CN111394360B - Migratory locust cap and migratory locust C-type isomer gene dsRNA and application thereof - Google Patents

Abstract

The invention provides a migratory locust cap, C-type isomer gene dsRNA and application thereof. In particular to a locusta migratoria cap and C-shaped isomer gene, the nucleotide sequence of the gene is SEQ ID NO: 1, based on SEQ ID NO: 1, designing and synthesizing a gene fragment SEQ ID NO: 7 and corresponding dsRNA, wherein the synthetic dsRNA is designed and injected into a migratory locust body, the expression level of a migratory locust cap and a C-shaped isomer gene is reduced, the lethality of deltamethrin to a migratory locust of 3 years is improved to 3.8 times, and the lethality of imidacloprid to the migratory locust of 3 years is improved to 2.8 times.

Description

Migratory locust cap and migratory locust C-type isomer gene dsRNA and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to dsRNA (double-stranded ribonucleic acid) synthesized based on a migratory locust cap and a C-type isomer gene fragment and application thereof in improving the prevention and treatment effects of deltamethrin and imidacloprid on migratory locust.

Background

Deltamethrin is a broad-spectrum insecticide with contact poisoning and stomach poisoning in pyrethroid insecticides, and has quick contact poisoning effect and strong knock-down force. Imidacloprid is a nicotine ultra-high-efficiency pesticide, has the characteristics of broad spectrum, high efficiency, low toxicity and low residue, and has multiple effects of contact poisoning, stomach toxicity, systemic absorption and the like. For a long time, in the emergency prevention and treatment work of migratory locusts, a large amount of pyrethrins insecticides represented by deltamethrin and nicotine insecticides represented by imidacloprid are used, so that the migratory locusts have obvious resistance to insecticides such as pyrethrins and nicotinoids, the application amount of the insecticides is increased, the prevention and treatment cost of locusts is increased, and the excessive use of deltamethrin and imidacloprid can cause great threat to public health and ecological balance. Although the traditional pesticide mixing and alternate use can reduce the pesticide resistance of locusta migratoria to a certain extent. However, the problem of the drug resistance of locusta migratoria to insecticides such as pyrethrins and nicotinoids is still very serious. Therefore, a novel method for simultaneously enhancing the control effect of deltamethrin and imidacloprid on migratory locust is urgently needed to be developed.

RNA silencing refers to the phenomenon of highly specific degradation of homologous mRNA induced by endogenous or exogenous double-stranded RNA (dsrna). RNA silencing technology has the obvious advantages of high efficiency and specificity, high safety to environment and non-target organisms and the like, and is widely used for pest drug resistance control.

Through search, the currently available locust-resistant dsRNA related patent applications are as follows: patent application No. 201610316474.6 entitled "application of locusta migratoria intestinal nucleic acid hydrolase gene in pest control"; patent application No. 201610186141.6, entitled "migratory locust wing epidermal protein gene and its application in pest control"; patent application No. 201610186149.2, entitled "migratory locust wing specific epidermal protein gene and application of dsRNA thereof"; patent application No. 201510160191.2 entitled "application of Knickkopf gene dsRNA in pest control"; patent application No. 201510160194.6 entitled "Retroactive gene and its dsRNA for pest control; patent application No. 201510118799.9 entitled "an insect cytochrome P450 gene and uses thereof"; patent application No. 201510080636.6 entitled "insect chitin deacetylase gene 1 and its use in pest control"; the patent application No. 201410647729.8, the name is 'the application of ATP synthase beta subunit gene of migratory locust in east Asia and dsRNA thereof in pest control'; the patent application No. 201410665503.0, the name is 'the application of ATP synthase alpha subunit gene of migratory locust in east Asia and dsRNA thereof in pest control'; patent application No. 201410292658.4 entitled "use of insect type ii chitinase gene specific dsRNA"; the application is a patent application No. 201410069843.7, which is named as the sequence of locust I-type chitinase gene and the application of dsRNA thereof, and the application is a patent application No. 201310023385.9, which is named as the application of insect UDP-N-acetylglucosamine pyrophosphorylase gene and dsRNA thereof; patent application No. 201210356675.0 entitled "insect beta-N-acetylglucosaminidase gene and uses thereof"; patent application No. 201010163625.1 entitled "an insect chitin synthase 1 gene fragment and dsRNA and application thereof"; patent application No. 201010163645.9, entitled "an insect chitin synthase 1A gene fragment and dsRNA and application thereof"; patent application No. 201010163618.1 entitled "an insect chitin synthase 2 gene and uses"; the name of patent application No. 201010163634.0 is 'insect chitin synthetase 1B gene fragment and dsRNA and application thereof', and the name of patent application No. 201010136330.5 is 'insect chitinase gene and application of dsRNA'. The patent application No. 201710115802, entitled "cytochrome P450 reductase gene dsRNA of migratory locust" and its application ".

The core content of the locust-related dsRNA patent mainly relates to introducing dsRNA into a locust-like fly, silencing a certain key gene/lethal gene of the locust-like fly to cause disorder of an important metabolic pathway in a body, and further triggering a locust-like fly lethal effect. However, the lethal effect caused by the key gene/lethal gene of the locusta migratoria is slow to take effect, most locusta migratoria can still continue to develop for several days and even molt to the next age, which is not favorable for the emergency control of locusta and the loss reduction of locusta. More importantly, locusta migratoria is not only an important agricultural pest but also an important link of the food chain of the farmland. In the production process of important key genes/lethal genes dsRNA of migratory locust, the key genes/lethal gene sequences of migratory locust are inevitably required to be artificially amplified or introduced into crop genomes through a plant transgenic technology, so that the potential risks of leakage and transfer of the key genes/lethal genes of migratory locust exist, the excessive reduction of the number of migratory locust and even population extinction are further caused, natural enemy organisms of farmlands are reduced, the ecological balance of the farmlands is threatened, and secondary insect disasters of the farmlands are induced.

The cap and collar C-type isomer is an important signal molecule for insects to adapt to external environmental stress. Under the induction of exogenous chemical substances such as pesticide, Kelch-like epichlorohydrin related protein-1 blocks the modification of Cul 3-E3-ubiquitin ligase on cap and collar C-type isomers, and the content of the cap and collar C-type isomers in cytoplasm is increased and the cap and collar C-type isomers are aggregated in cell nucleus. In the nucleus, cap and collar type C isoforms bind to the sarcomerposis minor tendinosus oncogene homolog (sMaf) and, after binding, to the Antioxidant Response Element (ARE)/sarcomerposis minor tendinosus oncogene homolog recognition element (MARE), activate transcription of a series of metabolic detoxification genes. Therefore, silencing the cap and collar C-type isomer genes of the pests can possibly reduce the response of the metabolic detoxification system of the insects to the pesticides, further reduce the metabolic detoxification capability of the insects to the pesticides, and further improve the control effect of the pesticides to the pests. The migratory locust only contains a cap and collar C-type isomer gene, and the silencing of the cap and collar C-type isomer gene can not cause the migratory locust to die directly. The method greatly facilitates researchers to regulate a plurality of genes related to metabolism detoxification by interfering with the migratory locust cap and C-shaped isomer genes, thereby improving the sensitivity of migratory locust to pesticides.

Disclosure of Invention

The invention provides a migratory locust cap, C-type isomer gene dsRNA and application thereof aiming at the problems.

In order to achieve the purpose, the invention adopts the following technical scheme:

the nucleotide sequence of the migratory locust cap and C-shaped isomer gene provided by the invention is SEQ ID NO: 1; the nucleotide sequence of the gene is obtained by a bioinformatics analysis method, and comprises the steps of firstly comparing and annotating a migratory locust transcriptome database by blastx software, then obtaining undetermined nucleotide sequences of migratory locust cap and C-type isomer genes by searching the transcriptome annotation database, and designing a full-length upstream primer SEQ ID NO:3 and full-length downstream primer SEQ ID NO: 4; using total cDNA of migratory locust as a template, and obtaining a DNA fragment with the size of a target fragment by reverse transcription PCR amplification; separating a PCR product by agarose gel electrophoresis, cutting and recovering a target fragment, purifying a gel recovery kit, inserting the purified DNA fragment into a pGEM-T easy vector, transferring escherichia coli DH5 alpha competent cells by a heat shock method, selecting independent and full white colonies on a screening plate of X-gal, IPTG and ampicillin, inoculating the white colonies into an LB liquid culture medium containing ampicillin, carrying out overnight oscillation amplification culture, extracting plasmids by a plasmid miniprep kit, and carrying out DNA sequencing by a biological engineering (Shanghai) member company; the sequencing result is completely consistent with the sequence to be determined of the migratory locust cap and the C-shaped isomer gene, and the result proves that the total length of the migratory locust cap and the C-shaped isomer gene is 2970bp, and the nucleotide sequence of the migratory locust cap and the C-shaped isomer gene is SEQ ID NO: 1 is shown.

The invention provides an amino acid sequence coded by a migratory locust cap and C-type isomer gene, which is characterized in that the amino acid sequence is SEQ ID NO: 2; the amino acid sequence was obtained by converting SEQ ID NO: 1, translating into corresponding amino acid by using Translate tool software, predicting the relative molecular weight and isoelectric point by using ProtParam software, wherein the prediction result shows that the migratory locust cap and C-type isomer gene codes 989 amino acids, the protein prediction relative molecular weight is 106.8KD, and the theoretical isoelectric point is 4.95.

The invention provides a migratory locust cap with T7 promoter sequences fused at two ends and a C-type isomer gene fragment, as well as application of dsRNA synthesized based on the fragment and the dsRNA synthesized based on the fragment in improving the migratory locust control effect of deltamethrin and imidacloprid; based on the locust-migratory cap and C-type isomer gene sequence, an upstream primer SEQ ID NO:5 and 5' end containing downstream primer SEQ ID NO:6, using locusta migratoria cap and C-type isomer gene DNA as templates, and obtaining a target fragment SEQ ID NO: 7; separating the target fragment by agarose gel electrophoresis, cutting and recovering the target fragment, purifying the target fragment by a gel recovery kit, and synthesizing dsRNA by using a T7 RNA polymerase in vitro transcription kit; and then injecting the dsRNA into the second abdominal segment of the locusta migratoria by using a micro-injector, and detecting the reduction degree of the mRNA expression level of the cap and C-type isomer genes of the locusta migratoria and the capability of the dsRNA for improving the control effect of deltamethrin and imidacloprid on the locusta migratoria.

The invention has the beneficial effects that: the dsRNA synthesized based on the migratory locust cap and the C-shaped isomer gene fragment is injected into the second abdominal segment of the migratory locust by a micro-injector, so that the mRNA expression level of the migratory locust cap and the C-shaped isomer gene is reduced by 65.7-76.5 percent, the lethality of deltamethrin to 3-year migratory locust is improved to 3.8 times, and the lethality of imidacloprid to 3-year migratory locust is improved to 2.8 times.

Drawings

FIG. 1: the effect of injection of dsRNA on the gene expression of locusta migratoria cap and C-type isomer. (dsGFP is the control group injected with dsGFP, dsCncC is the treatment group injected with migratory locust cap and C-type isoform gene dsRNA), beta-actin is the reference gene, wherein P < 0.05.

FIG. 2: effect of injection of dsRNA on deltamethrin and imidacloprid lethality to migratory locusts. (dsGFP is a control group injected with dsGFP, dsCncC is a treatment group injected with migratory locust cap and C-type isoform gene dsRNA), wherein P < 0.05.

Detailed Description

In order to further illustrate the technical solution of the present invention, the present invention is further illustrated by the following examples.

Example 1: and (3) obtaining full-length cDNA of locusta migratoria cap and C-type isomer genes and predicting amino acid sequences.

1. And (3) bioinformatics search of locusta migratoria cap and C-type isomer genes.

Firstly, the Unigene sequence database sequence in the migratory locust transcriptome database is compared with the sequence in the non-redundant protein database pairwise by utilizing Blastx software, and the annotation result is searched by taking "cap 'n' coller isoform C" as a keyword to obtain 1 undetermined sequence of the migratory locust cap and the C-type isoform gene.

2. And obtaining the full-length cDNA of the locusta migratoria cap and the C-type isomer gene.

2.1) designing full-length primers required by PCR full-length amplification:

respectively designing a full-length upstream primer ATGGTTTGCC TGAAGAAATC AAAGTGT (SEQ ID NO:3) and a full-length downstream primer TCACTCCTTT TCTTCTTCAC GCTTTCT (SEQ ID NO:4) by using Oligo software; the designed full-length primer is synthesized by the generation of biological engineering (Shanghai) GmbH.

2.2) preparing a template required by PCR amplification:

selecting 3-year nymphs of migratory locusts with good development condition and normal activity, grinding the nymphs in liquid nitrogen, and extracting RNA of the total migratory locusts by referring to a TRIzol-chloroform method; extracting Kit and RevertAId by adopting Oligotex mRNA Mini Kit^TMH Minus Reverse Transcriptase prepares migratory locust total cDNA, thereby obtaining the template required by PCR amplification reaction.

2.3) PCR amplification reaction:

using full-length primer, using migratory locust total cDNA as template, PCR amplifying to obtain migratory locust cap and C-type isomer gene sequence, separating and detecting by agarose gel electrophoresis (figure 1); cutting and recovering the target band, purifying the DNA agarose gel recovery kit, inserting the purified DNA agarose gel recovery kit into a pGEM-T easy Vector, transferring escherichia coli DH5 alpha competent cells by a heat shock method, culturing and picking full white colonies on agar plates of X-gal, IPTG and ampicillin, inoculating the colonies into an LB liquid culture medium containing the ampicillin for amplification culture, extracting plasmids by adopting a small plasmid extraction kit, and sequencing the plasmids by a company Limited in engineering (Shanghai); the sequencing result shows that the length of the DNA sequence of the insert is 2970bp, and the nucleotide sequence is SEQ ID NO: 1, or a fragment thereof.

3. And predicting the amino acid sequences of the migratory locust cap and C-type isomer genes.

Translating and predicting the amino acids coded by the migratory locust cap and the C-shaped isomer gene by using a Translate tool, wherein the result shows that the migratory locust cap and the C-shaped isomer gene code 898 amino acids, and the amino acid sequences of the migratory locust cap and the C-shaped isomer gene are SEQ ID NO: 2, the relative molecular weight of the migratory locust cap and the C-type isomer protein is predicted to be 106.8KD by adopting ProtParam software, and the theoretical isoelectric point is 4.95. The functional domain of the migratory locust cap and the C-type isomer gene is predicted by SMART software, and the result shows that the migratory locust cap and the C-type isomer gene contain seven Neh homologous structural domains (Nrf2-ECH homology domains).

Example 2: and (3) synthesizing dsRNA of locusta migratoria cap and C-type isomer genes.

1. Preparing a template required by synthesizing locusta migratoria cytochrome gene dsRNA.

Nucleotide sequence SEQ ID NO: 1, designing a pair of primers required for synthesizing dsRNA; sequence shown as taatacgact cactataggg AAACCCCGCT CTAAGAAGGA (SEQ ID NO:5) andtaatacgactcactatagggGACACTAGCT GTGCGAACCA (SEQ ID NO:6) are upstream and downstream primers required for dsRNA synthesis (the underlined part is the T7 promoter sequence); the designed dsRNA primer is synthesized by the generation of biological engineering (Shanghai) GmbH。

Carrying out PCR amplification on the primers (the 5' tail ends of which contain a T7 promoter sequence) for synthesizing the dsRNA to obtain a segment, wherein both ends of the segment are provided with T7 promoters, and the total length of the segment is 535 bp; the DNA sequence is SEQ ID NO: 7; after agarose gel electrophoresis separation, cutting of a target band and purification of a DNA agarose gel recovery kit, a NanoDrop2000 micro-spectrophotometer is used for quantification and detection, and the obtained product is used as a template for synthesizing dsRNA.

2. And (3) synthesizing dsRNA of locusta migratoria cap and C-type isomer genes.

Based on the template for synthesizing dsRNA of the above steps, dsRNA was synthesized by in vitro Transcription with T7 RNA polymerase using HiScribe RNAi Transcription Kit (NEB). The purified dsRNA was quantified by a NanoDrop2000 microspectrophotometer to a final concentration of 1.5. mu.g/. mu.L and stored in a freezer at-20 ℃ for future use.

Example 3: silencing of locusta migratoria cap and C-type isomer genes.

1. And (3) injection of the C-type isomer gene dsRNA.

And selecting the nymphs of 120 migratory locusts at 3 rd day 2-3, and using the nymphs for dsRNA injection experiment. Mu.g of dsRNA fragments were injected into the second abdominal segment of locusta migratoria using a microinjection needle. Migratory locusts injected with GFP gene dsRNA are used as a control group, and migratory locusts injected with cap and C-type isomer gene dsRNA are used as a treatment group. After the injection is finished, the locusts of the control group and the locusts of the treatment group are placed in an artificial climate box for raising. The breeding conditions are as follows: the lighting period is 14 hours and the darkness is 10 hours, the temperature is 28-32 ℃, the relative humidity is 30-60 percent, and enough fresh wheat seedlings are fed.

2. And detecting the expression level of mRNA of the migratory locust cap and C-type isomer genes.

Continuously feeding a control group migratory locust injected with dsGFP gene dsRNA, an injection cap and a treatment group migratory locust injected with C-type isomer gene dsRNA for 24 hours and 48 hours respectively in an artificial climate box, and reserving samples in a liquid nitrogen tank for storage; crushing a migratory locust sample by using a tissue grinder in a liquid nitrogen environment, extracting total RNA of the migratory locust by using a TRIzol reagent, and performing reverse transcription by using a RevertAID First Strand cDNA Synthesis Kit (ThermoFisher) to synthesize cDNA; detecting the relative mRNA expression levels of the cap and collar C-type isomer genes and the beta-actin gene by a real-time quantitative PCR technology, thereby determining the silencing efficiency of the migratory locust cap and collar C-type isomer genes; the results are shown in FIG. 1: compared with a control group migratory locust, the mRNA level of the cap and collar C-type isomer genes of the migratory locust of an experimental group is remarkably reduced by 65.7-76.5%.

3. Screening of migratory locust differential expression gene after silencing of migratory locust cap and C-type isomer gene

Total RNA of a control group migratory locust and a treatment group migratory locust is extracted, migratory locust mRNA is purified by a poly-T magnetic bead method, then a reverse transcription kit is used for synthesizing first strand cDNA, and DNA polymerase is used for synthesizing second strand cDNA. After the cDNA tail sequence was completed with DNA polymerase, adenine nucleotides were added to the 3' -end of the cDNA tail, and adapter sequences were added to both ends of the cDNA sequence. The size of the cDNA sequence fragment is interrupted to 150-200bp by a User enzyme method, and then high-fidelity DNA polymerase is used for amplification to obtain an RNA-seq library. And (3) performing machine sequencing on the RNA-seq library, removing low-quality sequences and error sequences, and performing redundancy removal and splicing by a Trinity program to obtain a transcriptome database. Screening of the differential expression genes of the control group and the treatment group is completed by a DESeq program package, the screening threshold value is that P is less than or equal to 0.05, and the difference multiple is more than or equal to 2 times. The results show that: compared with a control group migratory locust, 16732 locusts in the treatment group have no significant difference in expression level, and 35 genes are significantly up-regulated and 73 genes are significantly down-regulated.

Example 4: the migratory locust cap and C-type isomer gene dsRNA promotes the death rate of deltamethrin and imidacloprid to migratory locust.

A control group migratory locust injected with dsGFP gene dsRNA, an injection cap and a treatment group migratory locust injected with C-type isomer gene dsRNA are raised in an artificial climate box for 24 hours, and 3 microliters of aqueous solution containing 2 micrograms/milliliter deltamethrin or 3 microliters of aqueous solution containing 10 micrograms/milliliter imidacloprid are dripped into the abdomen of the migratory locust. After continuously raising the migratory locust in the artificial climate box for 24 hours, counting the lethality of deltamethrin and imidacloprid to the migratory locust; the results are shown in FIG. 2: after the dsRNA of the cap and the C-type isomer gene is injected, the lethality of the migratory locust to the deltamethrin can be improved to 3.8 times, and the lethality of imidacloprid to the migratory locust of 3 years can be improved to 2.8 times.

While there have been shown and described what are at present considered to be the essential features and advantages of the invention, it will be apparent to those skilled in the art that the invention is not limited to the details of the foregoing exemplary embodiments, but is capable of other specific forms without departing from the spirit or essential characteristics thereof. The present embodiments are therefore to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein.

Furthermore, it should be understood that although the present description refers to embodiments, not every embodiment may contain only a single embodiment, and such description is for clarity only, and those skilled in the art should integrate the description, and the embodiments may be combined as appropriate to form other embodiments understood by those skilled in the art.

Sequence listing

SEQ ID NO：1

atggtttgcctgaagaaatcaaagtgtgacgagttgttgcagctggcactgctactcagcttgttgcgagcagatccagacacttacctgcggcgggaagctccagaaatcgtgggcgtccgcgtggagacaggtcaggcgtgggccctcgccggtcctcggggtcctaacttcgataaccgcaggccctatatccaccctaaaagcctcgactctgaactcataaattacgagcgagaagtcttcgaggagctcaacgcccttgggcgctacaacaggataactacgggaatatataatgttactgcgtatcttctcaatgtggatggaaacagtccggatgatgatttcggagcggacaatgcatcgagctctgggttgcttgtggacaacgacagaccatcagtgtctgcaaccgaggattacgcggagccatcatcttctggactatcgggatttcctttcctgttcgatgacgacgagagcgaccccagcttggcggatacggcagacctgactcaggaggacatggacctgatcgaggtgctttggaagcaggacgtggacctggggttctccctggaggagctgcagcccgccgacaagcccggcaagagccctgcggacgacgacgtcgccaccctaaaggccatcgccgccagcgaccccaaaccccgctctaagaaggacgacgacagtgaggacgaaaggacttccaaccctgacgacccatgggctggcctgtcatacactattgatttggagacaggagagtatgtgctcaaggatagcctgtgtgaagaactgagcaacacacctgcaaccatcttagttgatgaagcaccatcttcattgcttgatcttcaggaattctcacttgaggaggcattacagcttgtgggactgaatgaaagctctactgaggcctcaaaggaagaaagtccactctcagagccagcaatatcagcgccacctcaaaagagtggcactgatggagatgtgaagaaggacgctgctgagaaagacccattggaaacagcctcaacaccctcaacaacagacgaggagttgggcgatatgatacaaacagcacagttccaccacccacacccccatccacgctctttccagggtcgtgtgccggtggttcgcacagctagtgtcgaacagcgctggcaagacttggcaaacctgctgagcctacctggggaaggtgttcctggccacacgagctaccctcatcaccatcatcctcatcacccacacgcacaccatccacatattggatatggcggcagtgcagctggaggtgctgttggcggttatggagatgcagcaaggggggtcttgctgcacaatgccacgcttgctcctcccgttggggacatgaatgcttccagtccatatcatggacattctgttggaagcaattcaaaccttggaactgccgtggctgcttcaatgaacctgacaaacagcagtgaaccaatgggagatgcaggctctactgcatcatacaaaatggaatcatcgcatgacatgatgtactatcagaattccaccaccgaaataagtcagacaacagagggatttttgtcatccatactaaatgatgaggatttgcagctgatggatatggcaatgaatgacagtatgtacacgatgcgcatgctggacgcgacgggcaacccgacttctgcgtctagcggcgggcacgcgggggcggcggccggcggcgcttcggcggtggcggcttctggtccgggagcggctggggcgacgtcagccgctgcggcggcggcggctgctgcggcggcggcggcggctgcggccgcggcggccgaggagcgcatggacgcgtccagcgacagcgccgtcagctccatgggctccgagcgcgtgccctcgctgtccgacggcgagtggatggagaccggctccgactccggacacacgcccggcgaccactacggcgccgccgactaccacgccagcaagtacaggccatacgactacagctactctggacgccagcactccagttctgttagcactgctgagacgcagcaccgtgtcccgcccatggctcaaaagaaacatcagatgtttggaaagcgatgcttccaggagcaaactgcaggagcagcttcttcgttgggtagccacggtacgacacctagtctgccaccagcgcctgtaaagtacgagttcagtgaggcggtgcctgctggtggaaatgcatttggcagcccgctggaggctggagttgctgctgcaaaggcacctgagatgaaatatagttgcagcgttgaatttgcaaggcaccatccagaagtaagaccatctattgaccacatacagcacaatcattcataccaccttcctgcggaaagtacaggtgccttacaaagacctgtctcgagagacaagcaaaaaggtcgtaaatctgatgaggaacatctgaacagagatgaaaaacgggcacgtgcaatgaacatcccattgcctgtgaatgacattatcaatttgccaatggatgaatttaatgagcgactgtcaaaatatgatcttagtgaggcacagttatcacttattagggacatcaggaggagaggaaagaataaggttgcagcacagaactgtcgcaaaaggaaactagatcagattctcagtcttgcagatgaggttaaagaaatgcgtgatcggaagagccgtctgatgcaggagagggattacatgctggctgaacgtcagcgtgtgaaagagaagtttagccagctttacaggcacatctttcagcaactgcgggatcctgacggcaaccaatattcaatgtgtgaatatagccttcaacaatctgcagatggcacagtgctgctagtgcctcgagcaaatgcaactgcttttctggatcccgaagccaccactgctgctgcttcatgcagaaagcgtgaagaagaaaaggagtga

SEQ ID NO：2

met val cys leu lys lys ser lys cys asp glu leu leu gln leu ala leu leu leu ser leu leu arg ala asp pro asp thr tyr leu arg arg glu ala pro glu ile val gly val arg val glu thr gly gln ala trp ala leu ala gly pro arg gly pro asn phe asp asn arg arg pro tyr ile his pro lys ser leu asp ser glu leu ile asn tyr glu arg glu val phe glu glu leu asn ala leu gly arg tyr asn arg ile thr thr gly ile tyr asn val thr ala tyr leu leu asn val asp gly asn ser pro asp asp asp phe gly ala asp asn ala ser ser ser gly leu leu val asp asn asp arg pro ser val ser ala thr glu asp tyr ala glu pro ser ser ser gly leu ser gly phe pro phe leu phe asp asp asp glu ser asp pro ser leu ala asp thr ala asp leu thr gln glu asp met asp leu ile glu val leu trp lys gln asp val asp leu gly phe ser leu glu glu leu gln pro ala asp lys pro gly lys ser pro ala asp asp asp val ala thr leu lys ala ile ala ala ser asp pro lys pro arg ser lys lys asp asp asp ser glu asp glu arg thr ser asn pro asp asp pro trp ala gly leu ser tyr thr ile asp leu glu thr gly glu tyr val leu lys asp ser leu cys glu glu leu ser asn thr pro ala thr ile leu val asp glu ala pro ser ser leu leu asp leu gln glu phe ser leu glu glu ala leu gln leu val gly leu asn glu ser ser thr glu ala ser lys glu glu ser pro leu ser glu pro ala ile ser ala pro pro gln lys ser gly thr asp gly asp val lys lys asp ala ala glu lys asp pro leu glu thr ala ser thr pro ser thr thr asp glu glu leu gly asp met ile gln thr ala gln phe his his pro his pro his pro arg ser phe gln gly arg val pro val val arg thr ala ser val glu gln arg trp gln asp leu ala asn leu leu ser leu pro gly glu gly val pro gly his thr ser tyr pro his his his his pro his his pro his ala his his pro his ile gly tyr gly gly ser ala ala gly gly ala val gly gly tyr gly asp ala ala arg gly val leu leu his asn ala thr leu ala pro pro val gly asp met asn ala ser ser pro tyr his gly his ser val gly ser asn ser asn leu gly thr ala val ala ala ser met asn leu thr asn ser ser glu pro met gly asp ala gly ser thr ala ser tyr lys met glu ser ser his asp met met tyr tyr gln asn ser thr thr glu ile ser gln thr thr glu gly phe leu ser ser ile leu asn asp glu asp leu gln leu met asp met ala met asn asp ser met tyr thr met arg met leu asp ala thr gly asn pro thr ser ala ser ser gly gly his ala gly ala ala ala gly gly ala ser ala val ala ala ser gly pro gly ala ala gly ala thr ser ala ala ala ala ala ala ala ala ala ala ala ala ala ala ala ala ala ala ala glu glu arg met asp ala ser ser asp ser ala val ser ser met gly ser glu arg val pro ser leu ser asp gly glu trp met glu thr gly ser asp ser gly his thr pro gly asp his tyr gly ala ala asp tyr his ala ser lys tyr arg pro tyr asp tyr ser tyr ser gly arg gln his ser ser ser val ser thr ala glu thr gln his arg val pro pro met ala gln lys lys his gln met phe gly lys arg cys phe gln glu gln thr ala gly ala ala ser ser leu gly ser his gly thr thr pro ser leu pro pro ala pro val lys tyr glu phe ser glu ala val pro ala gly gly asn ala phe gly ser pro leu glu ala gly val ala ala ala lys ala pro glu met lys tyr ser cys ser val glu phe ala arg his his pro glu val arg pro ser ile asp his ile gln his asn his ser tyr his leu pro ala glu ser thr gly ala leu gln arg pro val ser arg asp lys gln lys gly arg lys ser asp glu glu his leu asn arg asp glu lys arg ala arg ala met asn ile pro leu pro val asn asp ile ile asn leu pro met asp glu phe asn glu arg leu ser lys tyr asp leu ser glu ala gln leu ser leu ile arg asp ile arg arg arg gly lys asn lys val ala ala gln asn cys arg lys arg lys leu asp gln ile leu ser leu ala asp glu val lys glu met arg asp arg lys ser arg leu met gln glu arg asp tyr met leu ala glu arg gln arg val lys glu lys phe ser gln leu tyr arg his ile phe gln gln leu arg asp pro asp gly asn gln tyr ser met cys glu tyr ser leu gln gln ser ala asp gly thr val leu leu val pro arg ala asn ala thr ala phe leu asp pro glu ala thr thr ala ala ala ser cys arg lys arg glu glu glu lys glu

SEQ ID NO：3

Atggtttgcctgaagaaatcaaagtgt

SEQ ID NO：4

Tcactccttttcttcttcacgctttct

SEQ ID NO：5

Taatacgactcactatagggaaaccccgctctaagaagga

SEQ ID NO：6

Taatacgactcactataggggacactagctgtgcgaacca

SEQ ID NO：7

taatacgactcactatagggaaaccccgctctaagaaggacgacgacagtgaggacgaaaggacttccaaccctgacgacccatgggctggcctgtcatacactattgatttggagacaggagagtatgtgctcaaggatagcctgtgtgaagaactgagcaacacacctgcaaccatcttagttgatgaagcaccatcttcattgcttgatcttcaggaattctcacttgaggaggcattacagcttgtgggactgaatgaaagctctactgaggcctcaaaggaagaaagtccactctcagagccagcaatatcagcgccacctcaaaagagtggcactgatggagatgtgaagaaggacgctgctgagaaagacccattggaaacagcctcaacaccctcaacaacagacgaggagttgggcgatatgatacaaacagcacagttccaccacccacacccccatccacgctctttccagggtcgtgtgccggtggttcgcacagctagtgtcccctatagtgagtcgtatta

Sequence listing

<110> university of Shanxi

<120> locusta migratoria cap and C-type isomer gene dsRNA and application thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2970

<212> DNA

<213> migratory locust (Locusa migratoria)

<400> 1

atggtttgcc tgaagaaatc aaagtgtgac gagttgttgc agctggcact gctactcagc 60

ttgttgcgag cagatccaga cacttacctg cggcgggaag ctccagaaat cgtgggcgtc 120

cgcgtggaga caggtcaggc gtgggccctc gccggtcctc ggggtcctaa cttcgataac 180

cgcaggccct atatccaccc taaaagcctc gactctgaac tcataaatta cgagcgagaa 240

gtcttcgagg agctcaacgc ccttgggcgc tacaacagga taactacggg aatatataat 300

gttactgcgt atcttctcaa tgtggatgga aacagtccgg atgatgattt cggagcggac 360

aatgcatcga gctctgggtt gcttgtggac aacgacagac catcagtgtc tgcaaccgag 420

gattacgcgg agccatcatc ttctggacta tcgggatttc ctttcctgtt cgatgacgac 480

gagagcgacc ccagcttggc ggatacggca gacctgactc aggaggacat ggacctgatc 540

gaggtgcttt ggaagcagga cgtggacctg gggttctccc tggaggagct gcagcccgcc 600

gacaagcccg gcaagagccc tgcggacgac gacgtcgcca ccctaaaggc catcgccgcc 660

agcgacccca aaccccgctc taagaaggac gacgacagtg aggacgaaag gacttccaac 720

cctgacgacc catgggctgg cctgtcatac actattgatt tggagacagg agagtatgtg 780

ctcaaggata gcctgtgtga agaactgagc aacacacctg caaccatctt agttgatgaa 840

gcaccatctt cattgcttga tcttcaggaa ttctcacttg aggaggcatt acagcttgtg 900

ggactgaatg aaagctctac tgaggcctca aaggaagaaa gtccactctc agagccagca 960

atatcagcgc cacctcaaaa gagtggcact gatggagatg tgaagaagga cgctgctgag 1020

aaagacccat tggaaacagc ctcaacaccc tcaacaacag acgaggagtt gggcgatatg 1080

atacaaacag cacagttcca ccacccacac ccccatccac gctctttcca gggtcgtgtg 1140

ccggtggttc gcacagctag tgtcgaacag cgctggcaag acttggcaaa cctgctgagc 1200

ctacctgggg aaggtgttcc tggccacacg agctaccctc atcaccatca tcctcatcac 1260

ccacacgcac accatccaca tattggatat ggcggcagtg cagctggagg tgctgttggc 1320

ggttatggag atgcagcaag gggggtcttg ctgcacaatg ccacgcttgc tcctcccgtt 1380

ggggacatga atgcttccag tccatatcat ggacattctg ttggaagcaa ttcaaacctt 1440

ggaactgccg tggctgcttc aatgaacctg acaaacagca gtgaaccaat gggagatgca 1500

ggctctactg catcatacaa aatggaatca tcgcatgaca tgatgtacta tcagaattcc 1560

accaccgaaa taagtcagac aacagaggga tttttgtcat ccatactaaa tgatgaggat 1620

ttgcagctga tggatatggc aatgaatgac agtatgtaca cgatgcgcat gctggacgcg 1680

acgggcaacc cgacttctgc gtctagcggc gggcacgcgg gggcggcggc cggcggcgct 1740

tcggcggtgg cggcttctgg tccgggagcg gctggggcga cgtcagccgc tgcggcggcg 1800

gcggctgctg cggcggcggc ggcggctgcg gccgcggcgg ccgaggagcg catggacgcg 1860

tccagcgaca gcgccgtcag ctccatgggc tccgagcgcg tgccctcgct gtccgacggc 1920

gagtggatgg agaccggctc cgactccgga cacacgcccg gcgaccacta cggcgccgcc 1980

gactaccacg ccagcaagta caggccatac gactacagct actctggacg ccagcactcc 2040

agttctgtta gcactgctga gacgcagcac cgtgtcccgc ccatggctca aaagaaacat 2100

cagatgtttg gaaagcgatg cttccaggag caaactgcag gagcagcttc ttcgttgggt 2160

agccacggta cgacacctag tctgccacca gcgcctgtaa agtacgagtt cagtgaggcg 2220

gtgcctgctg gtggaaatgc atttggcagc ccgctggagg ctggagttgc tgctgcaaag 2280

gcacctgaga tgaaatatag ttgcagcgtt gaatttgcaa ggcaccatcc agaagtaaga 2340

ccatctattg accacataca gcacaatcat tcataccacc ttcctgcgga aagtacaggt 2400

gccttacaaa gacctgtctc gagagacaag caaaaaggtc gtaaatctga tgaggaacat 2460

ctgaacagag atgaaaaacg ggcacgtgca atgaacatcc cattgcctgt gaatgacatt 2520

atcaatttgc caatggatga atttaatgag cgactgtcaa aatatgatct tagtgaggca 2580

cagttatcac ttattaggga catcaggagg agaggaaaga ataaggttgc agcacagaac 2640

tgtcgcaaaa ggaaactaga tcagattctc agtcttgcag atgaggttaa agaaatgcgt 2700

gatcggaaga gccgtctgat gcaggagagg gattacatgc tggctgaacg tcagcgtgtg 2760

aaagagaagt ttagccagct ttacaggcac atctttcagc aactgcggga tcctgacggc 2820

aaccaatatt caatgtgtga atatagcctt caacaatctg cagatggcac agtgctgcta 2880

gtgcctcgag caaatgcaac tgcttttctg gatcccgaag ccaccactgc tgctgcttca 2940

tgcagaaagc gtgaagaaga aaaggagtga 2970

<210> 2

<211> 989

<212> PRT

<213> migratory locust (Locusa migratoria)

<400> 2

Met Val Cys Leu Lys Lys Ser Lys Cys Asp Glu Leu Leu Gln Leu Ala

1 5 10 15

Leu Leu Leu Ser Leu Leu Arg Ala Asp Pro Asp Thr Tyr Leu Arg Arg

20 25 30

Glu Ala Pro Glu Ile Val Gly Val Arg Val Glu Thr Gly Gln Ala Trp

35 40 45

Ala Leu Ala Gly Pro Arg Gly Pro Asn Phe Asp Asn Arg Arg Pro Tyr

50 55 60

Ile His Pro Lys Ser Leu Asp Ser Glu Leu Ile Asn Tyr Glu Arg Glu

65 70 75 80

Val Phe Glu Glu Leu Asn Ala Leu Gly Arg Tyr Asn Arg Ile Thr Thr

85 90 95

Gly Ile Tyr Asn Val Thr Ala Tyr Leu Leu Asn Val Asp Gly Asn Ser

100 105 110

Pro Asp Asp Asp Phe Gly Ala Asp Asn Ala Ser Ser Ser Gly Leu Leu

115 120 125

Val Asp Asn Asp Arg Pro Ser Val Ser Ala Thr Glu Asp Tyr Ala Glu

130 135 140

Pro Ser Ser Ser Gly Leu Ser Gly Phe Pro Phe Leu Phe Asp Asp Asp

145 150 155 160

Glu Ser Asp Pro Ser Leu Ala Asp Thr Ala Asp Leu Thr Gln Glu Asp

165 170 175

Met Asp Leu Ile Glu Val Leu Trp Lys Gln Asp Val Asp Leu Gly Phe

180 185 190

Ser Leu Glu Glu Leu Gln Pro Ala Asp Lys Pro Gly Lys Ser Pro Ala

195 200 205

Asp Asp Asp Val Ala Thr Leu Lys Ala Ile Ala Ala Ser Asp Pro Lys

210 215 220

Pro Arg Ser Lys Lys Asp Asp Asp Ser Glu Asp Glu Arg Thr Ser Asn

225 230 235 240

Pro Asp Asp Pro Trp Ala Gly Leu Ser Tyr Thr Ile Asp Leu Glu Thr

245 250 255

Gly Glu Tyr Val Leu Lys Asp Ser Leu Cys Glu Glu Leu Ser Asn Thr

260 265 270

Pro Ala Thr Ile Leu Val Asp Glu Ala Pro Ser Ser Leu Leu Asp Leu

275 280 285

Gln Glu Phe Ser Leu Glu Glu Ala Leu Gln Leu Val Gly Leu Asn Glu

290 295 300

Ser Ser Thr Glu Ala Ser Lys Glu Glu Ser Pro Leu Ser Glu Pro Ala

305 310 315 320

Ile Ser Ala Pro Pro Gln Lys Ser Gly Thr Asp Gly Asp Val Lys Lys

325 330 335

Asp Ala Ala Glu Lys Asp Pro Leu Glu Thr Ala Ser Thr Pro Ser Thr

340 345 350

Thr Asp Glu Glu Leu Gly Asp Met Ile Gln Thr Ala Gln Phe His His

355 360 365

Pro His Pro His Pro Arg Ser Phe Gln Gly Arg Val Pro Val Val Arg

370 375 380

Thr Ala Ser Val Glu Gln Arg Trp Gln Asp Leu Ala Asn Leu Leu Ser

385 390 395 400

Leu Pro Gly Glu Gly Val Pro Gly His Thr Ser Tyr Pro His His His

405 410 415

His Pro His His Pro His Ala His His Pro His Ile Gly Tyr Gly Gly

420 425 430

Ser Ala Ala Gly Gly Ala Val Gly Gly Tyr Gly Asp Ala Ala Arg Gly

435 440 445

Val Leu Leu His Asn Ala Thr Leu Ala Pro Pro Val Gly Asp Met Asn

450 455 460

Ala Ser Ser Pro Tyr His Gly His Ser Val Gly Ser Asn Ser Asn Leu

465 470 475 480

Gly Thr Ala Val Ala Ala Ser Met Asn Leu Thr Asn Ser Ser Glu Pro

485 490 495

Met Gly Asp Ala Gly Ser Thr Ala Ser Tyr Lys Met Glu Ser Ser His

500 505 510

Asp Met Met Tyr Tyr Gln Asn Ser Thr Thr Glu Ile Ser Gln Thr Thr

515 520 525

Glu Gly Phe Leu Ser Ser Ile Leu Asn Asp Glu Asp Leu Gln Leu Met

530 535 540

Asp Met Ala Met Asn Asp Ser Met Tyr Thr Met Arg Met Leu Asp Ala

545 550 555 560

Thr Gly Asn Pro Thr Ser Ala Ser Ser Gly Gly His Ala Gly Ala Ala

565 570 575

Ala Gly Gly Ala Ser Ala Val Ala Ala Ser Gly Pro Gly Ala Ala Gly

580 585 590

Ala Thr Ser Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala

595 600 605

Ala Ala Ala Ala Ala Ala Glu Glu Arg Met Asp Ala Ser Ser Asp Ser

610 615 620

Ala Val Ser Ser Met Gly Ser Glu Arg Val Pro Ser Leu Ser Asp Gly

625 630 635 640

Glu Trp Met Glu Thr Gly Ser Asp Ser Gly His Thr Pro Gly Asp His

645 650 655

Tyr Gly Ala Ala Asp Tyr His Ala Ser Lys Tyr Arg Pro Tyr Asp Tyr

660 665 670

Ser Tyr Ser Gly Arg Gln His Ser Ser Ser Val Ser Thr Ala Glu Thr

675 680 685

Gln His Arg Val Pro Pro Met Ala Gln Lys Lys His Gln Met Phe Gly

690 695 700

Lys Arg Cys Phe Gln Glu Gln Thr Ala Gly Ala Ala Ser Ser Leu Gly

705 710 715 720

Ser His Gly Thr Thr Pro Ser Leu Pro Pro Ala Pro Val Lys Tyr Glu

725 730 735

Phe Ser Glu Ala Val Pro Ala Gly Gly Asn Ala Phe Gly Ser Pro Leu

740 745 750

Glu Ala Gly Val Ala Ala Ala Lys Ala Pro Glu Met Lys Tyr Ser Cys

755 760 765

Ser Val Glu Phe Ala Arg His His Pro Glu Val Arg Pro Ser Ile Asp

770 775 780

His Ile Gln His Asn His Ser Tyr His Leu Pro Ala Glu Ser Thr Gly

785 790 795 800

Ala Leu Gln Arg Pro Val Ser Arg Asp Lys Gln Lys Gly Arg Lys Ser

805 810 815

Asp Glu Glu His Leu Asn Arg Asp Glu Lys Arg Ala Arg Ala Met Asn

820 825 830

Ile Pro Leu Pro Val Asn Asp Ile Ile Asn Leu Pro Met Asp Glu Phe

835 840 845

Asn Glu Arg Leu Ser Lys Tyr Asp Leu Ser Glu Ala Gln Leu Ser Leu

850 855 860

Ile Arg Asp Ile Arg Arg Arg Gly Lys Asn Lys Val Ala Ala Gln Asn

865 870 875 880

Cys Arg Lys Arg Lys Leu Asp Gln Ile Leu Ser Leu Ala Asp Glu Val

885 890 895

Lys Glu Met Arg Asp Arg Lys Ser Arg Leu Met Gln Glu Arg Asp Tyr

900 905 910

Met Leu Ala Glu Arg Gln Arg Val Lys Glu Lys Phe Ser Gln Leu Tyr

915 920 925

Arg His Ile Phe Gln Gln Leu Arg Asp Pro Asp Gly Asn Gln Tyr Ser

930 935 940

Met Cys Glu Tyr Ser Leu Gln Gln Ser Ala Asp Gly Thr Val Leu Leu

945 950 955 960

Val Pro Arg Ala Asn Ala Thr Ala Phe Leu Asp Pro Glu Ala Thr Thr

965 970 975

Ala Ala Ala Ser Cys Arg Lys Arg Glu Glu Glu Lys Glu

980 985

<210> 3

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggtttgcc tgaagaaatc aaagtgt 27

<210> 4

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcactccttt tcttcttcac gctttct 27

<210> 5

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

taatacgact cactataggg aaaccccgct ctaagaagga 40

<210> 6

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

taatacgact cactataggg gacactagct gtgcgaacca 40

<210> 7

<211> 535

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

taatacgact cactataggg aaaccccgct ctaagaagga cgacgacagt gaggacgaaa 60

ggacttccaa ccctgacgac ccatgggctg gcctgtcata cactattgat ttggagacag 120

gagagtatgt gctcaaggat agcctgtgtg aagaactgag caacacacct gcaaccatct 180

tagttgatga agcaccatct tcattgcttg atcttcagga attctcactt gaggaggcat 240

tacagcttgt gggactgaat gaaagctcta ctgaggcctc aaaggaagaa agtccactct 300

cagagccagc aatatcagcg ccacctcaaa agagtggcac tgatggagat gtgaagaagg 360

acgctgctga gaaagaccca ttggaaacag cctcaacacc ctcaacaaca gacgaggagt 420

tgggcgatat gatacaaaca gcacagttcc accacccaca cccccatcca cgctctttcc 480

agggtcgtgt gccggtggtt cgcacagcta gtgtccccta tagtgagtcg tatta 535

Claims (3)

1. A migratory locust cap and C-shaped isomer gene has the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof.

2. A migratory locust cap and C-shaped isomer gene fragment with both ends fused with a T7 promoter has the nucleotide sequence of SEQ ID NO: 7, or a sequence shown in the figure.

3. The application of dsRNA synthesized by taking the migratory locust cap with two ends fused with a T7 promoter and the C-shaped isomer gene fragment as templates in claim 2 to improving the migratory locust control effect of deltamethrin and imidacloprid.

Images