-2 pseudovirus packaging

Pseudovirus expressing the full-length protein of SARS-CoV-2S was packaged using 293T (source: ATCC). 293T was digested one day in advance, counted, and 3.5x10 ⁶ cells were added to a T25 culture flask, supplemented with medium (DMEM+10% FBS) to 7 mL, and placed in a 37°C, 5% CO ₂ incubator for overnight plating. The next day, take 20 μg of SARS-CoV-2 Spike plasmid (source: Beijing Yiqiao Shenzhou Technology Co., Ltd.), and then use 293T culture to dilute the plasmid to 1 mL, and take 25 μL of Sinofection Transfection Reagent (source: Beijing Yiqiao Shenzhou Technology Co., Ltd.) , use 293T culture to dilute to 1mL, add the diluted Sino Transfection Reagent to the diluted plasmid, mix well, and incubate at room temperature for 10min. The cell plates were placed 37 ℃, 5% CO ₂ incubator after the culture medium was changed 6h. 24h later, VSV pseudovirus (VSV△G-Luc) was used to infect 293T cells transfected with SARS-CoV-2 Spike, 1h later, washed three times with PBS, and supplemented with 7mL of fresh 293T medium. After 24 hours, the supernatant was collected, filtered with a 0.45 μm filter to remove cell debris, and a pseudovirus solution was obtained, which was stored at -80°C.

2.2 SARS-CoV-2 pseudovirus titer detection

The virus was diluted 10 times by limiting dilution method, and a total of 6 virus concentrations were set, each with 6 duplicate wells. The 96-well plate was seeded at a density of 3×10 ⁴ cells/mL VERO E6 (source: Cell Resource Center, Institute of Basic Medicine, Chinese Academy of Medical Sciences) suspension, 100 μL/well. Add 100 μL of serially diluted virus to each well, use the cell culture medium as a negative control, mix well and place in a 37°C, 5% CO ₂ incubator for 24 h. After the incubation, discard the supernatant, add passive lysis buffer (source: Promega) diluted to 1x, 100 μL/well, and mix to lyse the cells. 40 μL/well was transferred to a 96-well white bottom plate to detect the fluorescent signal, and the TCID ₅₀ value was calculated using the Karber method.

Example 3: Antibody Preparation

3.1 Source of antibody sequence: CoV2-HB27 is a humanized antibody that can block the binding of the SARS-CoV-2 spike protein (S protein) to the ACE2 receptor and efficiently neutralize cells infected by the SARS-CoV-2 virus. Details of its preparation, structure and properties are detailed in patent application 202010349190.3 and PCT/CN2021/089748 (herein incorporated for reference and made a part hereof).

SARS-2-H014 is a human that can cross-block the binding of SARS-CoV-2 and SARS-CoV spike protein (S protein) to the ACE2 receptor, and efficiently neutralize SARS-CoV-2 and SARS-CoV virus-infected cells. Antibody. Its preparation, structure and properties are detailed in patent application 202010219867.1 and PCT/CN2021/082374 (herein incorporated for reference and made a part hereof).

3.2 Production of CoV2-HB27-IgG1 antibody

The nucleotide sequence of the CoV2-HB27 heavy chain variable region (SEQ ID NO: 5) was obtained by the method of total gene synthesis. Inserted into pSE vector cleaved by ScaI+NheI (source: Fermentas, the same below) with heavy chain signal peptide (SEQ ID NO:3) and heavy chain IgG1 constant region (SEQ ID NO:7) by In-fusion method The CoV2-HB27 heavy chain (SEQ ID NO: 1) expression vector was obtained from .

The nucleotide sequences of the CoV2-HB27 light chain variable region (SEQ ID NO: 6) were obtained by the method of total gene synthesis. Inserted by In-fusion method into ScaI+BsiWI (source: Fermentas) digested pSE with light chain signal peptide (SEQ ID NO:4) and light chain kappa constant region nucleotide sequence (SEQ ID NO:8) The CoV2-HB27 light chain (SEQ ID NO: 2) expression vector was obtained from the vector.

After the plasmid was extracted, it was transfected into 293E cells (source: Invitrogen, the same below), cultured and expressed for 7 days, and purified with a protein A purification column to obtain a high-purity antibody.

Whole gene synthesis of CoV2-HB27 heavy chain variable region primers:

F1 (SEQ ID NO: 35)	GCTACCAGGGTGCTGAGTGAGGTGAAACTGGTGGAGTCTGGAGGAGGACTG
R1 (SEQ ID NO: 36)	CAGGGAGCCTCCAGGCTTCACCAGTCCTCCTCC
F2 (SEQ ID NO: 37)	CCTGGAGGCTCCCTGAGACTGTCCTGTGCTGCC
R2 (SEQ ID NO: 38)	GTTGCTGAAGGTGAAGCCAGAGGCAGCACAGGA
F3 (SEQ ID NO: 39)	TTCACCTTCAGCAACTATGGGATGAGTTGGGT
R3 (SEQ ID NO: 40)	CTCTTGCCAGGAGCCTGTCTCACCCAACTCATC
F4 (SEQ ID NO: 41)	GGCTCCTGGCAAGAGATTGGAGTGGGTGGCTG
R4 (SEQ ID NO: 42)	AGGAGCCTCCAGAGGAAATCTCAGCCACCCACT

F5 (SEQ ID NO: 43)	CCTCTGGAGGCCTCCTACACCTACTACCCTGAC
R5 (SEQ ID NO: 44)	GGTGAACCTGCCTGTCACTGTGTCAGGGTAGTA
F6 (SEQ ID NO: 45)	ACAGGCAGGTTCACCATCAGCAGGGACAATGCC
R6 (SEQ ID NO: 46)	TTGGAGGTAGAGGGTGTTCTTGGCATTGTCCCT
F7 (SEQ ID NO: 47)	ACCCTCTACCTCCAAATGAACTCCCTGAGGGCT
R7 (SEQ ID NO: 48)	GTAGTAGACTGCTGTGTCCTCAGCCCTCAGGGA
F8 (SEQ ID NO: 49)	ACAGCAGTCTACTACTGTGCCAGGTTCAGATAT
R8 (SEQ ID NO: 50)	CACTGTGCCTCCTCCTCCATCATATCTGAACCT
F9 (SEQ ID NO: 51)	GGAGGAGGCACAGTGGACTACTGGGGACAAGGC
R9 (SEQ ID NO: 52)	TGGGCCCTTGGTGCTTGCGCTGGACACTGTCACCAGGGTGCCTTGTCCCCA

Splicing CoV2-HB27-IgG1 heavy chain primers:

Whole gene synthesis of COV2-HB27 light chain variable region primers:

F12 (SEQ ID NO: 57)	GCCACAGGAGTGCATAGTGAGATTGTGCTGACCCAGAGCCCTGCCACCCTG
R12 (SEQ ID NO: 58)	CCTCTCTCCAGGGCTCAGGGACAGGGTGGCAGG
F13 (SEQ ID NO: 59)	AGCCCTGGAGAGAGGGCTACCCTGTCCTGTAGG
R13 (SEQ ID NO: 60)	GTTGTCCACAGACTCAGATGCCCTACAGGACAG
F14 (SEQ ID NO: 61)	GAGTCTGTGGACAACTATGGCATCTCC
R14 (SEQ ID NO: 62)	GGAACCAGTTCATAAAGGAGATGCCATA
F15 (SEQ ID NO: 63)	TTATGAACTGGTTCCAACAGAAGCCTG
R15 (SEQ ID NO: 64)	AGTCTTGGGGCTTGTCCAGGCTTCTGTT
F16 (SEQ ID NO: 65)	ACAAGCCCCAAGACTGCTGATTTATGC
R16 (SEQ ID NO: 66)	GCCCTGGTTGCTGGCAGCATAAATCAGC
F17 (SEQ ID NO: 67)	GCCAGCAACCAGGGCCTCTGGAGTGCCTGCCAGG
R17 (SEQ ID NO: 68)	GCCAGAGCCAGAGCCAGAGAACCTGGCAGGCAC
F18 (SEQ ID NO: 69)	GGCTCTGGCTCTGGCACAGACTTCTCCCTGACC
R18 (SEQ ID NO: 70)	CTCAGGTTCCAAGGAGGAGATGGTCAGGGAGAA
F19 (SEQ ID NO: 71)	TCCTTGGAACCTGAGGACTTTGCTGTCTACTTC
R19 (SEQ ID NO: 72)	CACCTCCTTGCTCTGTTGACAGAAGTAGACAGC
F20 (SEQ ID NO: 73)	CAGAGCAAGGAGGTGCCAAGGACCTTTGGACAA
R20 (SEQ ID NO: 74)	TGGTGCAGCCACCGTACGCTTAATCTCCACCTTGGTGCCTTGTCCAAAGGT

3.3 Production of CoV2-HB27-Fd6-IgG1 antibody

In order to reduce the immune function mediated by the Fc fragment of the antibody, the constant region of the IgG1 subtype was subjected to nucleotide mutation with reference to the literature [18] to obtain a genetically engineered heavy chain IgG1 constant region nucleotide sequence (Fd6-IgG1, SEQ ID NO:9). The CoV2-HB27-Fd6-IgG1 heavy chain sequence (SEQ ID NO: 10) was obtained by PCR, which comprises the heavy chain signal peptide nucleotide sequence (SEQ ID NO: 3), the heavy chain variable region nucleotide sequence (SEQ ID NO: 3) ID NO: 5) and Fd6-IgG1 constant region nucleotide sequence (SEQ ID NO: 9). The expression vector containing CoV2-HB27-Fd6-IgG1 heavy chain (SEQ ID NO: 10) was obtained by inserting into the pSE vector digested by HindIII+XbaI by In-fusion method.

Splicing CoV2-HB27-Fd6-IgG1 heavy chain primers:

The CoV2-HB27-Fd6-IgG1 heavy chain (SEQ ID NO:10) expression vector and CoV2-HB27 light chain (SEQ ID NO:2) expression vector plasmids were extracted, transfected into 293E cells, cultured and expressed for 7 days, and purified with protein A The CoV2-HB27-Fd6-IgG1 antibody with reduced Fc function was obtained by column purification.

3.4 Production of CoV2-HB27-Fd11-IgG4 antibody

In order to reduce the immune function mediated by the Fc fragment of the antibody, nucleotide mutations were performed on the constant region of the IgG4 subtype with reference to the literature [18] to obtain a genetically engineered heavy chain IgG4 constant region nucleotide sequence (Fd11-IgG4, SEQ ID NO: 11). The CoV2-HB27-Fd11-IgG4 heavy chain sequence (SEQ ID NO: 12) was obtained by PCR, which comprises the heavy chain signal peptide nucleotide sequence (SEQ ID NO: 3), the heavy chain variable region nucleotide sequence (SEQ ID NO: 3) ID NO: 5) and the Fd11-IgG4 constant region nucleotide sequence (SEQ ID NO: 11). The expression vector containing CoV2-HB27-Fd11-IgG4 heavy chain (SEQ ID NO: 12) was obtained by inserting into pSE vector digested by HindIII+XbaI by In-fusion method.

Splicing CoV2-HB27-Fd11-IgG4 heavy chain primers:

The CoV2-HB27-Fd11-IgG4 heavy chain (SEQ ID NO:12) expression vector and CoV2-HB27 light chain (SEQ ID NO:2) expression vector plasmids were extracted, transfected into 293E cells, cultured and expressed for 7 days, and purified with protein A The CoV2-HB27-Fd11-IgG4 antibody with reduced Fc function was obtained by column purification.

3.5 Production of SARS-2-H014-IgG1 antibody

The nucleotide sequences of SARS-2-H014 heavy chain variable region (SEQ ID NO: 16) were obtained by the method of total gene synthesis. SARS was obtained by inserting into pSE vector with heavy chain signal peptide (SEQ ID NO: 15) and heavy chain IgG1 constant region (SEQ ID NO: 7) digested by ScaI+NheI (source: Fermentas) by In-fusion method -2-H014 heavy chain (SEQ ID NO: 13) expression vector.

The SARS-2-H014 light chain variable region (SEQ ID NO: 17) was obtained by the method of total gene synthesis, and inserted into the light chain signal peptide (SEQ ID NO: 4) and the light chain kappa constant by the In-fusion method The SARS-2-H014 light chain (SEQ ID NO: 14) expression vector was obtained from the pSE vector digested by ScaI+BsiWI (source: Fermentas) with the nucleotide sequence of the region (SEQ ID NO: 18). After the plasmid was extracted, it was transfected into 293E cells (source: Invitrogen) for culturing and expression for 7 days, and purified by protein A purification column to obtain high-purity antibody.

Whole gene synthesis of SARS-2-H014 heavy chain variable region primers:

Whole gene synthesis of SARS-2-H014 light chain variable region primers:

3.6 Production of SARS-2-H014-Fd11-IgG4 antibody

Construction and production of IgG4 subtype humanized antibody SARS-2-H014 with reduced Fc function

In order to reduce the immune function mediated by the Fc fragment of the antibody, nucleotide mutations were performed on the constant region of the IgG4 subtype with reference to the literature [18] to obtain a genetically engineered heavy chain IgG4 constant region nucleotide sequence (Fd11-IgG4, SEQ ID NO: 11). The SARS-2-H014-Fd11-IgG4 heavy chain sequence (SEQ ID NO: 19) was obtained by splicing PCR, which contained the heavy chain signal peptide nucleotide sequence (SEQ ID NO: 15), and the SARS-2-H014 heavy chain could be Variable region nucleotide sequence (SEQ ID NO: 16) and Fd11-IgG4 nucleotide sequence (SEQ ID NO: 11). The SARS-2-H014-Fd11-IgG4 heavy chain (SEQ ID NO: 19) expression vector was obtained by inserting into the pSE vector digested by HindIII+XbaI (source: Fermentas) by the In-fusion method.

Splicing SARS-2-H014-Fd11-IgG4 heavy chain primers:

F44 (SEQ ID NO: 117)	GTCACCGTCCTGACACGAAGCTTGCCGCCACCATG
R44 (SEQ ID NO: 118)	TGGGCCCTTGGTGCTTGC
F45 (SEQ ID NO: 119)	GCAAGCACCAAGGGGCCCA
R45 (SEQ ID NO: 120)	ACTATAGAATAGGGCCCTCTAGA

Extract SARS-2-H014-Fd11-IgG4 heavy chain (SEQ ID NO:19) expression vector, SARS-2-H014 light chain (SEQ ID NO:14) expression vector plasmid, transfect HEK-293 cells for culture expression 7 On the same day, a protein A purification column was used to obtain a highly purified IgG4 subtype humanized SARS-2-H014 antibody with reduced Fc function, namely SARS-2-H014-Fd11-IgG4.

3.7 Antibody production and purification

The 293E cells were passaged to 200mL/flask with SCD4-4-TC2 medium (source: Beijing Yiqiao Shenzhou Technology Co., Ltd.), the initial seeding density was 0.3-0.4×10 ⁶ cell/mL, and the rotation speed was 175 rpm at 37 °C CO _{2 .} Cell culture was performed in a shaker. After the cell density reaches 1.5~3×10 ⁶ cells/mL, add a total of 100 μg light and heavy chain plasmid DNA mixed at a ratio of 1:1 and 800 μL TF2 transfection reagent (source: Beijing Yiqiao Shenzhou Technology Co., Ltd.) Cultivation was continued in the bed until harvest on the 7th day. The culture medium was centrifuged at 4000rpm for 25min, the supernatant was collected, and 1/5 of the supernatant volume was added to the stock buffer (source: Shenzhou Cell Engineering Co., Ltd.). Use PBS to equilibrate the Protein A column (source: Shenzhou Cell Engineering Co., Ltd.) for 5-10 times the column volume, add the filtered culture supernatant to the column, and equilibrate 5-10 times the column volume again, then add sodium acetate to the column. Buffer (source: Shenzhou Cell Engineering Co., Ltd.) was used to elute the samples. After elution, the samples were neutralized with Tris buffer until neutral.

Example 4: Fc function of COV2-HB27-Fd11-IgG4 antibody

4.1 CD16a binding function of CoV2-HB27-Fd11-IgG4 antibody

Avidin protein (source: Thermo, the same below) at a concentration of 10 μg/mL was coated on a 96-well plate, 100 μL per well, and coated overnight at 2-8°C. The next day, the plate was washed, and after blocking at room temperature for 1 h, 100 μL of biotin-labeled CD16a-AVI-His(V158) + BirA protein (source: Beijing Yiqiao Shenzhou Technology Co., Ltd.) was added at a concentration of 5 μg/mL, and the plate was washed after incubating at room temperature for 1 h. . 100 μL of CoV2-HB27 antibodies with different Fc functional forms were added at the concentration of 5 μg/mL and 1 μg/mL. After 1 h of incubation, wash the plate to remove unbound antibodies, add goat anti-human IgGF(ab)2/HRP (source: Jackson ImmunoResearch, the same below), and repeat the plate washing after incubation, and finally add the substrate chromogenic solution for color development. microplate reading OD _450.

As a result, as shown in Figure 2A, the Fd11-IgG4 format antibody with reduced Fc function has only very weak binding to CD16a compared to the IgG1 format.

4.2 CD32-binding function of CoV2-HB27-Fd11-IgG4 antibody

Avidin protein at a concentration of 10 μg/mL was coated on a 96-well plate, 100 μL per well, overnight at 2-8°C. The next day, the plate was washed, and after blocking at room temperature for 1 h, 100 μL of biotin-labeled CD32a-AVI-His(R131)+BirA protein (source: Beijing Yiqiao Shenzhou Technology Co., Ltd.) or CD32b-AVI-HIS was added at a concentration of 5 μg/mL. +BirA (source: Beijing Yiqiao Shenzhou Technology Co., Ltd.) protein, incubated at room temperature for 1 h and washed the plate. Add 100 μL of CoV2-HB27 antibodies of different Fc functional forms at concentrations of 5 μg/mL and 1 μg/mL. After incubation for 1 h, wash the plate to remove unbound antibodies, add goat anti-human IgG F(ab)2/HRP and incubate, repeat the plate washing, add substrate color development solution for color development, and read the OD _{450 with a} microplate reader after termination.

As a result, as shown in Fig. 2, the Fd11-IgG4 format antibody with reduced Fc function showed almost no binding to CD32a and CD32b compared with the IgG1 format antibody (Figs. 2B and 2C).

4.3 CD64-binding function of CoV2-HB27-Fd11-IgG4 antibody

Avidin protein at a concentration of 10 μg/mL was coated on a 96-well plate, 100 μL per well, overnight at 2-8°C. The next day, the plate was washed, and after blocking at room temperature for 1 h, 100 μL of biotin-labeled CD64-AVI-His+BirA protein (source: Beijing Yiqiao Shenzhou Technology Co., Ltd.) was added at a concentration of 0.5 μg/mL, and the plate was washed after incubating at room temperature for 1 h. Add 100 μL of CoV2-HB27 antibodies of different Fc functional forms at concentrations of 5 μg/mL and 1 μg/mL. After incubation for 1 h, wash the plate to remove unbound antibodies, add goat anti-human IgG F(ab)2/HRP and incubate, repeat the plate washing, and finally add the substrate chromogenic solution for color development, and read the OD ₄₅₀ after termination.

As a result, as shown in Fig. 2D, the Fd6-IgG1 format antibody with reduced Fc function has only weaker binding to CD64 than the IgG1 format antibody.

4.4 C1q-binding function of CoV2-HB27-Fd11-IgG4 antibody

Different concentrations of CoV2-HB27 antibodies with different Fc functional forms were coated on a 96-well plate, 100 μL/well, overnight at 4°C, and the antibody concentration was 5 μg/mL and 1 μg/mL. The plate was washed the next day, and after blocking at room temperature for 1 h, 5 μg/mL of C1q complement protein (source: Beijing Yiqiao Shenzhou Technology Co., Ltd.) was added, 100 μg/well, and incubated for 1 h. Wash the plate to remove unbound protein, add 0.5 μg/mL anti-C1q/HRP (source: Abcam) and incubate, repeat the plate washing, and finally add the substrate color solution for color development, and detect the OD ₄₅₀ after termination.

As a result, as shown in Figure 3, the Fd11-IgG4 format antibody with reduced Fc function has only weak binding to C1q.

4.5 ADCC function mediated by CoV2-HB27-Fd11-IgG4 antibody

The 293FT cell line (293FT-SARS-CoV-2-S, source: Shenzhou Cell Engineering Co., Ltd., the same below) expressing SARS-CoV-2 full-length protein transiently was used as the target cell to stably transfect CD16AV and NFAT- The Jurkat cells of Luc2P (Jurkat-NFAT/Luc2P-CD16AV) are effector cells, and the ADCC function of the humanized antibody is detected by the reporter gene method.

^{Target cells at a density of 1×10 5} cells/mL and an equal volume of equal density of effector cells were inoculated in 50 μL/well in a 96-well plate. Afterwards, 50 μL of CoV2-HB27 antibody and H7N9-R1 negative control antibody of different Fc functional forms were added. CoV2-HB27-IgG1, CoV2-HB27-Fd11-IgG4 antibody and H7N9-R1 negative control antibody were added at concentrations of 20 μg/mL, 1 μg/mL and 0.05 μg/mL. 37 ℃, 5% CO ₂ incubator for 6h after mixing. Finally, add 5×passive lysis buffer, 30 μL/well, and mix to lyse the cells. Take 10 μL/well cell sample to detect RLU value. Use GraphPad Prism software to analyze and draw the dose-response histogram, and the ordinate is the RLU value. Induction fold of bioluminescence intensity=RLU value of sample group/RLU value of negative control group.

As a result, as shown in FIG. 4 , the Fd11-IgG4 antibody with reduced Fc function had no ADCC effect.

4.6 ADCP function mediated by CoV2-HB27-Fd11-IgG4 antibody

Using 293FT-SARS-CoV-2-S as target cells, Jurkat cells stably transfected with CD32A, CD32B or CD64 and NFAT-Luc2P (Jurkat-NFAT/Luc2P-CD32A, Jurkat-NFAT/Luc2P-CD32B or Jurkat-NFAT /Luc2P-CD64) as effector cells, and the humanized antibody-mediated ADCP function was detected by reporter gene method.

^{Target cells at a density of 1×10 5} cells/mL and an equal volume of equal density of effector cells were inoculated in 50 μL/well in a 96-well plate. Afterwards, 50 μL of CoV2-HB27 antibody and H7N9-R1 negative control antibody of different Fc functional forms were added. Jurkat-NFAT/Luc2P-CD32A, Jurkat-NFAT/Luc2P-CD32B and Jurkat-NFAT/Luc2P-CD64 were used as effector cells, and antibodies were added at concentrations of 20 μg/mL, 1 μg/mL and 0.05 μg/mL. 37 ℃, 5% CO ₂ incubator for 6h after mixing. Finally, add 5×passive lysis buffer, 30 μL/well, and mix to lyse the cells. Take 10 μL/well cell sample to detect RLU value. Use GraphPad Prism software to analyze and draw the dose-response histogram, and the ordinate is the RLU value. Induction fold of bioluminescence intensity=RLU value of sample group/RLU value of negative control group.

The results are shown in Fig. 5. When Jurkat-NFAT/Luc2P-CD32A, Jurkat-NFAT/Luc2P-CD32B and Jurkat-NFAT/Luc2P-CD64 were used as effector cells (Fig. 5A, 5B and Fig. 5C), IgG1 and Fd11-IgG4 None of the forms of CoV2-HB27 antibodies had ADCP effects.

4.7 CDC function mediated by CoV2-HB27-Fd11-IgG4 antibody

Using 293FT-SARS-CoV-2-S as target cells, the CDC function of humanized antibodies was detected by WST-8 method.

Target cells at a ^{density of 2×10 6} cells/mL were seeded at 50 μL/well in a 96-well plate. Add 50 μL of rabbit complement (source: One lambda) and CoV2-HB27 antibodies with different Fc functional forms and set up detection blank wells (no cells), positive control group (only inoculated with cells) control and H7N9-R1 negative control antibody group, antibody The addition concentrations were 100 μg/mL, 20 μg/mL, 4 μg/mL, 0.8 μg/mL, 0.16 μg/mL, 0.032 μg/mL, 0.0064 μg/mL, and 0.00128 μg/mL. 37 ℃, 5% CO ₂ incubator for 2h after mixing. After the incubation, WST-8 chromogenic solution was added, 10 μL/well. The 96-well plate was _{incubated in a CO 2} incubator, and the absorbance was measured at 450 nm and 630 nm on a microplate reader after the color was stabilized. CDC killing effect in absorbance value (OD ₄₅₀ -OD _630), and blank wells is subtracted to calculate the value read antibody. Killing rate %=(OD value of positive control-OD value of sample)/OD value of positive control×100%.

The results are shown in Figure 6. The CoV2-HB27 antibodies with different Fc functional forms have no CDC effect on the target cells expressing the SARS-CoV-2S protein.

Example 5: Fc engineering reduces the ADE effect of antibodies on CD32A expressing cells

5.1 Fd6 and Fd11 antibody engineering reduces the ADE effect of CoV2-HB27-IgG1 antibody on CHO-K1-CD32A cells

After CHO-K1-CD32A was digested one day in advance, the cell density was adjusted to 3x10 ⁵ /mL with medium, and 100 μL of cell suspension was added to each well of a 96-well cell culture plate, and then placed in a 37°C, 5% CO ₂ incubator for overnight plating. The next day, another 96-well cell culture plate was added with different concentrations (final concentration of 500 μg/mL starting, 4-fold gradient dilution, 9 gradients in total), 50 μL/well. _{Add 500 TCID 50} of SARS-CoV-2 pseudovirus to each well, 50 μL/well. The group with virus and no antibody was used as a positive control, and the group without virus and antibody was used as a negative control. After mixing, it was placed in a 37°C, 5% CO ₂ incubator for 1 h. After the incubation, 100 μL/well was transferred into the plated CHO-K1-CD32A cell plate, and placed in a 37° C., 5% CO ₂ incubator for static culture for 24 h. After the incubation, add passive lysis 5x buffer (source: Promega), 30 μL/well, and mix to lyse the cells. Take 10 μL/well and transfer it into 96-well white bottom plate fluorescence signal value (RLU). The sample RLU/positive control RLU was calculated and plotted using GraphPad. The results are shown in Figure 7. Fd6 modification and Fd11 modification can significantly reduce the ADE effect of CoV2-HB27-IgG1 antibody on CHO-K1-CD32A cells.

Example 6: Fc engineering reduces the ADE effect of antibodies on CD32B expressing cells

6.1 Fd6 and Fd11 antibody engineering reduces the ADE effect of CoV2-HB27-IgG1 antibody on CHO-K1-CD32B cells

After CHO-K1-CD32B was digested one day in advance, the cell density was adjusted to 3x10 ⁵ /mL with medium, 100 μL of cell suspension was added to each well of a 96-well cell culture plate, and then placed in a 37°C, 5% CO ₂ incubator for overnight plating. The next day, another 96-well cell culture plate was added with different concentrations (final concentration of 500 μg/mL starting, 4-fold gradient dilution, 9 gradients in total), 50 μL/well. _{Add 500 TCID 50} of SARS-CoV-2 pseudovirus to each well, 50 μL/well. The group with virus and no antibody was used as a positive control, and the group without virus and antibody was used as a negative control. After mixing, it was placed in a 37°C, 5% CO ₂ incubator for 1 h. After the incubation, 100 μL/well was transferred into the plated CHO-K1-CD32B cell plate, and placed in a 37°C, 5% CO ₂ incubator for static culture for 24 h. After the incubation, add passive lysis 5x buffer, 30 μL/well, and mix to lyse the cells. Take 10 μL/well and transfer it into 96-well white bottom plate fluorescence signal value (RLU). The sample RLU/positive control RLU was calculated and plotted using GraphPad. The results are shown in Figure 8. Fd6 modification and Fd11 modification can significantly reduce the ADE effect of CoV2-HB27-IgG1 antibody on CHO-K1-CD32B cells.

Example 7: Fc engineering reduces the ADE effect of antibodies on CD64 expressing cells

7.1 Fd11 antibody modification reduces the ADE effect of SARS-2-H014-IgG1 antibody on CHO-K1-CD64 cells

After CHO-K1-CD64 was digested one day in advance, the cell density was adjusted to 3x10 ⁵ /mL with medium, and 100 μL of cell suspension was added to each well of a 96-well cell culture plate, and then placed in a 37°C, 5% CO ₂ incubator for overnight plating. The next day, another 96-well cell culture plate was added with antibodies of different concentrations (final concentration 100 μg/mL starting, 5-fold gradient dilution, 9 gradients in total), 50 μL/well. _{Add 500 TCID 50} of SARS-CoV-2 pseudovirus to each well, 50 μL/well. The group with virus and no antibody was used as a positive control, and the group without virus and antibody was used as a negative control. After mixing, it was placed in a 37°C, 5% CO ₂ incubator for 1 h. After the incubation, 100 μL/well was transferred into the plated CHO-K1-CD64 cell plate, and placed in a 37°C, 5% CO ₂ incubator for static culture for 24 h. After the incubation, add passive lysis 5x buffer, 30 μL/well, and mix to lyse the cells. Take 10 μL/well and transfer it into 96-well white bottom plate fluorescence signal value (RLU). The sample RLU/positive control RLU was calculated and plotted using GraphPad. The results are shown in Figure 9. Fd11 modification can significantly reduce the ADE effect of SARS-2-H014-IgG1 antibody on CHO-K1-CD64 cells.

Example 8: Fc engineering reduces the ADE effect of antibodies on cells expressing various FcRs

8.1 Fd6 and Fd11 engineering reduces the ADE effect of CoV2-HB27-IgG1 antibody on Raji cells

Antibodies of different concentrations (final concentration 500 μg/mL starting, 4-fold gradient dilution, 9 gradients in total) were added to the 96-well cell culture plate, 50 μL/well. _{Add 500 TCID 50} of SARS-CoV-2 pseudovirus to each well, 50 μL/well. The group with virus and no antibody was used as a positive control, and the group without virus and antibody was used as a negative control. After mixing, it was placed in a 37°C, 5% CO ₂ incubator for 1 h. After the incubation, 100 μL of Raji cells with a density of 3×10 ⁵ /mL were added to each well, and the cells were placed in a 37° C., 5% CO ₂ incubator for static culture for 24 h. After the incubation, add passive lysis 5x buffer, 30 μL/well, and mix to lyse the cells. Take 10 μL/well and transfer it into 96-well white bottom plate fluorescence signal value (RLU). The sample RLU/positive control RLU was calculated and plotted using GraphPad. The results are shown in Figure 10. Fd6 and Fd11 modification can significantly reduce the ADE effect of CoV2-HB27-IgG1 antibody on Raji cells.

8.2 Fd11 antibody modification reduces the ADE effect of SARS-2-H014-IgG1 antibody on THP-1 cells

THP-1 cells were cultured with 2.5 μg/mL PMA and induced for 3 days to evaluate the ADE effect of antibodies of different subtypes of SARS-2-H014. THP-1 cells were digested one day before induction, and the cell density was adjusted to 3x10 ⁵ /mL with medium. 100 μL of cell suspension was added to each well of a 96-well cell culture plate and then placed in a 37°C, 5% CO ₂ incubator for overnight plating. The next day, another 96-well cell culture plate was added with different concentrations (final concentration of 80 μg/mL starting, 5-fold gradient dilution, 9 gradients in total), 50 μL/well. _{Add 500 TCID 50} of SARS-CoV-2 pseudovirus to each well, 50 μL/well. The group with virus and no antibody was used as a positive control, and the group without virus and antibody was used as a negative control. After mixing, it was placed in a 37°C, 5% CO ₂ incubator for 1 h. After the incubation, 100 μL/well was transferred to the plated THP-1 cell plate, and placed in a 37°C, 5% CO ₂ incubator for static culture for 24 h. After the incubation, add passive lysis 5×buffer, 30 μL/well, and mix to lyse the cells. Take 10 μL/well and transfer it into 96-well white bottom plate fluorescence signal value (RLU). The sample RLU/positive control RLU was calculated and plotted using GraphPad. The results are shown in Figure 11. Fd11 modification can significantly reduce the ADE effect of SARS-2-H014-IgG1 antibody on THP-1 cells.

8.3 Fd11 antibody modification reduces the ADE effect of SARS-2-H014-IgG1 antibody on U937 cells

U937 cells were cultured with 2.5 μg/mL PMA and induced for 3 days to evaluate the ADE effect of antibodies of different subtypes of SARS-2-H014. U937 cells were digested one day in advance after induction, and the cell density was adjusted to 3x10 ⁵ /mL with medium. 100 μL of cell suspension was added to each well of a 96-well cell culture plate and then placed in a 37°C, 5% CO ₂ incubator for overnight plating. The next day, another 96-well cell culture plate was added with different concentrations (final concentration 10 μg/mL starting, 5-fold gradient dilution, 6 gradients in total), 50 μL/well. _{Add 500 TCID 50} of SARS-CoV-2 pseudovirus to each well, 50 μL/well. The group with virus and no antibody was used as a positive control, and the group without virus and antibody was used as a negative control. After mixing, it was placed in a 37°C, 5% CO ₂ incubator for 1 h. After the incubation, 100 μL/well was transferred to the plated U937 cell plate, and placed in a 37°C, 5% CO ₂ incubator for static culture for 24 h. After the incubation, add passive lysis 5×buffer, 30 μL/well, and mix to lyse the cells. Take 10 μL/well and transfer it into 96-well white bottom plate fluorescence signal value (RLU). The sample RLU/positive control RLU was calculated and plotted using GraphPad. The results are shown in Figure 12. Fd11 modification can significantly reduce the ADE effect of SARS-2-H014-IgG1 antibody on U937 cells.

sequence listing

references

1. van Erp, EA; Luytjes, W.; Ferwerda, G.; van Kasteren, PBFc-Mediated Antibody Effector Functions During Respiratory Syncytial Virus Infection and Disease. Frontiers in immunology 2019, 10, 548-548, doi: 10.3389/fimmu. 2019.00548.

2.Halstead, S.B.; Nimmannitya, S.; Yamarat, C.; Russell, P.K.

3. Kuzmina, NA; Younan, P.; Gilchuk, P.; Santos, RI; Flyak, AI; Ilinykh, PA; al.Antibody-Dependent Enhancement of Ebola Virus Infection by Human Antibodies Isolated from Survivors.Cell reports 2018,24,1802-1815.e1805,doi:10.1016/j.celrep.2018.07.035.

4. Li, M.; Zhao, L.; Zhang, C.; Wang, X.; Hong, W.; Sun, J.; Liu, R.; Yu, L.; Wang, J.; Zhang, F ., et al.Dengue immune sera enhance Zika virus infection in human peripheral blood monocytes through Fc gamma receptors.PLOS ONE 2018,13,e0200478,doi:10.1371/journal.pone.0200478.

5. Lum, F.-M.; Couderc, T.; Chia, B.-S.; Ong, R.-Y.; Her, Z.; Chow, A.; Leo, Y.-S.; Kam , Y.-W.; Rénia, L.; Lecuit, M., et al. Antibody-mediated enhancement aggravates chikungunya virus infection and disease severity. Scientific Reports 2018,8,1860,doi:10.1038/s41598-018-20305- 4.

6. Wilder-Smith, A.; Hombach, J.; Ferguson, N.; Selgelid, M.; O'Brien, K.; Vannice, K.; Barrett, A.; Ferdinand, E.; Flasche, S. ; Guzman, M., et al. Deliberations of the Strategic Advisory Group of Experts on Immunization on the use of CYD-TDV dengue vaccine. The Lancet Infectious Diseases 2019, 19, e31-e38, doi: 10.1016/S1473-3099(18 )30494-8.

7. Lee, N.; Chan, PK; Ip, M.; Wong, E.; Ho, J.; Ho, C.; Cockram, CS; Hui, DSAnti-SARS-CoV IgG response in relation to disease severity of severe acute respiratory syndrome. Journal of clinical virology: the official publication of the Pan American Society for Clinical Virology 2006,35,179-184,doi:10.1016/j.jcv.2005.07.005.

8. Zhang, B.; Zhou, X.; Zhu, C.; Feng, F.; Qiu, Y.; Feng, J.; Jia, Q.; Song, Q.; Zhu, B.; Wang, J. .Immune phenotyping based on neutrophil-to-lymphocyte ratio and IgG predicts disease severity and outcome for patients with COVID-19.medRxiv 2020,10.1101 / 2020.03.12.20035048,2020.2003.2012.20035048, doi: 10.1101 / 2020.03.12.20035048.

9. Zhao, J.; Yuan, Q.; Wang, H.; Liu, W.; Liao, X.; Su, Y.; Wang, X.; Yuan, J.; Li, T.; Li, J. ., et al. Antibody responses to SARS-CoV-2 in patients of novel coronavirus disease 2019. Clinical Infectious Diseases 2020, 10.1093/cid/ciaa344, doi: 10.1093/cid/ciaa344.

10. Tan, W.; Lu, Y.; Zhang, J.; Wang, J.; Dan, Y.; Tan, Z.; He, X.; Qian, C.; Sun, Q.; Hu, Q .,et al.Viral Kinetics and Antibody Responses in Patients with COVID-19.medRxiv 2020,10.1101/2020.03.24.20042382,2020.2003.2024.20042382,doi:10.1101/2020.03.24.200423

11. Wang, SF; Tseng, SP; Yen, CH; Yang, JY; Tsao, CH; Shen, CW; Chen, KH; Liu, FT; Liu, WT; Chen, YM, et al. Antibody-dependent SARS coronavirus infection is mediated by antibodies again spike proteins. Biochem Biophys Res Commun 2014, 451, 208-214, doi:10.1016/j.bbrc.2014.07.090.

12. Taylor, A.; Foo, SS; Bruzzone, R.; Dinh, LV; King, NJ; /imr.12367.

13. Moi, ML; Lim, CK; Kotaki, A.; Takasaki, T.; Kurane, I. Development of an antibody-dependent enhancement assay for dengue virus using stable BHK-21 cell lines expressing Fc gammaRIIA. J Virol Methods 2010 , 163, 205-209, doi:10.1016/j.jviromet.2009.09.018.

14. Wan, Y.; Shang, J.; Sun, S.; Tai, W.; Chen, J.; Geng, Q.; He, L.; Chen, Y.; Wu, J.; Shi, Z ., et al.Molecular Mechanism for Antibody-Dependent Enhancement of Coronavirus Entry.Journal of virology 2020,94,doi:10.1128/JVI.02015-19.

15. Liu, L.; Wei, Q.; Lin, Q.; Fang, J.; Wang, H.; Kwok, H.; Tang, H.; Nishiura, K.; Peng, J.; Tan, Z. ., et al. Anti-spike IgG causes severe acute lung injury by skewing macrophage responses during acute SARS-CoV infection. JCI Insight 2019, 4, doi:10.1172/jci.insight.123158.

16. Kam, YW; Kien, F.; Roberts, A.; Cheung, YC; Lamirande, EW; Vogel, L.; Chu, SL; Tse, J.; Guarner, J.; Zaki, SR, et al. Antibodies against trimeric S glycoprotein protect hamsters against SARS-CoV challenge despite their capacity to mediate FcgammaRII-dependent entry into B cells in vitro.Vaccine 2007,25,729-740,doi:10.1016/j.vaccine.2006.08.011.

17. Upasani, V.; Vo, HTM; Ung, S.; Heng, S.; Laurent, D.; Choeung, R.; Duong, V.; Sorn, S.; Ly, S.; Rodenhuis-Zybert, IA, et al.Impaired Antibody-Independent Immune Response of B Cells in Patients With Acute Dengue Infection.Frontiers in Immunology 2019,10,doi:10.3389/fimmu.2019.02500.

18. Ye Xin; Sun Le; Xu Shaoyu; Hu Qiyue; Tao Weikang; Zhang Lianshan.Cd47 antibody,antigen-binding fragment and medical use thereof.Google Patents:2018.

Claims (32)

1. A method of reducing the effects of viral ADE, the method comprising administering to a subject infected, or at risk of being infected with a virus, the following molecule:

   The molecule contains

   a) Fc fragments with reduced Fc receptor binding/complement binding; and preferably

   b) An antigen-binding fragment that recognizes and binds to the viral coat protein or extramembrane domain.
2. The method of claim 1, wherein the pathogen is selected from the group consisting of:

   Coronavirus, influenza virus, cold virus, parainfluenza virus, upper respiratory syncytial virus, dengue virus, West Nile virus, Marburg virus, Lassa hemorrhagic fever virus, HIV virus, Ebola virus, herpes zoster virus, CMV virus, hepatitis virus, human herpes simplex virus, cytomegalovirus, rotavirus, Epstein-Barr virus, measles virus, mumps virus, human papilloma virus, flavivirus or influenza virus; preferably SARS-CoV-2, SARS -CoV, MERS-CoV; Influenza A virus (including H10N8, H7N9, H1N1, H5N1, etc.), Influenza B virus; Ebola virus; and Hepatitis A, B, C, E viruses.
3. The method of any one of claims 1-2, wherein the Fc fragment is derived from a heavy chain constant region of a human antibody, murine antibody, rabbit antibody, or other mammalian antibody.
4. The method of claim 3, wherein the Fc fragment is derived from an antibody of the IgG, IgM or IgA subtype of a human antibody, preferably from an antibody of the IgGl, IgG2, IgG3 or IgG4 subtype.
5. The method of any one of claims 1-4, wherein the Fc fragment has the following properties:

   Reduced binding to one or more antibody Fc receptors; and/or

   Does not bind or has insignificant binding capacity to one or more complements;

   Preferably, the Fc receptors are CD16a, CD16b, CD32a, CD32b, CD64, CD89, FcRn.
6. The method of claim 5, wherein the Fc fragment comprises the sequence of SEQ ID NO:26.
7. The method of claim 6, wherein the molecule is an IgG antibody comprising

   the heavy chain sequence of SEQ ID NO: 27; and

   Light chain sequence of SEQ ID NO:21.
8. The method of claim 5, wherein the Fc fragment comprises the sequence of SEQ ID NO:29.
9. The method of claim 8, wherein the molecule is an IgG antibody comprising

   (a) the heavy chain sequence of SEQ ID NO: 28; and

   The light chain sequence of SEQ ID NO:21 or

   (b) the heavy chain sequence of SEQ ID NO: 34; and

   Light chain sequence of SEQ ID NO:31.
10. The method of any one of claims 1-9, wherein the molecule contains

    one or more a) antigen-binding fragments that recognize and bind to the viral coat protein or extramembrane domain; and

    One or more b) Fc mutant fragments with reduced Fc receptor binding/complement binding.
11. The method of any one of claims 1-10, wherein the molecule is preferably conjugated to other macromolecules via a linker,

    Preferably, the other macromolecules are polysaccharides, peptides/proteins or PEG;

    Preferably, the peptide/protein is a modified or mutagenized albumin (HSA).
12. A molecule that reduces the effect of viral ADE, the molecule contains

    a) Fc fragments with reduced Fc receptor binding/complement binding; and preferably

    b) An antigen-binding fragment that recognizes and binds to the viral coat protein or extramembrane domain.
13. The molecule of claim 12, wherein the pathogen is selected from the group consisting of:

    Coronavirus, influenza virus, cold virus, parainfluenza virus, upper respiratory syncytial virus, dengue virus, West Nile virus, Marburg virus, Lassa hemorrhagic fever virus, HIV virus, Ebola virus, herpes zoster virus, CMV virus, hepatitis virus, human herpes simplex virus, cytomegalovirus, rotavirus, Epstein-Barr virus, measles virus, mumps virus, human papilloma virus, flavivirus or influenza virus; preferably SARS-CoV-2, SARS -CoV, MERS-CoV; Influenza A virus (including H10N8, H7N9, H1N1, H5N1, etc.), Influenza B virus; Ebola virus; and Hepatitis A, B, C, E viruses.
14. The molecule of any one of claims 12-13, wherein the Fc fragment is derived from the heavy chain constant region of a human, murine, rabbit or other mammalian antibody.
15. The molecule of claim 14, wherein the Fc fragment is derived from an antibody of the IgG, IgM or IgA subtype of a human antibody, preferably from an antibody of the IgGl, IgG2, IgG3 or IgG4 subtype.
16. The molecule of claim 15, wherein the Fc fragment

    Significantly reduced binding to one or more antibody Fc receptors; and/or

    Does not bind or has insignificant binding capacity to one or more complements;

    Preferably, the Fc receptors are CD16a, CD16b, CD32a, CD32b, CD64, CD89, FcRn.
17. The molecule of claim 16, wherein the molecule comprises the sequence of SEQ ID NO:26.
18. The molecule of claim 16, wherein the molecule is an IgG antibody comprising

    the heavy chain sequence of SEQ ID NO: 27; and

    Light chain sequence of SEQ ID NO:21.
19. The molecule of claim 15, wherein the molecule comprises the sequence of SEQ ID NO:29.
20. The molecule of claim 16, wherein the molecule is an IgG antibody comprising

    (a) the heavy chain sequence of SEQ ID NO: 28; and

    the light chain sequence of SEQ ID NO: 21, or

    (b) the heavy chain sequence of SEQ ID NO: 34; and

    Light chain sequence of SEQ ID NO:31.
21. The molecule of any one of claims 12-20, wherein the molecule contains

    one or more a) Fc fragments with reduced Fc receptor binding/complement binding; and preferably

    One or more of b) antigen-binding fragments that recognize and bind to the viral coat protein or extramembrane domain.
22. A conjugate of the molecule of any one of claims 12-21 with other macromolecules,

    Other macromolecules are polysaccharides, peptides/proteins or PEG;

    Preferably, the peptide/protein is a modified or mutagenized albumin (HSA);

    Preferably, the aforementioned molecules are conjugated to other macromolecules via linkers.
23. A nucleic acid encoding the molecule of any one of claims 12-21, which is mRNA and/or DNA.
24. An expression vector comprising the nucleic acid of claim 23.
25. A host cell comprising the nucleic acid of claim 23 or the expression vector of claim 24.
26. A method for producing the molecule of any one of claims 12-21, comprising culturing the host cell of claim 25 under conditions suitable for expression of the aforementioned protein molecule, and recovering the expressed product.
27. A pharmaceutical composition comprising

    a) the molecule of any one of claims 12-21, the conjugate of claim 22, the nucleic acid of claim 23, or the expression vector of claim 24; and/or

    c) A pharmaceutically acceptable carrier, excipient or stabilizer, preferably a pharmaceutically acceptable carrier, excipient or stabilizer in the form of a lyophilized formulation or an aqueous solution.
28. The molecule of any one of claims 12-21, the conjugate of claim 22, the nucleic acid of claim 23 or the expression vector of claim 24, or the pharmaceutical composition of claim 27 , its use for the prevention or treatment of diseases caused by viruses, preferably coronaviruses, more preferably SARS-CoV-2.
29. The molecule of any one of claims 12-21, the conjugate of claim 22, the nucleic acid of claim 23 or the expression vector of claim 24, or the pharmaceutical composition of claim 27 , which is used in the preparation of medicines for preventing diseases caused by viruses, preferably coronaviruses, more preferably SARS-CoV-2.
30. A drug combination comprising

    The molecule of any one of claims 12-21, the conjugate of claim 22, the nucleic acid of claim 23 or the expression vector of claim 24, or the pharmaceutical composition of claim 27 ;as well as

    one or more additional therapeutic agents.
31. A kind of test kit, it comprises

    The molecule of any one of claims 12-21, the conjugate of claim 22, the nucleic acid of claim 23 or the expression vector of claim 24, or the pharmaceutical composition of claim 27 ;

    Preferably,

    Also further included is a device for administering the drug.
32. A method of treating a disease caused by a virus, preferably a coronavirus, more preferably SARS-CoV-2, comprising administering to a subject a molecule according to any one of claims 12-21, a conjugate according to claim 22 , the nucleic acid of claim 23 or the expression vector of claim 24 , or the pharmaceutical composition of claim 27 , the pharmaceutical combination of claim 30 or the kit of claim 31 .

Images