CN104293810B

CN104293810B - Gypsymoth chitinase gene and dsRNA based on gene silent technology

Info

Publication number: CN104293810B
Application number: CN201410439310.3A
Authority: CN
Inventors: 范晓军; 张建栋; 赵秋勇; 张常; 刘建红; 糜艳霞
Original assignee: Taiyuan University of Technology
Current assignee: Taiyuan University of Technology
Priority date: 2014-09-01
Filing date: 2014-09-01
Publication date: 2018-02-02
Anticipated expiration: 2034-09-01
Also published as: CN104293810A

Abstract

The present invention provides a kind of genetic fragment of gene of insect chitinase 5 and its dsRNA application, by the clone to the gene of gypsymoth chitinase 5 and sequencing, obtains nucleotides sequence and is classified as SEQ ID NO：1 gene of total length chitinase 5, it is SEQ ID NO therefrom to select sequence：2 genetic fragment of chitinase 5, the synthesis for dsRNA.After the body cavity of above-mentioned dsRNA injection gypsymoths, gypsymoth is difficult dead because of husking.Development for the insect pest control method of safety nuisance free provides new approach.

Description

Gypsymoth chitinase gene and dsRNA based on gene silent technology

Technical field

The present invention relates to biological technical field, and in particular to the gypsymoth lethal gene fragment based on gene silent technology Applications of the Chitinase5 and its dsRNA and dsRNA in lethal insect.

Background technology

In China, the continuous single long-term use of chemical agent has caused insect that Multiple Pesticides are generated with different degrees of resist The property of medicine, satisfied prevention effect is can be only achieved for example, needing to continue to increase Pesticide use amount for insect gypsymoth, is caused more For serious environmental pollution, vicious circle is formed.In addition, gypsymoth can also influence human health, when the direct dirty dancing poison of people During moth, redness can often occur and itch phenomenon, severe patient even produces fash.Therefore, in agricultural production practice, it is badly in need of chemical agriculture Replacement means of prevention outside medicine.

RNA is disturbed（RNA interference, RNAi）It is a kind of gene silencing phenomenon by double chain RNA mediate, double-strand RNA is finally processed to the tiny RNA that size is about 22nt（siRNA）, sequence pairing by way of with protein coding gene knot Close, the degree degraded target gene mRNA or the protein translation process of suppressor matched according to sequence.RNAi is widely present In fungi, plant and animal.Andre Fire and Craig Mello in 2006 is because having found that Nobel doctor is awarded in RNAi phenomenons Learn and encouraged with physiology.

In organism, it is necessary that some important gene pairs, which sustain life,.Therefore, for theoretically, if sharp The expression of important gene in agricultural pests is disturbed with RNA perturbation techniques, then can cause the teratogenesis or lethal of insect, so as to Reach the purpose of control insect.

Chitin degrading and metabolism are distinctive biological phenomenas in insect constant pitch main drive object, due to the mankind and other height Deng be free of chitin in animal body, therefore insect chitin degeneration system has been acknowledged as the target that novel pesticide acts on.It is several Fourth matter enzyme plays key effect in the degradation process of insect chitin, using RNA perturbation techniques, carries out chitinase dsRNA Application in control of insect is significant.

The content of the invention

It is an object of the invention to provide a kind of gene of chitinase 5 of insect gypsymoth and its lethal gene fragment, by the base Because of the application in lethal insect gypsymoth of dsRNA and dsRNA of fragment synthesis.

The present invention adopts the following technical scheme that realization：

A kind of gene of chitinase 5 of gypsymoth, its nucleotide sequence such as SEQ ID NO：Shown in 1；It is by designing elder brother After the degenerate primer of worm chitinase, PCR amplifications obtain its conserved region, are expanded by RACE-PCR and obtain total length, are named as LdCHT5.Its total length is 1895bp, wherein open read frame 1737bp, encodes the length point of 578 amino acid, 5 ＇-UTR and 3 ＇-UTR Wei not 42bp and 116bp.

The lethal fragment of the gene of chitinase 5 of above-mentioned gypsymoth, its nucleotide sequence such as SEQ ID NO：Shown in 2, it is According to SEQ ID NO：1 design sense primer SEQ ID NO：3 and anti-sense primer SEQ ID NO：4, expand and obtain through PCR.

Related kit is further utilized, dsRNA is synthesized according to the gene lethal fragment of chitinase 5 of gypsymoth.

Applications of the dsRNA in lethal insect：DsRNA is injected to the prepupal period larva body cavity of gypsymoth, the results showed that： In insect bodies, dsRNA can be expressed with the mRNA of the specific gene of silence chitinase 5, cause gypsymoth difficult dead because of husking Die.

The present invention is reasonable in design, obtains the lethal gene fragment of the gene of chitinase 5 of gypsymoth, and by the gene piece Duan Hecheng dsRNA, there is provided for a kind of biological control method of insect gypsymoth, be expected to reduce largely making for agricultural chemicals With, environmental protection, production cost is reduced, economic well-being of workers and staff is improved, there is market application foreground.

Brief description of the drawings

Fig. 1 represents the influence grown after prepupal period Lymantria dispar larvae injection dsRNA to it.Inject dsRNA experiment Group（A, B in figure）There is the phenotype that husking difficulty can not turn to adult and death, the control group of injection DEPC processing water（C in figure, D）Development is normal.

Embodiment

Embodiment 1

The preparation method of the full length gene of gypsymoth chitinase 5 is as follows：

（1）, PCR primer design

According to the amino acid consensus sequence of known insect chitinase 5, it is as follows to devise following degenerated primers：

Sense primer：CHT5F 5'-GAYTGGGAGTACCCHGG-3',

Anti-sense primer：CHT5R 5'-TCCATRTCRATRGCCCA-3'；

（2）, the gene RACE primers of gypsymoth chitinase 5 design

It is as follows based on fragment obtained above design primer：

5'RACE sense primers：5'- CGCTACGTAACGGCATGACAGTG(C)₁₆-3'

5'RACE anti-sense primers：5'- GGTGTACGGAGCAGGATCGCCACC-3'

3'RACE sense primers：5'- GCTGGATGCTATCCACGTGATGTCG-3'

3'RACE anti-sense primers：5'- CGCTACGTAACGGCATGACAGTG(T)₁₈-3'

All primers synthesize by Shanghai Invitrogen biology Co., Ltd.

（3）The acquisition of gypsymoth total serum IgE

The instar larvae of gypsymoth 4 of the same size is chosen, 3 first groups, is frozen in liquid nitrogen, total serum IgE to be extracted, extraction is total RNA concrete operation step according to TaKaRa Trizol kits.

（4）, the chains of gypsymoth cDNA first synthesis

The operating procedure of the synthesis of the chains of cDNA first is with reference to PrimeScriptTM RT reagent Kit with gDNA Eraser kits.

（5）, PCR amplification

Using the above-mentioned chains of cDNA first as template, according to Taq enzyme（TIANGEN）Specification enters performing PCR amplification, by what is expanded Fragment is further cloned, is sequenced.

（6）Sequence analysis

Obtained sequence is analyzed using ExPASy, and sequence homology is carried out using BLAST functions in NCBI websites Compare, it is determined that the genetic fragment obtained is the gene of gypsymoth chitinase 5.

The gene of chitinase 5 of above-mentioned gypsymoth, its nucleotide sequence such as SEQ ID NO：Shown in 1.

Embodiment 2

The preparation method of the gene lethal fragment of gypsymoth chitinase 5 is as follows：

The nucleotide sequence of the gene of gypsymoth chitinase 5 obtained according to embodiment 1, using primerpremier5.0 The specific primer of Software for Design, upstream primer sequence are SEQ ID NO：3, downstream primer sequence is SEQ ID NO：4, own Primer synthesizes by Shanghai Invitrogen biology Co., Ltd；Wherein, sense primer and anti-sense primer need to obtain for embodiment 1 The nucleotide sequence of the gene of gypsymoth chitinase 5 be designed, applicant pass through to the design of multiple upstream and downstream primers and After the conscientiously screening of multiple genetic fragments, the lethal gene fragment with practical application effect is just finally determined.

The restructuring pEASY-T1 plasmids of the gene of gypsymoth chitinase 5 that embodiment 1 obtains will be successfully connected as template, PCR amplifications obtain the gene lethal fragment of gypsymoth chitinase 5, use MicroElute Cycle Pure Kit（OMEGA）Examination Agent box is purified.

The gene lethal fragment of chitinase 5 of above-mentioned gypsymoth, its nucleotide sequence such as SEQ ID NO：Shown in 2.

Embodiment 3

The dsRNA of the gene lethal fragment of gypsymoth chitinase 5 acquisition

The gene lethal fragment of chitinase 5 obtained with embodiment 2, according to T7RiboMAX Express RNAi System（Promega）Kit specification, in-vitro transcription synthesis dsRNA.Obtained dsRNA is electric with 1.5% Ago-Gel Swimming detects its unicity, uses ELIASA（Thermo Scientific Multiskan GO, Thermo Fisher Scientific, USA）Detect its concentration, and be concentrated into the μ g/ μ l of final concentration 1 preserve to -80 DEG C it is standby.

Embodiment 4

Applications of the dsRNA in lethal insect gypsymoth is as follows：

The dsRNA of the gene lethal fragment of gypsymoth chitinase 5 lethal gypsymoth experiment

（1）The dsRNA injections of the genetic fragment of gypsymoth chitinase 5

Choose the dsRNA that prepupal period larva is used to inject above-mentioned synthesis.The micro syringe of 5ul specifications is used to inject, and notes Can not be firmly excessive when penetrating, flank portion pays attention to avoiding valve as injection point.The amount for injecting dsRNA is 5 μ g, and sets injection The control group of the water of the DEPC processing of equivalent, experimental group and each 20 of control group.After injection, larva is positioned over biochemical training Support and raised in case with purchased from Chinese forest-science academy's forest ecological environment with Protective strategy（Illumination：Interlunation=16h：8h, 26 ± 1 DEG C of temperature, humidity 70%）.

（2）, injection dsRNA after gypsymoth phenotype observation

Larva continues to raise after injecting, and observes in time.The experimental group of injection dsRNA gypsymoths has part larva It is dead for adult because nymphosis can not be sloughed off.

（3）, injection dsRNA after gypsymoth death condition observation

The gypsymoth experimental group death rate for injecting dsRNA is 25%, this control group handled with injection DEPC（The death rate is 1.67%）Compare, lethal effect is obvious.

SEQUENCE LISTING

<110>Institutes Of Technology Of Taiyuan

<120>The gene of gypsymoth chitinase 5 and dsRNA based on gene silent technology

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 1895

<212> DNA

<213>Gypsymoth (Lymantria dispar)

<400> 1

ctcggatcca ctagtaacgg ccgccagtgt gctggaattg cccttagagt gatactagcg 60

acgttggccg tcctggcggt cgcaacgact gcaattgaag cggacagcaa agcgcgcata 120

gtatgctact tcagcaactg ggcggtgtac agacccggcg tgggtcgcta cggcatcgag 180

gacatccccg tggacctctg cacgcacatc atctactcct tcatcggcgt cactgagaag 240

agcaatgagg tcctcatcat tgatcctgag ctggacgtag acaagaacgg ttttcggaac 300

ttcacagctc ttcgaaagtc gcaccctaac gtgaagttca cggtggctgt gggtggctgg 360

gccgaggggg gctctaagta ctcgcacatg gttgcgcaga aacaaaccag aatggctttc 420

gttaggagcg ttgttgattt cttgaagaaa tacgactttg atggtttgga cttggattgg 480

gagtaccctg gtgcggctga ccgtggtggc tccttctcag acaaggatcg gttcctcttc 540

ctcgtccagg agttgaggag agccttcatc agggagaaga ggggatggga actgactgct 600

gctgtgcctc tcgctaactt cagactgatg gagggatacc acgtacctga tctttgccaa 660

gagctggatg ctatccacgt gatgtcgtac gatttgcgcg gcaactgggc tggctttgca 720

gatgtgcact cacctttata taagcgtcct catgatcagt gggcctatga gaagttgaat 780

gtgaatgatg gcctagcgct ctgggaagag aagggttgtc ccagcaacaa gctcgtcgtc 840

ggcattccgt tctacggtcg ctccttcaca ctctccgctg gtaacaacaa ttacggactt 900

ggtacctaca tcaacaagga ggctggaggt ggcgatcctg ctccgtacac caatgctact 960

gggttctggg cttattatga gatctgtacc gaagtcgaca aagaaggctc aggctggacc 1020

aagaaatggg atgacgccgg caaatgtccc tacgcctaca agggcaccca gtgggtcggc 1080

tacgaggacc ctcgcagtgt cgagatcaag atgaactgga tcaaggagaa gggctacctg 1140

ggcgccatga cctgggccat cgatatggac gacttcaagg gactttgtgg tgatgagaac 1200

cctctgatca agctcctgca taagcatatg agcacttaca ctgtcccacc acctcgctct 1260

ggaaatacta ctcctacgcc tgaatgggcg cggcccccgt ccacaacgtc cgacccggct 1320

gagggggaga tcgtcactac tgtcaagtcc acgactgcga agccagctac gacgaaacca 1380

agcacagcca agccaacgac ggccaagcct acgacggcca agccaacaac ggccaagcct 1440

acgacgacca aagcacccca agccgtaaca atcccagatg atgagaatga catcgctgtg 1500

agacctgaac ctccgaaaaa acctgtaact ccagaaaccc ctgtggtacc tgaagttcct 1560

gaatctgctg aaacaccaac tgaaaatgaa atagataacc acgacgtttg caattctgaa 1620

gaggattacg tgcctgacaa gaaaaagtgc gataagtact ggcgatgcgt caacggacga 1680

ggaatgctgt tcacatgcca accaggaact gtgttcaacg tgaagctgaa tgtctgcgac 1740

tggccagaca acgccgaccg tagtgactgc gagccctaaa ctgaagggca attctgcaga 1800

tatccatcac actggcggcc gctcgagcat gcatctagag ggcccaattc gccctatagt 1860

gagtcgtatt acaattcact ggccgtcgtt ttaca 1895

<210> 2

<211> 472

<212> DNA

<213>Gypsymoth (Lymantria dispar)

<400> 2

taagtactcg cacatggttg cgcagaaaca aaccagaatg gctttcgtta ggagcgttgt 60

tgatttcttg aagaaatacg actttgatgg tttggacttg gattgggagt accctggtgc 120

ggctgaccgt ggtggctcct tctcagacaa ggatcggttc ctcttcctcg tccaggagtt 180

gaggagagcc ttcatcaggg agaagagggg atgggaactg actgctgctg tgcctctcgc 240

taacttcaga ctgatggagg gataccacgt acctgatctt tgccaagagc tggatgctat 300

ccacgtgatg tcgtacgatt tgcgcggcaa ctgggctggc tttgcagatg tgcactcacc 360

tttatataag cgtcctcatg atcagtgggc ctatgagaag ttgaatgtga atgatggcct 420

agcgctctgg gaagagaagg gttgtcccag caacaagctc gtcgtcggca tt 472

<210> 3

<211> 41

<212> DNA

<213>Gypsymoth (Lymantria dispar)

<400> 3

taatacgact cactataggg taagtactcg cacatggttg c 41

<210> 4

<211> 44

<212> DNA

<213>Gypsymoth (Lymantria dispar)

<400> 4

taatacgact cactataggg gaatgccgac gacgagcttg ttgc 44

Claims

1. a kind of gene lethal fragment of chitinase 5 of gypsymoth, its nucleotide sequence such as SEQ ID NO：Shown in 2.

A kind of 2. preparation method of the gene lethal fragment of chitinase 5 of the gypsymoth described in claim 1, it is characterised in that： Comprise the following steps：

First, the nucleotide sequence of the gene of gypsymoth chitinase 5 is obtained

（1）, PCR primer design

According to the amino acid consensus sequence of known insect chitinase 5, following degenerated primers is devised：

Sense primer：CHT5F 5'-GAYTGGGAGTACCCHGG-3',

Anti-sense primer：CHT5R 5'-TCCATRTCRATRGCCCA-3'；

（2）, the gene RACE primers of gypsymoth chitinase 5 design

5'RACE sense primers：5'- CGCTACGTAACGGCATGACAGTG(C)₁₆-3'

5'RACE anti-sense primers：5'- GGTGTACGGAGCAGGATCGCCACC-3'

3'RACE sense primers：5'- GCTGGATGCTATCCACGTGATGTCG-3'

3'RACE anti-sense primers：5'- CGCTACGTAACGGCATGACAGTG(T)₁₈-3'

（3）, gypsymoth total serum IgE acquisition

The concrete operation step for extracting total serum IgE is carried out according to the specification of TaKaRa Trizol kits；

（4）, the chains of gypsymoth cDNA first synthesis

The operating procedure of the synthesis of the chains of cDNA first is with reference to PrimeScriptTM RT reagent Kit with gDNA The specification of Eraser kits is carried out；

（5）, PCR amplification

Using the above-mentioned chains of cDNA first as template, performing PCR is entered using degenerated primers and RACE primers according to Taq enzyme specification successively Amplification, the fragment expanded is further cloned, is sequenced；

（6）, sequence analysis

Obtained sequence is analyzed using ExPASy, and sequence homology comparison is carried out using BLAST functions in NCBI websites, Determine that obtained genetic fragment is the gene of gypsymoth chitinase 5, its nucleotide sequence such as SEQ ID NO：Shown in 1；

2nd, according to the nucleotide sequence of the gene of gypsymoth chitinase 5 of acquisition, design upstream primer sequence is SEQ ID NO： 3, downstream primer sequence is SEQ ID NO：4；The restructuring of the gene of gypsymoth chitinase 5 of step 1 acquisition will be successfully connected PEASY-T1 plasmids obtain the gene lethal fragment of chitinase 5, its nucleotide sequence such as SEQ ID as template, PCR amplifications NO：Shown in 2, purified using MicroElute Cycle Pure Kit kits.

A kind of 3. dsRNA of the gene lethal fragment of chitinase 5 synthesis of gypsymoth according to claim 1.

4. the dsRNA using the synthesis of the gene lethal fragment of gypsymoth chitinase 5 described in claim 3 waves poison in lethal insect Application in moth.