CN106636148B - A kind of migratory locusts cytochrome P450 reductase gene dsRNA and its application - Google Patents

A kind of migratory locusts cytochrome P450 reductase gene dsRNA and its application Download PDF

Info

Publication number
CN106636148B
CN106636148B CN201710115802.0A CN201710115802A CN106636148B CN 106636148 B CN106636148 B CN 106636148B CN 201710115802 A CN201710115802 A CN 201710115802A CN 106636148 B CN106636148 B CN 106636148B
Authority
CN
China
Prior art keywords
cytochrome
migratory locusts
dsrna
reductase
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201710115802.0A
Other languages
Chinese (zh)
Other versions
CN106636148A (en
Inventor
张学尧
王俊秀
马恩波
张建珍
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanxi University
Original Assignee
Shanxi University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanxi University filed Critical Shanxi University
Priority to CN201710115802.0A priority Critical patent/CN106636148B/en
Publication of CN106636148A publication Critical patent/CN106636148A/en
Application granted granted Critical
Publication of CN106636148B publication Critical patent/CN106636148B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C12N9/0077—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with a reduced iron-sulfur protein as one donor (1.14.15)
    • C12N9/0081—Cholesterol monooxygenase (cytochrome P 450scc)(1.14.15.6)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
    • A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
    • A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/15—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with reduced iron-sulfur protein as one donor, and incorporation of one atom of oxygen (1.14.15)
    • C12Y114/15006—Cholesterol monooxygenase (side-chain-cleaving) (1.14.15.6), i.e. cytochrome P450scc
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Agronomy & Crop Science (AREA)
  • Pest Control & Pesticides (AREA)
  • Dentistry (AREA)
  • Environmental Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides a kind of migratory locusts cytochrome P450 reductase gene dsRNA and its application.Specifically a kind of migratory locusts cytochrome P450 reductase gene, the nucleotides sequence of the gene are classified as SEQ ID NO:1, are based on SEQ ID NO:1, design synthesis genetic fragment SEQ ID NO:7 and corresponding dsRNA.The dsRNA of design synthesis is injected into migratory locusts body, and migratory locusts cytochrome P450 reductase gene expression dose is lowered, the decline of cytochrome P450 reductase enzyme activity, and sevin is caused to improve to 1.73 times -2.3 times migratory locusts lethality.The present invention, which screens the cytochrome P450 gene obtained, can be used as the molecular target of sevin Controlling Resistance, provide new approach for migratory locusts sevin resistance management.

Description

A kind of migratory locusts cytochrome P450 reductase gene dsRNA and its application
Technical field
The present invention relates to field of biotechnology, more particularly to a kind of cytochrome P450 reductase genetic fragment that is based on to synthesize DsRNA and its improve sevin prevention and treatment migratory locusts effect in application.
Technical background
Sevin is a kind of carbamate insecticides that purposes is extremely wide, has, stability low to people, animal toxicity Good, lasting medicine, work the advantages that rapid, is widely used in the daily preventing and controlling of the various pests of crop and forest.It is long Since phase, Reusability prevents and treats migratory locusts by the carbamate insecticides of representative of sevin, has made migratory locusts to sevin More serious resistance is generated, causes sevin prevention and treatment dosage to increase, plague of locusts control cost improves, and it is also right that sevin is excessively used Human health causes potential hazard to the ecological balance.Have at present through traditional mixed pesticide, alternately rotation use, It develops the approach such as novel pesticide to prevent and treat applied to migratory locusts, but field migratory locusts drug resistance harm at present is still extremely serious.Therefore There is an urgent need to research and develop the novel enhancing sevin of one kind to the technology of migratory locusts control efficiency.
RNA interference refers to endogenous or external source double-stranded RNA, under the action of inducing silencing complex and Dicer enzyme, specificity Induction expression of target gene silencing the phenomenon that.Due to RNA interference can with silencing pest pesticide resistance or resistant gene, to environment and Higher mammal safety, so the technology is widely used in pest resistance to insecticide prevention and treatment.
It is found through retrieval, current existing migratory locusts dsRNA related application is as follows: number of patent application 201610316474.6, it is entitled " a kind of migratory locusts enteron aisle nucleic acid hydrolysis enzyme gene application " in control of insect；Patent application Numbers 201610186141.6, it is entitled " migratory locusts wing epidermal protein gene and its application in control of insect "；Number of patent application 201610186149.2, it is entitled " application of the special epidermal protein gene of migratory locusts wing and its dsRNA "；Number of patent application 201510160191.2 entitled " application of the Knickkopf gene dsRNA in control of insect "；Number of patent application 201510160194.6, it is entitled " application of Retroactive gene and its dsRNA in control of insect "；Number of patent application 201510118799.9 entitled " a kind of insect cell cytochrome p 450 gene and its application "；Number of patent application 201510080636.6, it is entitled " insect chitin deacetylate enzyme gene 1 and its application in control of insect "；Patent Shen Please numbers 201410647729.8, it is entitled that " a kind of Asiatic migrotory locust atp synthase beta subunit gene and its dsRNA are in control of insect Using "；Number of patent application 201410665503.0, entitled " a kind of Asiatic migrotory locust atp synthase α subunit gene and its dsRNA exist Application in control of insect "；Number of patent application 201410292658.4, entitled " II type chitinase gene specificity of insect The application of dsRNA "；Number of patent application 201410069843.7, it is entitled " sequence of I type chitinase gene of locust and its The application of dsRNA ", number of patent application 201310023385.9, entitled " insect UDP-N- acetylglucosamine pyrophosphorylation The application of enzyme gene and its dsRNA "；Number of patent application 201210356675.0, entitled " insect β-N-acetylglucosamine Glycoside enzyme gene and its application "；Number of patent application 201010163625.1, a kind of entitled " insect chitin synthetase 1 gene piece Section and its dsRNA and application "；Number of patent application 201010163645.9, a kind of entitled " insect chitin synthetase 1 A gene Segment and its dsRNA and application "；Number of patent application 201010163618.1, a kind of entitled " 2 base of insect chitin synthetase Cause and application "；Number of patent application 201010163634.0, it is entitled " a kind of insect chitin synthetase 11 B gene segment and its DsRNA and application ", number of patent application 201010136330.5, entitled " chitinase genes of insects and its dsRNA's answers With ".
The core content of above-mentioned 18 patent applications all refer to using some key gene of injection method dsRNA silencing migratory locusts/ Lethal gene causes migratory locusts lethal phenotype, however after above-mentioned key gene/lethal gene silencing, the migratory locusts phenomena of mortality show compared with Slowly, it needs to wait more days or one development ages that could gradually observe lethal effect, this is highly detrimental to the plague of locusts and concentrates outburst Emergency prevention and control afterwards.More importantly migratory locusts are not only a kind of agricultural pests, the even more important link in food chain.In agriculture Industry production economy threshold value is hereinafter, a certain number of migratory locusts population quantities should be kept, to maintain the ecological balance.If above-mentioned migratory locusts are closed Key gene/lethal gene sequence artificial massive amplification or is transferred to crops by plant transgene means in process of production, Just there is generation key gene/lethal gene uncontrolled transfer potential risk, and then may cause migratory locusts population quantity and sharply subtract It is few, lead to the reduction of Feeding behavior quantity, finally endangers agricultural ecological balance, induce other insect disasters.
Cytochrome P450 is one of big metabolic detoxification enzyme system of insect three, which participates in a variety of agricultures including sevin The metabolic detoxification of medicine.The vigor of Cytochrome P450, which is strictly relied on, provides electronics with cytochrome P450 reductase.Therefore by elder brother Worm cytochrome P450 reductase interference, so that it may reduce insect cell cytochrome p 450 to the detoxification ability of pesticide, to reach Pesticide is improved to the control efficiency of pest.Usual insect only contains a cytochrome P450 reductase gene, what dsRNA was mediated Cytochrome P450 reductase interference majority will not directly cause insect death.This greatly facilitates researcher and passes through interference cell Cytochrome p 450 reductase, while multiple cytochrome P 450 enzymes vigor are adjusted, and then improve pest to the sensibility of pesticide.At present There is not yet improving the correlation of migratory locusts sevin lethality for migratory locusts cytochrome P450 reductase by dsRNA perturbation technique Report.
Summary of the invention
The purpose of the present invention is to provide a kind of dsRNA based on the synthesis of migratory locusts cytochrome P450 reductase genetic fragment And its improving the application in sevin prevention and treatment migratory locusts effect.
A kind of migratory locusts cytochrome P450 reductase gene provided by the invention, the nucleotides sequence of the gene are classified as SEQ ID Sequence shown in NO:1；The acquisition of the gene nucleotide series is according to non-redundant proteins database, using blastx software pair Annotation is compared in migratory locusts transcript profile database；The migratory locusts cytochrome P450 reductase base undetermined obtained for search annotation Cause, using Oligo software design overall length upstream primer SEQ ID NO:3 and overall length downstream primer SEQ ID NO:4；With migratory locusts CDNA is template, obtains the DNA fragmentation that a length is 2043bp by PCR amplification；It will be separated by agarose gel electrophoresis, The PCR product of plastic recovery kit after purification is connect with pEASY-T1 carrier, and heat shock method is transferred to Trans1-T1 competent cell, In agar plate picking colony, after being cultivated 12 hours in containing ammonia benzyl mycin-Double LB liquid medium of kanamycins, Shanghai Sangon Biotech Company is sent to be sequenced；It is 2043bp that sequencing, which obtains cytochrome P450 reductase full length gene, and nucleotides sequence is classified as Shown in SEQ ID NO:1.
The present invention provides a kind of amino acid sequence of migratory locusts cytochrome P450 reductase gene coding, it is characterised in that ammonia Base acid sequence is sequence shown in SEQ ID NO:2；The acquisition of the amino acid sequence is according to codeword triplet principle, by SEQ ID NO:1 is corresponding amino acid by Translate tool software translation, and carries out to its relative molecular weight and isoelectric point Prediction, prediction result show that cytochrome P450 reductase gene encodes 680 amino acid, relative molecular weight 77.1KD, reason It is 5.49 by isoelectric point.
The present invention provides a kind of both ends and merges the migratory locusts cytochrome P450 reductase genetic fragment for having T7 promoter, with And the dsRNA based on the segment synthesis and dsRNA based on segment synthesis is improving answering in sevin prevention and treatment migratory locusts effect With；Based on migratory locusts cytochrome P450 reductase gene order, 5 ' upstream primer SEQ ID of the end containing T7 promoter of design NO:5 and 5 ' holds the downstream primer SEQ ID NO:6 containing T7 promoter, is with migratory locusts cytochrome P450 reductase gene DNA Template reacts amplification by PCR and obtains target fragment SEQ ID NO:7；The target fragment is passed through into agarose gel electrophoresis point From, it is ultraviolet cut glue purification after, with t7 rna polymerase in-vitro transcription kit synthesize dsRNA；Later with glass needle by the dsRNA It is injected into the second uromere of migratory locusts abdomen, is detected under migratory locusts cytochrome P450 reductase mRNA expression and enzyme activity level Drop degree and the dsRNA improve sevin to the ability of migratory locusts control efficiency.
Beneficial effects of the present invention: by it is a kind of based on migratory locusts cytochrome P450 reductase genetic fragment synthesis dsRNA, The dsRNA is injected into the second uromere of migratory locusts abdomen with glass needle, migratory locusts cytochrome P450 reductase mRNA table can be detected Decline 64.3%-81.1% up to level, and cytochrome P450 reductase activity level reduces 18.4%-27.2%, injection should Lethality of the sevin to 3 age migratory locusts can be improved to 1.73 times -2.3 times after dsRNA.
Detailed description of the invention
Fig. 1: (swimming lane 1 is shown the pcr amplification product electrophoretogram of migratory locusts cytochrome P450 reductase full length gene clone DL5000DNA Marker, stripe size be followed successively by from top to bottom 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp and 100bp, swimming lane 2 show migratory locusts cytochrome P450 reductase full length gene amplified production item Band).
Fig. 2: dsRNA to migratory locusts cytochrome P450 reductase Gene Expression (dsGFP be inject dsGFP control Group, dsCPR are the processing group for injecting migratory locusts cytochrome P450 reductase genetic fragment dsRNA), β-actin is reference gene, Wherein P < 0.01 * *.
Fig. 3: dsRNA on migratory locusts cytochrome P450 reductase enzyme activity influence (dsGFP be injection dsGFP control group, DsCPR is the processing group for injecting migratory locusts cytochrome P450 reductase genetic fragment dsRNA), wherein P < 0.05 *.
Fig. 4: the injection dsRNA influence to sevin to migratory locusts lethality.(dsGFP is the control group for injecting dsGFP, DsCPR is the processing group for injecting migratory locusts cytochrome P450 reductase genetic fragment dsRNA), wherein P < 0.05 *.
Specific embodiment
Embodiment 1: migratory locusts cytochrome P450 reductase full length gene cDNA is obtained and amino acid sequence prediction.
1. migratory locusts cytochrome P450 reductase gene biological informatics is searched for.
With Formatdb program by migratory locusts transcript profile Unigene it is Sequence Transformed be comparison data library, pass through blastx software Comparison data library and non-redundant proteins database are compared into annotation one by one, search annotation result obtains 2 migratory locusts cell colors Plain P450 restores enzyme sequence.
2. migratory locusts cytochrome P450 reductase full length gene cDNA is obtained.
2.1) overall length design of primers needed for PCR overall length expands:
Compared using Sequencher software by 2 migratory locusts cytochrome P450 reductase genes that annotation obtains are compared It is right, it is spliced into 1 full length sequence；And overall length upstream primer is separately designed using Oligo software ATGGAGGCAGAGGCAGGCAACGAG (SEQ ID NO:3) and overall length downstream primer TCAGCTCCATACATCTGAAGAAT (SEQ ID NO:4)；Designed a pair of of overall length primer is sent to Sangon Biotech (Shanghai) Co., Ltd..
2.2) prepared by template needed for PCR amplification:
The migratory locusts 3 age nymph that upgrowth situation is good, jump is strong is chosen, is placed in liquid nitrogen and grinds, referring to English fine horse Trizol Kit extracts total serum IgE；Using Oligotex mRNA Mini Kit extracts kit and RevertAidTMH Minus Reverse Transcriptase reverse transcriptase reverse transcription cDNA, to obtain template needed for PCR reacts.
2.3) pcr amplification reaction:
PCR amplification obtains migratory locusts cytochrome P450 reductase cDNA and carries out detection separation (Fig. 1) by Ago-Gel； By gel extraction, plastic recovery kit (Sangon Biotech (Shanghai) Co., Ltd.) after purification, is carried with pEASY-T1 Body link, then be transferred in Trans-T1 competent cell and cultivate, the full hickie of agar plate culture picking, and access and contain ammonia benzyl It is cultivated in the fluid nutrient medium of penicillin and kanamycins, using the small extraction reagent kit of plasmid (raw work bioengineering (Shanghai) share Co., Ltd) extract plasmid after, send Sangon Biotech (Shanghai) Co., Ltd. to be sequenced；The full length gene obtained is sequenced The DNA sequence dna of cDNA is 2043bp, and nucleotides sequence is classified as sequence shown in SEQ ID NO:1.
3. migratory locusts cytochrome P450 reductase gene amino acid sequence is predicted.
It is predicted using amino acid of the Translate tool to migratory locusts cytochrome P450 reductase coded by said gene, The result shows that migratory locusts cytochrome P450 reductase gene encodes 680 amino acid, amino acid sequence is SEQ ID NO:2 institute The sequence shown, prediction relative molecular weight are 77.1KD, and theoretical isoelectric point is 5.49；Using SMART online software to its functional domain It is predicted, migratory locusts cytochrome P450 gene has signal peptide as the result is shown, contains FMN, FAD and NADP structural domain.Migratory locusts The amino acid of cytochrome P450 reductase coding is similar to the amino acid sequence that Drosophila melanogaster cytochrome P450 gene encodes Property reaches 70%.
Embodiment 2: the synthesis of migratory locusts cytochrome P450 reductase genetic fragment dsRNA.
The preparation of template needed for 1. migratory locusts cytochrome genes segment dsRNA is synthesized.
DNA sequence dna SEQ ID NO:1 based on the migratory locusts cytochrome P450 reductase gene that sequencing obtains, uses Primer needed for Oligo software design a pair synthesizes dsRNA；SequencetaatacgactcactatagggTATGAAATGGGTCTTGG GGA (SEQ ID NO:5) andtaatacgactcactatagggDivide shown in GGGTGCTTCTTCGTTGACTC (SEQ ID NO:6) It Wei not the required upstream and downstream primer of dsRNA synthesis (underscore part is T7 promoter)；Designed dsRNA primer is sent to raw work Bioengineering (Shanghai) limited liability company.
The required primer (containing T7 promoter sequence) for being used to synthesize dsRNA of design synthesis is subjected to PCR amplification, is obtained Obtain the segment that a segment length is 519bp；Its DNA sequence dna is sequence shown in SEQ ID NO:7；By gel separation, after purification It is detected using ultraviolet microplate reader, and the template as dsRNA synthesis.
2. the synthesis of migratory locusts cytochrome P450 reductase genetic fragment dsRNA.
It is used to synthesize the template of dsRNA based on above-mentioned preparation, using T7RiboMAXTM Express RNAi System (Promega) synthesis dsRNA is transcribed in vitro by t7 rna polymerase in kit.By micro ultraviolet specrophotometer to synthesis Good dsRNA is quantified, and so that its concentration is reached 1.0 μ g/ μ L, and be stored in spare in -20 DEG C of refrigerators.
Embodiment 3: migratory locusts cytochrome P450 reductase genetic fragment dsRNA promotes sevin to the migratory locusts death rate.
1. the injection of migratory locusts cytochrome P450 reductase genetic fragment dsRNA.
The 2nd day 3 ages nymph of 100 half male and half females of picking is injected for dsRNA.The 3 age nymphs for injecting dsGFP are made For control group, the dsRNA that dsCPR genetic fragment is synthesized is as processing group.Using glass needle by 3 μ L's (3 every nymph of μ g/) DsCPR is injected into the second uromere of migratory locusts abdomen, while the nymph of the identical quantity of picking injects same amount of dsGFP.It is to be injected complete Two groups of nymphs are placed under the same terms (illumination: interlunation=14:10 hours, 32 ± 3 DEG C of temperature, humidity 50%) by Bi Hou. Feed enough fresh wheat seedings, oat, wheat bran.
2. the detection of expression of migratory locusts cytochrome P450 reductase gene mRNA.
The migratory locusts of dsGFP and cytochrome P450 reductase genetic fragment dsRNA will be injected, continues to raise 24 hours, 48 Hour and 72 hours, and be stored in liquid nitrogen；RNA is extracted using TAKARA Trizol kit, and uses RevertAidTMH Minus Reverse Transcriptase reverse transcription is at the first chain cDNA；Cell color is detected using Real-time round pcr The mRNA of plain P450 reductase gene and β-actin expression, to be carried out to cytochrome P450 reductase gene silencing efficiency Compare；The results show that the mRNA of the cytochrome P450 reductase in experimental group is extremely aobvious to compare dsGFP group as benchmark Writing reduces p < 0.01 (Fig. 2).
3. after the dsRNA for injecting cytochrome P450 reductase genetic fragment, to cytochrome P450 reductase vigor It influences.
The migratory locusts of dsGFP and cytochrome P450 reductase genetic fragment dsRNA will have been injected, continue raising 24 hours and 48 hours, every 1 portion of polypide added the phosphate buffer of 10 parts of pH=7.8, and glass homogenizer is sufficiently homogenized；Polypide homogenate warp 10,000 revs/min are centrifuged 30 minutes, clear enzyme solution in acquisition, and by 950 microlitres of working solutions, (every milliliter contains 0.45 milligram of cytochromes C), it is uniformly mixed with 30 microlitres of upper clear enzyme solutions and 100 microlitres of NADPH and 20 microlitre of potassium cyanide, isothermal reaction under the conditions of 25 DEG C；Enzyme Mark the value added of light absorption value at instrument record 550nm, enzyme activity calculation formula are as follows: cytochromes 450 reductase vitality (unit/milli Gram)=(550nm absorbance increase/per minute × dilution gfactor × 1.1 times)/(21.1 × sample volume × sample protein is dense Degree)；As a result as shown in figure 3, migratory locusts cytochrome P450 reductase activity is remarkably decreased after injection dsRNA.
4. influencing death of the sevin to 3 age migratory locusts after the dsRNA for injecting cytochrome P450 reductase genetic fragment Rate.
By the migratory locusts after injection dsGFP and cytochrome P450 reductase genetic fragment dsRNA, continue raising 24 hours, In migratory locusts abdomen third uromere, 3 microlitres of acetone solns containing 10 micrograms per millilitres of drop and 3 microlitres contain 15 micrograms per millilitres The acetone soln of sevin counts sevin to the lethality of migratory locusts after 24 hours；As a result as shown in figure 4, injection cytochromes Lethality of the sevin to 3 age migratory locusts can be improved to 1.73 times -2.3 times after the dsRNA of P450 reductase.
SEQUENCE LISTING
<110>University Of Shanxi
<120>a kind of migratory locusts cytochrome P450 reductase gene dsRNA and its application
<130>
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 2043
<212> DNA
<213> Locusta migratoria
<400> 1
atggaggcag aggcaggcaa cgagctgggc gcgcagccgc tggaggagga gccgctgctg 60
ggcgccgtcg acatcctgct gttggcagcc ctgctggcgc tcgccgtctg gtacctgcgc 120
agccgcaagg ccaagaagga ggcgcagctc aacgccttct ccaccaagtc ctacaccata 180
caaccgacgg ctatgacggc gcccgcctcg gaccagtcgt tcatccagaa gctgaagacg 240
tccgggcgca gcctggtggt gttctacggc agccagacgg gcaccgccga ggagttcgcc 300
gggcgcctcg ccaaggaggg cgcgcgctac cggctcaagg gcatggtcgc cgaccccgag 360
gagtgcgaca tggaagaact gacgagcctc aaagacatcc ccaactcgct ggcggtgttc 420
tgcatggcca cgtacggcga gggcgacccc acagacaacg ccatggagtt ctacgagtgg 480
ctgcagaacg gggaccccga cctctccggt ttaaactacg cggtatttgg gctgggcaat 540
aagacctatg agcactacaa tgaggtggca aagtacatcg ataagaggct ggaagatctt 600
ggcgcaacac gtgtctatga aatgggtctt ggggatgatg atgccaacat tgaagatgat 660
ttcattacat ggaaggatca gttttggcca gctgtatgtg aattctttgg catagagtcc 720
actggtgaag atgtcagtgt aagacagtat cggctcactg agcacgactc catttcctct 780
gataagatat acacagggga agttgcaagg ctgcattcac ttgcaaacca gagaccgcca 840
tatgatgcaa agaacccatt tcttgctcca gttaaagtca acaaagaact tcataaggct 900
ggtgatcgct catgtatgca tatagaattt gatattgagg gatccaaaat gagatatgat 960
tcaggtgacc atgtagctgt ataccccatg aatgatgaag ctcttgtcaa caggataggt 1020
gaactgttga atattgactt ggacactgtg ataacattga caaatactga tgaggagtca 1080
acgaagaagc acccgtttcc ttgtccctgt tcatatcgca cagctctgag gcattacttg 1140
gacatcactt ccaatccccg cactcacatt ttgaaggaac ttatagaata tactaaggat 1200
ccacaggaac aagagaaact taagctcatg tcaagcacat ctcctgaagg aaagtcatta 1260
tacaatcaat ggataattaa agataaccgt aatattgtcc atatactgga agatctaccc 1320
tcctgtaagc ctgctctgga ccatttgtgt gaattgcttc cccggctgca ggcgagatac 1380
tactccattt cgtcatctcc aaaggtgtat ccaaattcag tgcatgtgac agcagtgtta 1440
gtggattaca cgacacctac tggccggcac aacaagggtg ttgcaacaag ttggctgaag 1500
aagaagcaac caaaggaaga ttttacacct actactccaa tctacattag aagatcacag 1560
ttcaggttgc caacaagaac tcagacccca attataatga tcgggccagg gacaggactg 1620
gcacctttcc gtggatttat tcaagaacga catctttcaa gaaaagaagg taagccagtt 1680
ggtgatacca tattatactt tggatgccgt aaaaagtctg aagattttat ttatcaagag 1740
gaactggaac agtatgccaa tgaaggtaca cttaagatgt atgttgcatt ctcaagagac 1800
caagcagaga aagtgtatgt tacccacctg ctacaaaaga acaaagatga aatctggaat 1860
atcattggag aaaacaatgg tcacttatat gtttgtggtg atgcaaaaaa tatggcacgt 1920
gatgtgcatg acattgttgt gaaagttgta atggaaaaag gaaatatgtc ggaatcggaa 1980
gccatggcct atgtgaagaa gatggagaac cagaaaagat attcttcaga tgtatggagc 2040
tga 2043
<210> 2
<211> 680
<212> PRT
<213> Locusta migratoria
<400> 2
Met Glu Ala Glu Ala Gly Asn Glu Leu Gly Ala Gln Pro Leu Glu Glu
1 5 10 15
Glu Pro Leu Leu Gly Ala Val Asp Ile Leu Leu Leu Ala Ala Leu Leu
20 25 30
Ala Leu Ala Val Trp Tyr Leu Arg Ser Arg Lys Ala Lys Lys Glu Ala
35 40 45
Gln Leu Asn Ala Phe Ser Thr Lys Ser Tyr Thr Ile Gln Pro Thr Ala
50 55 60
Met Thr Ala Pro Ala Ser Asp Gln Ser Phe Ile Gln Lys Leu Lys Thr
65 70 75 80
Ser Gly Arg Ser Leu Val Val Phe Tyr Gly Ser Gln Thr Gly Thr Ala
85 90 95
Glu Glu Phe Ala Gly Arg Leu Ala Lys Glu Gly Ala Arg Tyr Arg Leu
100 105 110
Lys Gly Met Val Ala Asp Pro Glu Glu Cys Asp Met Glu Glu Leu Thr
115 120 125
Ser Leu Lys Asp Ile Pro Asn Ser Leu Ala Val Phe Cys Met Ala Thr
130 135 140
Tyr Gly Glu Gly Asp Pro Thr Asp Asn Ala Met Glu Phe Tyr Glu Trp
145 150 155 160
Leu Gln Asn Gly Asp Pro Asp Leu Ser Gly Leu Asn Tyr Ala Val Phe
165 170 175
Gly Leu Gly Asn Lys Thr Tyr Glu His Tyr Asn Glu Val Ala Lys Tyr
180 185 190
Ile Asp Lys Arg Leu Glu Asp Leu Gly Ala Thr Arg Val Tyr Glu Met
195 200 205
Gly Leu Gly Asp Asp Asp Ala Asn Ile Glu Asp Asp Phe Ile Thr Trp
210 215 220
Lys Asp Gln Phe Trp Pro Ala Val Cys Glu Phe Phe Gly Ile Glu Ser
225 230 235 240
Thr Gly Glu Asp Val Ser Val Arg Gln Tyr Arg Leu Thr Glu His Asp
245 250 255
Ser Ile Ser Ser Asp Lys Ile Tyr Thr Gly Glu Val Ala Arg Leu His
260 265 270
Ser Leu Ala Asn Gln Arg Pro Pro Tyr Asp Ala Lys Asn Pro Phe Leu
275 280 285
Ala Pro Val Lys Val Asn Lys Glu Leu His Lys Ala Gly Asp Arg Ser
290 295 300
Cys Met His Ile Glu Phe Asp Ile Glu Gly Ser Lys Met Arg Tyr Asp
305 310 315 320
Ser Gly Asp His Val Ala Val Tyr Pro Met Asn Asp Glu Ala Leu Val
325 330 335
Asn Arg Ile Gly Glu Leu Leu Asn Ile Asp Leu Asp Thr Val Ile Thr
340 345 350
Leu Thr Asn Thr Asp Glu Glu Ser Thr Lys Lys His Pro Phe Pro Cys
355 360 365
Pro Cys Ser Tyr Arg Thr Ala Leu Arg His Tyr Leu Asp Ile Thr Ser
370 375 380
Asn Pro Arg Thr His Ile Leu Lys Glu Leu Ile Glu Tyr Thr Lys Asp
385 390 395 400
Pro Gln Glu Gln Glu Lys Leu Lys Leu Met Ser Ser Thr Ser Pro Glu
405 410 415
Gly Lys Ser Leu Tyr Asn Gln Trp Ile Ile Lys Asp Asn Arg Asn Ile
420 425 430
Val His Ile Leu Glu Asp Leu Pro Ser Cys Lys Pro Ala Leu Asp His
435 440 445
Leu Cys Glu Leu Leu Pro Arg Leu Gln Ala Arg Tyr Tyr Ser Ile Ser
450 455 460
Ser Ser Pro Lys Val Tyr Pro Asn Ser Val His Val Thr Ala Val Leu
465 470 475 480
Val Asp Tyr Thr Thr Pro Thr Gly Arg His Asn Lys Gly Val Ala Thr
485 490 495
Ser Trp Leu Lys Lys Lys Gln Pro Lys Glu Asp Phe Thr Pro Thr Thr
500 505 510
Pro Ile Tyr Ile Arg Arg Ser Gln Phe Arg Leu Pro Thr Arg Thr Gln
515 520 525
Thr Pro Ile Ile Met Ile Gly Pro Gly Thr Gly Leu Ala Pro Phe Arg
530 535 540
Gly Phe Ile Gln Glu Arg His Leu Ser Arg Lys Glu Gly Lys Pro Val
545 550 555 560
Gly Asp Thr Ile Leu Tyr Phe Gly Cys Arg Lys Lys Ser Glu Asp Phe
565 570 575
Ile Tyr Gln Glu Glu Leu Glu Gln Tyr Ala Asn Glu Gly Thr Leu Lys
580 585 590
Met Tyr Val Ala Phe Ser Arg Asp Gln Ala Glu Lys Val Tyr Val Thr
595 600 605
His Leu Leu Gln Lys Asn Lys Asp Glu Ile Trp Asn Ile Ile Gly Glu
610 615 620
Asn Asn Gly His Leu Tyr Val Cys Gly Asp Ala Lys Asn Met Ala Arg
625 630 635 640
Asp Val His Asp Ile Val Val Lys Val Val Met Glu Lys Gly Asn Met
645 650 655
Ser Glu Ser Glu Ala Met Ala Tyr Val Lys Lys Met Glu Asn Gln Lys
660 665 670
Arg Tyr Ser Ser Asp Val Trp Ser
675 680
<210> 3
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<223>Sangon Biotech (Shanghai) Co., Ltd.
<400> 3
atggaggcag aggcaggcaa cgag 24
<210> 4
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223>Sangon Biotech (Shanghai) Co., Ltd.
<400> 4
tcagctccat acatctgaag aat 23
<210> 5
<211> 40
<212> DNA
<213> Artificial sequence
<220>
<223>Sangon Biotech (Shanghai) Co., Ltd.
<400> 5
taatacgact cactataggg tatgaaatgg gtcttgggga 40
<210> 6
<211> 40
<212> DNA
<213> Artificial sequence
<220>
<223>Sangon Biotech (Shanghai) Co., Ltd.
<400> 6
taatacgact cactataggg gggtgcttct tcgttgactc 40
<210> 7
<211> 519
<212> DNA
<213> Artificial sequence
<220>
<223> PCR product
<400> 7
taatacgact cactataggg tatgaaatgg gtcttgggga tgatgatgcc aacattgaag 60
atgatttcat tacatggaag gatcagtttt ggccagctgt atgtgaattc tttggcatag 120
agtccactgg tgaagatgtc agtgtaagac agtatcggct cactgagcac gactccattt 180
cctctgataa gatatacaca ggggaagttg caaggctgca ttcacttgca aaccagagac 240
cgccatatga tgcaaagaac ccatttcttg ctccagttaa agtcaacaaa gaacttcata 300
aggctggtga tcgctcatgt atgcatatag aatttgatat tgagggatcc aaaatgagat 360
atgattcagg tgaccatgta gctgtatacc ccatgaatga tgaagctctt gtcaacagga 420
taggtgaact gttgaatatt gacttggaca ctgtgataac attgacaaat actgatgagg 480
agtcaacgaa gaagcacccc cctatagtga gtcgtatta 519

Claims (1)

  1. There is the dsRNA of the migratory locusts cytochrome P450 reductase genetic fragment synthesis of T7 promoter mentioning 1. a kind of both ends are merged Application in high sevin prevention and treatment migratory locusts effect；
    The migratory locusts cytochrome P450 reductase genetic fragment for having T7 promoter is merged at the both ends, and nucleotides sequence is classified as Sequence shown in SEQ ID NO:7.
CN201710115802.0A 2017-03-01 2017-03-01 A kind of migratory locusts cytochrome P450 reductase gene dsRNA and its application Active CN106636148B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710115802.0A CN106636148B (en) 2017-03-01 2017-03-01 A kind of migratory locusts cytochrome P450 reductase gene dsRNA and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710115802.0A CN106636148B (en) 2017-03-01 2017-03-01 A kind of migratory locusts cytochrome P450 reductase gene dsRNA and its application

Publications (2)

Publication Number Publication Date
CN106636148A CN106636148A (en) 2017-05-10
CN106636148B true CN106636148B (en) 2019-07-09

Family

ID=58846941

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710115802.0A Active CN106636148B (en) 2017-03-01 2017-03-01 A kind of migratory locusts cytochrome P450 reductase gene dsRNA and its application

Country Status (1)

Country Link
CN (1) CN106636148B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108546692B (en) * 2018-05-14 2020-04-07 中国农业科学院植物保护研究所 Asian locusta protein tyrosine kinase PTK and coding gene and application thereof
CN110144351B (en) * 2019-05-17 2020-08-04 山西大学 dsRNA of locusta migratoria fatty acid synthetase gene L mFAS2, and preparation method and application thereof
CN111454959B (en) * 2020-03-31 2021-09-28 山西大学 Migratory locust Spinless gene dsRNA and application thereof

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101283089A (en) * 2005-10-07 2008-10-08 加利福尼亚大学董事会 Nucleic acids encoding modified cytochrome P450 enzymes and methods of use thereof
CN102776189B (en) * 2012-06-18 2013-10-23 中国农业科学院作物科学研究所 Cytochrome P450 dsRNA (double-stranded ribonucleic acid) and application to aphid growth inhibition
CN104178501A (en) * 2014-08-19 2014-12-03 新疆旺源驼奶实业有限公司 Nucleotide sequence for coding Bactrian camel cytochrome P450, Bactrian camel cytochrome P450 and application thereof
CN104673812A (en) * 2015-03-18 2015-06-03 山西大学 Insect cytochrome P450 gene and application thereof
CN105695476A (en) * 2016-03-29 2016-06-22 山西大学 Migratory locust wing epidermis protein gene and application thereof in pest control
CN105755006A (en) * 2016-03-29 2016-07-13 山西大学 Migratory locust wing specific cuticle protein gene and application of dsRNA thereof
CN105802924A (en) * 2016-01-08 2016-07-27 上海交通大学 Earthworm cytochrome P450 gene and protein encoded by same

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101283089A (en) * 2005-10-07 2008-10-08 加利福尼亚大学董事会 Nucleic acids encoding modified cytochrome P450 enzymes and methods of use thereof
CN102776189B (en) * 2012-06-18 2013-10-23 中国农业科学院作物科学研究所 Cytochrome P450 dsRNA (double-stranded ribonucleic acid) and application to aphid growth inhibition
CN104178501A (en) * 2014-08-19 2014-12-03 新疆旺源驼奶实业有限公司 Nucleotide sequence for coding Bactrian camel cytochrome P450, Bactrian camel cytochrome P450 and application thereof
CN104673812A (en) * 2015-03-18 2015-06-03 山西大学 Insect cytochrome P450 gene and application thereof
CN105802924A (en) * 2016-01-08 2016-07-27 上海交通大学 Earthworm cytochrome P450 gene and protein encoded by same
CN105695476A (en) * 2016-03-29 2016-06-22 山西大学 Migratory locust wing epidermis protein gene and application thereof in pest control
CN105755006A (en) * 2016-03-29 2016-07-13 山西大学 Migratory locust wing specific cuticle protein gene and application of dsRNA thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
"Locusta migratoria manilensis NADPH-cytochrome P450 reductase mRNA，complete cds";Zhang,X等;《GenBank Database》;20170101;Accession No.KT033858.1
飞蝗羧酸酯酶基因的分子特性及组织定位;葛娉婷;《山西大学2012届硕士学位论文》;20120601;全文

Also Published As

Publication number Publication date
CN106636148A (en) 2017-05-10

Similar Documents

Publication Publication Date Title
Zhao et al. Cloning and characterization of maize miRNAs involved in responses to nitrogen deficiency
Jang et al. A Spätzle-processing enzyme required for toll signaling activation in Drosophila innate immunity
Zhao et al. Functional characterization of three trehalase genes regulating the chitin metabolism pathway in rice brown planthopper using RNA interference
Yuan et al. RNA-Seq analysis of differential gene expression responding to different rhizobium strains in soybean (Glycine max) roots
CN104610440B (en) Applications of the ABC transporter gene ABCH1 and its specific dsRNA in diamondback moth preventing and treating and Bt resistance managements
CN106636148B (en) A kind of migratory locusts cytochrome P450 reductase gene dsRNA and its application
CN103687952A (en) Down regulating gene expression in insect pests
Singh et al. Identification and expression analysis of pathogenicity-related genes in Tilletia indica inciting Karnal bunt of wheat
CN111944824B (en) Tachykinin receptor gene of fall webworm, dsRNA and application in preventing and treating fall webworm
CN114957426B (en) SP6RARS and application thereof in preventing and treating cockroaches
CN117120605A (en) Compositions and methods for producing cyclic polyribonucleotides
CN104593391B (en) Brown planthopper survival and growth development-associated NlPIK3R1 gene, and coded protein and application thereof
CN104561006A (en) Lymantria dispar linnaeus CYP6AN15v1 gene dsRNA and application thereof in nuisanceless control
CN111394360B (en) Migratory locust cap and migratory locust C-type isomer gene dsRNA and application thereof
CN105685092B (en) A kind of chitin synthesis inhibits insecticides and preparation method and application
CN106086037B (en) A kind of sweet wormwood bZIP class transcription factor coded sequence and cloning process and application
Niu et al. Role of c‐Jun NH2‐terminal kinase‐mediated mitogen‐activated protein kinase pathway in response to pesticides in Apis cerana cerana
CN104293810B (en) Gypsymoth chitinase gene and dsRNA based on gene silent technology
CN112695045B (en) Lepidoptera insect Hpx12 gene and application thereof
Luo et al. A novel microRNA and the target gene TAB2 can regulate the process of sucking blood in and the spawn rate of Hyalomma asiaticum (Acari: Ixodidae) ticks
CN104404042A (en) Application of Locusta migratoria ATP synthase beta subunit gene and its dsRNA in pest control
Shi et al. Cotesia vestalis parasitization suppresses expression of a Plutella xylostella thioredoxin
Fan et al. Molecular Characterization and Expression Analysis of Glutaredoxin 5 in Black Tiger Shrimp (Penaeus monodon) and Correlation Analysis Between the SNPs of PmGrx5 and Ammonia-N Stress Tolerance Trait
Robles‐Fort et al. Unveiling gene expression regulation of the Bacillus thuringiensis Cry3Aa toxin receptor ADAM10 by the potato dietary miR171c in Colorado potato beetle
CN101210252B (en) Lepidoptera pest ground substance metalloprotein gene mmp and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant