CN111349646A - Recombinant plasmid for expressing high-temperature-resistant pullulanase and construction method and application thereof - Google Patents

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to a recombinant plasmid for expressing high-temperature resistant pullulanase, a construction method and application thereof. The recombinant plasmid pNCM02-KOD-PULU-SG structure comprises the following base sequence fragments arranged from upstream to downstream: A. artificially synthesizing the obtained KOD-PULU-SG gene fragment; a RepB replicon; nmr neomycin resistance expression element; ampr ampicillin-resistant expression elements; an ori replicon. In the invention, a new recombinant plasmid is constructed for the first time and is introduced into brevibacillus brevis to obtain recombinant genetic engineering bacteria, and the pullulanase activity expressed by the obtained recombinant brevibacillus brevis reaches 47.1U/mL. The recombinant brevibacillus brevis is used in fermentation, so that the fermentation efficiency of the high-temperature resistant pullulanase can be greatly improved, the cost of starch processing is effectively reduced, and the application prospect in the food industry is wide.

Description

Recombinant plasmid for expressing high-temperature-resistant pullulanase and construction method and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a recombinant plasmid for expressing high-temperature resistant pullulanase, a construction method and application thereof.

Background

Pullulanase (Pullulanase, EC 3.2.1.41) is a Pullulanase which, in the classification, is classified as Pullulanase (types I and II) or Pullulanase (types I, II and III). Pullulanase (types I and II) only hydrolyzes α -1,6 bonds in amylopectin, but not α -1,4 bonds in the substrate. Pullulanase (types I and II) only hydrolyzes α -1,4 bonds in amylopectin, but not α -1,6 bonds in this glucan the end product of the hydrolysis may be panose (in the case of type I of hydrolase in pullulan) or isoperaose (in the case of type II Pullulanase). Pullulanase is a unique enzyme capable of hydrolyzing α -1,4 and α -1,6 bonds in amylopectin, the final reaction product of which includes a mixture of trioses of maltotriose and maltose.

In the process of implementing the invention, the inventor finds that the prior art has at least the following problems:

pullulanase is frequently used in the food industry to improve the utilization efficiency of starch, thereby achieving a large number of applications. The main factors influencing the enzyme activity are temperature and pH value. The pullulanase has strong activity within the range of 55-65 ℃, wherein the temperature of 60 ℃ is the optimum temperature for degrading pullulan, the stability of the pullulanase is good when the temperature is lower than 70 ℃, the residual activity is more than 90%, and the enzyme activity begins to rapidly decline when the temperature is higher than 70 ℃. The optimum pH value is 5.0-6.0. Within the pH value range of 4.0-7.5, the stability of the pullulanase is high, the activity loss is less, and the residual activity of the pullulanase is more than 90%.

However, in the hydrolysis process of starch, the temperature and pH change greatly due to the complexity of the external environment. If a starch hydrolase with wider applicable temperature and pH value range can be developed or a large amount of microorganisms for efficiently producing the starch hydrolase can be developed, the application value is important.

Disclosure of Invention

The present invention has been made to solve the above problems.

The invention aims to provide a recombinant plasmid for expressing high-temperature resistant pullulanase, a construction method and application thereof, and also aims to provide a recombinant brevibacillus brevis containing the recombinant plasmid and a construction method thereof.

The purpose of the invention is realized by the following technical scheme:

the first aspect of the invention provides a recombinant plasmid pNCM02-KOD-PULU-SG for expressing high-temperature resistant pullulanase, wherein the structure of the recombinant plasmid pNCM02-KOD-PULU-SG comprises the following base sequence fragments arranged from upstream to downstream:

A. artificially synthesizing the obtained KOD-PULU-SG gene fragment;

a RepB replicon;

nmr neomycin resistance expression element;

ampr ampicillin-resistant expression elements;

an ori replicon;

wherein the base sequence of the KOD-PULU-SG gene obtained by artificial synthesis is shown in SEQ ID No. 1;

the base sequence of RepB is shown in SEQ ID No. 2;

the base sequence of the NmR neomycin resistance expression element is shown as SEQ ID No. 3;

the base sequence of the AmpR ampicillin resistance expression element is shown as SEQ ID No.4

The base sequence of ORI is shown in SEQ ID No. 5.

Wherein, the four base fragments are derived from a plasmid pNCM 02.

The base sequence of the plasmid pNCM02 is shown in SEQ ID No. 6.

The second aspect of the present invention provides a method for constructing the recombinant plasmid pNCM02-KOD-PULU-SG of the first aspect, which comprises the following steps:

(1) according to a high-temperature pullulanase sequence of Thermococcus kodakaraensis KOD1 strain published on NCBI, performing codon preference analysis on Brevibacillus brevis by using Jcat Codonadaptition Tool software to finally obtain an optimized KOD-PULU-SG gene base sequence, and artificially synthesizing to obtain the KOD-PULU-SG gene;

(2) amplifying the KOD-PULU-SG gene and the pNCM02 plasmid artificially synthesized in the step (1) by using polymerase chain reaction, eliminating a reaction template by using Dpn I enzyme after reaction, cleaning by using a DNA cleaning kit to obtain the amplified KOD-PULU-SG gene and the pNCM02 plasmid,

wherein the base sequence of the plasmid pNCM02 is shown as SEQ ID No. 6;

(3) and (3) performing a ligation reaction by using the amplified KOD-PULU-SG gene obtained in the step (2) and the pNCM02 plasmid by using a one-step-clone kit, transferring the ligated product into Escherichia coli DH5alpha competent cells, and screening a transformant for a recombinant strain by using an ampicillin resistance plate to obtain the recombinant plasmid pNCM 02-KOD-PULU-SG.

Preferably, wherein, in the step (1), the high temperature resistant pullulanase functional gene of Thermococcus kodakarensis KOD1 strain has been annotated before

https:// www.ncbi.nlm.nih.gov/protein/BAD85166.1, numbering: locus tagTK0977, GenBank accession No. BAD85166.1), the amino acid sequence of which is shown as SQE ID No.7, is optimized according to the preference of the short Bacillus brevis (Brevibacillus chloroshinensis) codon, a stop codon is added at the downstream, and the codon is artificially synthesized to obtain the base sequence of the KOD-PULU-SG gene,

the sequence of the gene coded in Brevibacillus brevis is shown as SQE ID No. 1.

Preferably, in the step (2), the process conditions are as follows:

1. the KOD-PULU-SG gene amplification method comprises the following steps: using Novowed company

Carrying out polymerase chain reaction by using the MaxSuper-Fidelity DNApolymerase kit, wherein primers used in the reaction are KPS-F and KPS-R, the sequences of the primers used in the reaction are respectively as follows, and the underlined parts are recombinant fragments:

an upstream primer KPS-F:

CTCCCATGGCTTTCGCTGCAGCAGGAAAAAAAGGAGGACTGCTGCTG；

a downstream primer KPS-R:

CACTATAATGCCGAAGCTTATCCTCTTTCCAGGATGATGATTCCG。

the polymerase chain reaction system is as follows:

system of	Volume,. mu.L
		PhantaMix	25
KPS-F	1
		KPS-R	1
KOD-PULU-SG template	1
		ddH2O	22
Total volume	50

Amplification conditions of 1, performing pre-denaturation at 95 ℃ for 10min in the first step, 2, performing denaturation at 95 ℃ for 15S in the second step, performing annealing at 55 ℃ for 15S, and extending at 72 ℃ for 2min, and 3, repeating the second step for 32 cycles; 4. the third step is to fill the tail end for 10min at 72 ℃; 5. cooling to 4 ℃ until the reaction is completed; adding Fastdigest Dpn I enzyme to eliminate the reaction template;

the Dpn I enzyme digestion reaction system is as follows:

system of	Volume,. mu.L
		PCR reaction solution	43
FastDigetDpnI enzyme	2
		10XFastDigestBuffer	5
Total volume	50

After reacting for 1h, purifying DNA by using a DNA cleaning kit of Axygen company to finally obtain the amplified KOD-PULU-SG fragment 50uL of 126 ng/uL; the agarose gel electrophoresis picture of the KOD-PULU-SG fragment is shown in FIG. 1;

the amplification method of the plasmid pNCM02 comprises the following steps: using Novowed company

Carrying out polymerase chain reaction by using the MaxSuper-FidelityDNApolymerase kit, wherein primers used in the reaction are NC-F and NC-R, the sequences of the primers used in the reaction are respectively as follows, and the underlined parts are recombinant fragments:

NC-F：GATAAGCTTCGGCATTATAGTGCGGAGG；

NC-R：TCCTGCTGCAGCGAAAGCCATGGGAG；

the polymerase chain reaction system is as follows:

system of	Volume,. mu.L
		Phanta Mix	25
NC-F	1
		NC-R	1
pNCM02 plasmid	1
		ddH2O	22
Total volume	50

Amplification conditions 1. first step, performing pre-denaturation at 95 ℃ for 10 min; 2. second, denaturation at 95 ℃ for 15S, annealing at 55 ℃ for 15S, and extension at 72 ℃ for 4min, 3. repeating the second step for 32 cycles; 4. the third step is to fill the tail end for 10min at 72 ℃; 5. cooling to 4 ℃ until the reaction is completed; adding Fastdigest Dpn I enzyme to eliminate the reaction template;

the Dpn I enzyme digestion reaction system is as follows:

system of	Volume,. mu.L
		PCR reaction solution	43
FastDiget Dpn I enzyme	2
		10X FastDigest Buffer	5
Total volume	50

After 1 hour of the reaction, DNA was purified using a DNA clean-up kit from Axygen corporation to obtain 119ng/uL of pNCM02 plasmid 50uL, and the agarose gel electrophoresis pattern of the pNCM02 plasmid is shown in FIG. 2.

Preferably, in step (3), the amplified KOD-PULU-SG fragment and the pNCM02 plasmid are ligated by the following method:

(1) using Novowed company

One Step Cloning Kit, the reaction system is as follows:

(2) reacting at 37 ℃ for 30min to obtain a recombinant product of the pNCM02 plasmid and the KOD-PULU-SG fragment, namely a ligation product;

(3) chemically converting the prepared frozen escherichia coli DH5 α cells into competent cells, putting the competent cells on ice, adding 20 mu L of the ligation product obtained in the step (2), mixing, and standing for 25min to obtain a mixture;

(4) putting the mixture prepared in the step (3) into a water bath kettle at 42 ℃ for 90s by heat shock, putting back on ice and standing for 5 min;

(5) adding the mixture treated in the step (4) into 700 mu L of LB culture medium, recovering the mixture on a shaking table with the speed of 220rpm at the temperature of 37 ℃ for 1h, and coating an ampicillin resistant plate, wherein the LB culture medium comprises the following components: 5g/L yeast powder, 10g/L peptone and 10g/L NaCl;

(6) and (3) after the mixture processed in the step (5) is used as a monoclonal stamp, the primers KPS-F and KPS-R are used for verifying positive colonies, finally, successfully-connected recombinant colonies of the pNCM02-KOD-PULU-SG plasmid are screened out, DNA sequencing is carried out to ensure the correctness of an expression sequence, and a plasmid map is shown in figure 3.

(7) Culturing the recombinant colony screened in the step (6), and extracting to obtain the recombinant plasmid pNCM 02-KOD-PULU-SG.

In a fourth aspect, the present invention provides a bacterium comprising the recombinant plasmid pNCM02-KOD-PULU-SG according to the first aspect of the present invention.

In a fifth aspect, the present invention provides a method for constructing a bacterium according to the fourth aspect, comprising the steps of:

and (3) electrically transforming the recombinant plasmid pNCM02-KOD-PULU-SG into Brevibacillus brevis SP3 to obtain the recombinant Brevibacillus brevis.

Preferably, the construction method of the bacterium comprises the following steps:

(1) adding the recombinant plasmid pNCM02-KOD-PULU-SG into competent cells of Brevibacillus brevis SP3, gently mixing uniformly, and carrying out ice bath for 10min to obtain a mixture;

(2) setting a parameter voltage of 1.8KV, and setting a pulse time of 6ms, transferring the mixture obtained in the step (1) into an electric transfer cup for electric transfer, and then adding an electric transfer repair culture medium to obtain an electric-transferred bacterial liquid;

(3) transferring the electro-transformed bacterial liquid obtained in the step (2) to an EP (EP) tube, and putting the EP tube into a shaking table for resuscitation for 1h, wherein the working conditions of the shaking table are as follows: 37 ℃ at 220 rpm;

(4) and (4) carrying out centrifugal treatment on the bacterial liquid obtained in the step (3), wherein the centrifugal operation conditions are as follows: 5000rpm for 3min, then spreading the bacillus brevis to a G7 solid culture medium containing 10 mug/ml neomycin, and putting the bacillus brevis into a cell culture box at 37 ℃ for culture to obtain the recombinant brevibacillus brevis;

wherein,

the composition of the G7 liquid medium was as follows: 1.0 wt% of glucose, 1.0 wt% of peptone, 0.5 wt% of beef extract, 0.2 wt% of yeast extract and pH 7.0;

the G7 solid culture medium in the step (4) is the G7 liquid culture medium added with 2 wt% agar powder;

when preparing the electrotransformation competent cells, the cells are reselected and washed by using the sterilized deionized water.

The components of the electrotransformation repair culture medium in the step (2) are as follows: adding 20mM MgCl into the G7 liquid culture medium₂。

In a sixth aspect, the invention provides a preparation comprising a bacterium according to the fourth aspect of the invention.

In a seventh aspect, the invention provides the use of a bacterium according to the fourth aspect of the invention in the fields of fermentation, starch processing, and high temperature resistant pullulanase production.

In the present invention, only KOD-PULU-SG gene fragments and base sequences, cells, bacteria and the like containing the gene fragments are obtained by artificial synthesis in the present invention. The KOD-PULU-SG gene fragment synthesis method is characterized in that the KOD-PULU-SG gene fragment synthesis method is used for synthesizing a base sequence of a KOD-PULU-SG gene obtained by software optimization through a conventional technical means.

The pNCM02 plasmid, Brevibacillus brevis, Escherichia coli, polymerase chain reaction kit, enzyme and the like used in the invention can be purchased from the market.

The design of primers and the addition of restriction sites are conventional technical means in the field, and are not described herein again.

The pNCM02 plasmid: is shuttle plasmid, when expressed in colibacillus cell, makes the recombinant colibacillus strain have ampicillin resistance; when expressed in Brevibacillus brevis, the recombinant Brevibacillus brevis strain is endowed with neomycin resistance.

A monoclonal seal: and selecting and transferring the wild single colony in the culture medium to a target resistance plate to obtain a positive monoclonal strain with target resistance.

Brevibacillus brevis or Brevibacillus brevis SP3 herein is Brevibacillus choshinensis SP 3.

As used herein, the following terms shall have the following meanings:

"polymerase chain reaction": PCR is a reaction in which DNA is denatured at a high temperature of 95 ℃ in vitro to become a single strand, a primer and the single strand are bound at a low temperature (usually about 60 ℃) in accordance with the principle of base complementary pairing, the temperature is adjusted to the optimum reaction temperature (about 72 ℃) for DNA polymerase, and the DNA polymerase synthesizes a complementary strand in the direction from phosphate to pentose (5 '-3').

"plasmid": an isolated DNA molecule that is present outside the bacterial chromosome.

"competent cell": refers to cells in a physiological state capable of absorbing foreign DNA.

"transformation": this refers to a process of introducing foreign DNA into bacteria for expression.

"transformants": the host bacterium takes up the DNA fragment of the expression vector and combines it into its own genome to obtain a partial genetic trait of the expression vector, and the transformed host bacterium is called a transformant (transformant).

"expression vector": the DNA molecule is a kind of DNA molecule which can bring the target DNA segment into host bacteria, amplify and express, and is usually plasmid.

As used herein, the following english abbreviations shall have the following meanings:

dNTP deoxyribonucleoside triphosphates including dATP, dGTP, dTTP, dCTP

DNA deoxyribonucleic acid

ddH2O double distilled water

Marker molecular weight standard

kDa kilodalton

rpm rotation/min

In carrying out the present invention, the applicant has found that:

thermococcus kodakarensis KOD1 is an anaerobic hyperthermophile, a strain belonging to the order Pyrococcales, the genus Thermococcus, which was found in hot springs by professor in 1993 in the vicinity of the island of the deer in Japan, and which is most suitable for growth at 85 ℃ at a pH of 6.5, and its complete genome information is disclosed (GenBank accession No. AP006878), and in the data, a number of enzymes associated with starch hydrolysis are included, such as α -amylase, 4- α -glucosyltransferase, cyclodextrin glucosyltransferase and pullulanase, all of which are thermophilic enzymes.

However, thermophilic microorganisms have harsh growth conditions and often require high temperatures and anaerobic environments. Meanwhile, thermophilic microorganisms have low yield of target proteins during growth, are not easy to separate, and are not suitable for large-scale enzyme production. Furthermore, since the mechanism of stability of thermophilic enzymes is not clear, the kinds of thermophilic enzymes are various and the actions of various enzymes are different. How to utilize the thermophilic microorganism still has problems, the method of the invention successfully utilizes the thermophilic microorganism and also obtains the following beneficial effects:

1. the invention constructs a new recombinant plasmid for the first time, and introduces the new recombinant plasmid into brevibacillus brevis to obtain recombinant genetic engineering bacteria, and the activity of the high-temperature resistant pullulanase expressed by the obtained recombinant brevibacillus brevis reaches 47.1U/mL. The optimal temperature of the enzyme is 90 ℃, and the optimal pH value ranges from 3.0 to 8.5, so the enzyme has strong acid resistance and thermal stability. The recombinant brevibacillus brevis is used in fermentation, so that the fermentation efficiency of the high-temperature resistant pullulanase can be greatly improved, the cost of starch processing is effectively reduced, and the application prospect in the food industry is wide.

2. The invention uses the Brevibacillus brevis protein expression platform for expressing the pullulanase of Thermococcus kodakarensissiso KOD1 for the first time. The invention firstly takes the Thermococcus kodakarensis KOD1 as a research object, uses Brevibacillus brevis to express the pullulanase of the Thermococcus kodakarensis KOD1, spans species, and finally expresses the high-temperature resistant pullulanase with enzyme activity after optimizing the codon of the pullulanase. In addition, the brevibacillus brevis is gram-positive bacteria, so endotoxin cannot be generated in the production and fermentation processes, the safety is good, and the protein secretion is efficient, so that the brevibacillus brevis has a huge application prospect in the food processing industry.

3. The invention selects high temperature resistant pullulanase expressed by Thermococcus kodakarensis KOD1, which is a III type pullulanase, and consists of 751 amino acids, the molecular weight is 84kDa, the optimal temperature is 90 ℃, the optimal pH value range is 3.0-8.5, and the half-life period is 45min at 100 ℃, thereby having better thermal stability and being suitable for the requirements of industrial application. Optimizing the encoding codon of the enzyme aiming at the codon preference of the brevibacillus brevis, constructing a recombinant strain, and carrying out shake flask fermentation production. The activity of the high-temperature resistant pullulanase expressed by the recombinant Brevibacillus brevis at the pH value of 4.2 and the temperature of 90 ℃ reaches 47.1U/mL.

Drawings

FIG. 1 shows KOD-PULU-SG gene amplification, nucleic acid electrophoresis pattern: 1 is DNAmarker lane, and 2 is KOD-PULU-SG gene lane.

FIG. 2 is a diagram of pNCM02 plasmid amplification, nucleic acid electrophoresis: the lane 1 is DNAmarker, and the lane 2 is pNCM02 plasmid gene.

FIG. 3 is a schematic diagram showing the construction relationship of the plasmid pNCM02-KOD-PULU-SG according to the present invention.

FIG. 4 is a graph showing the change in enzyme activity of the thermostable pullulanase described in example 4 with the lapse of fermentation time.

FIG. 5 is the protein electrophoresis chart of the pullulanase bacterial liquid in example 4, wherein a band of the high temperature resistant acidic pullulanase is shown at 84kDa in lane 1, and a protein electrophoresis Marker is shown in lane 2.

Detailed Description

The present invention will be further illustrated by the following detailed description of specific embodiments, but it should be understood that it is not intended to limit the technical solutions of the present invention.

The experimental procedures not specified in the following examples are generally carried out under conventional conditions, for example, as described in molecular cloning, A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989). The test methods described in the following examples are all conventional methods unless otherwise specified; the reagents or consumables, if not specified, are commercially available.

A recombinant plasmid pNCM02-KOD-PULU-SG for expressing high-temperature resistant pullulanase, wherein the structure of the recombinant plasmid pNCM02-KOD-PULU-SG comprises the following base sequence fragments arranged from upstream to downstream:

A. artificially synthesizing the obtained KOD-PULU-SG gene fragment;

a RepB replicon;

nmr neomycin resistance expression element;

ampr ampicillin-resistant expression elements;

an ori replicon;

wherein the base sequence of the KOD-PULU-SG gene obtained by artificial synthesis is shown in SEQ ID No. 1;

the base sequence of RepB is shown in SEQ ID No. 2;

the base sequence of the AmpR ampicillin resistance expression element is shown in SEQ ID No. 4;

the base sequence of the NmR neomycin resistance expression element is shown as SEQ ID No. 3;

the base sequence of ORI is shown in SEQ ID No. 5.

Wherein, the four base fragments are derived from a plasmid pNCM 02.

The base sequence of the plasmid pNCM02 is shown in SEQ ID No. 6.

Example 2

The method for constructing the recombinant plasmid pNCM02-KOD-PULU-SG described in example 1, which comprises the following steps:

first step, gene optimization synthesis of high temperature resistant pullulanase

Obtaining a high-temperature resistant pullulanase gene: functional genes of thermostable pullulanase of Thermococcus kodakarensis KOD1 strain have been previously annotated (locus tag TK0977, GenBank accession No. BAD85166.1), and the amino acid sequence thereof is shown as SQE ID No. 7.

By optimizing the codon preference of Brevibacillus brevis and adding a stop codon at the downstream, a KOD-PULU-SG gene fragment was obtained, and the sequence of the gene encoded in Brevibacillus brevis is shown in SQE ID No. 1. And carrying out artificial synthesis on codons according to the KOD-PULU-SG gene segment.

The artificial synthesis of gene fragments is a well-known technique and is not described herein.

Second step, construction and transformation of expression vector of high-temperature resistant neutral pullulanase

KOD-PULU-SG gene fragment amplification reaction: performing polymerase chain reaction on the KOD-PULU-SG sequence, wherein primers used for the reaction are KPS-F and KPS-R, and the sequences of the primers used for the reaction are respectively as follows, wherein the underlined part is a recombinant fragment: :

an upstream primer KPS-F:

CTCCCATGGCTTTCGCTGCAGCAGGAAAAAAAGGAGGACTGCTGC-TG；

a downstream primer KPS-R:

CACTATAATGCCGAAGCTTATCCTCTTTCCAGGATGATGATTCCG。

using Novowed company

The Max Super-Fidelity DNApolymerase kit was used in the following polymerase chain reaction system:

system of	Volume (μ L)
		PhantaMix	25
KPS-F	1
		KPS-R	1
KOD-PULU-SG template	1
		ddH2O	22
Total volume	50

Amplification conditions of 1, first step of pre-denaturation at 95 ℃ for 10min, 2, second step of denaturation at 95 ℃ for 15S, annealing at 55 ℃ for 15S, extension at 72 ℃ for 2min, and 3, repeating the second step for 32 cycles. 4. And the third step is to fill the tail end for 10min at 72 ℃. 5. Cooling to 4 ℃ until the reaction is completed. The elimination of the reaction template was carried out by adding FastDiget Dpn I enzyme.

The Dpn I enzyme digestion reaction system is as follows:

system of	Volume (μ L)
		PCR reaction solution	43
FastDigest Dpn I	2
		10X FastDigest Buffer	5
Total volume	50

After 1 hour of reaction, DNA was purified using a DNA clean kit from Axygen, to obtain 50uL of KOD-PULU-SG fragment at 126 ng/uL. The agarose gel electrophoresis pattern of the fragment is shown in FIG. 1.

pNCM02 plasmid amplification reaction: sources of pNCM02 plasmid: purchased from Takara Bio Inc., Japan. The pNCM02 plasmid sequence used was that of Novozan

Max Super-Fidelity DNApolymerase kit polymerase chain reaction, wherein primers used for the reaction are NC-F and NC-R, the sequences of the primers used for the reaction are respectively as follows, wherein the underlined parts are recombinant fragments:

NC-F：GATAAGCTTCGGCATTATAGTGCGGAGG；NC-R：TCCTGCTG-CAGCGAAAGCCATGGGAG

the polymerase chain reaction system is as follows:

system of	Volume (μ L)
		Phanta Mix	25
NC-F	1
		NC-R	1
pNCM02 plasmid	1
		ddH2O	22
Total volume	50

Amplification conditions of 1, first step of pre-denaturation at 95 ℃ for 10min, 2, second step of denaturation at 95 ℃ for 15S, annealing at 55 ℃ for 15S, and extension at 72 ℃ for 4min, and 3, repeating the second step for 32 cycles. 4. And the third step is to fill the tail end for 10min at 72 ℃. 5. Cooling to 4 ℃ until the reaction is completed.

The elimination of the reaction template was carried out by adding FastDiget Dpn I enzyme. The Dpn I enzyme digestion reaction system is as follows:

system of	Volume (μ L)
		PCR reaction solution	43
FastDigest Dpn I	2
		10X FastDigest Buffer	5
Total volume	50

After 1 hour of reaction, DNA was purified using a DNA clean kit from Axygen to obtain 119ng/uL of pNCM02 fragment 50 uL. The agarose gel electrophoresis pattern of the fragment is shown in FIG. 2.

Ligation of pNCM02-KOD-PULU-SG plasmid

(1) Use ofOf Novovozan Co

One Step Cloning Kit, the reaction system is as follows:

(2) reacting at 37 ℃ for 30min to obtain a fragment recombinant product.

(3) Prepared frozen escherichia coli DH5 α cells are added with CaCl₂The method comprises preparing competent cells, placing on ice, adding 20 μ L ligation product, mixing, and standing for 25min, wherein the source of Escherichia coli DH5 α cell strain is biological engineering (Shanghai) GmbH.

(4) The sample was placed in a 42 ℃ water bath for 90s with heat shock and placed back on ice for 5 min.

(5) Add 700. mu.L LB medium (5g/L yeast powder, 10g/L peptone, 10g/L NaCl) and resuscitate on a shaker at 37 ℃ and 220rpm for 1 h. Amp zymogen resistant plates were coated.

(6) After a monoclonal stamp is made, the primers KPS-F and KPS-R are used for verifying positive colonies, finally, successfully-connected recombinant colonies of the pNCM02-KOD-PULU-SG plasmid are screened out, and DNA sequencing is carried out to ensure the correctness of an expression sequence.

(7) Culturing the recombinant bacterial colony, and extracting to obtain the recombinant plasmid pNCM 02-KOD-PULU-SG.

FIG. 3 is a schematic diagram showing the construction relationship of the plasmid pNCM 02-KOD-PULU-SG.

Wherein, P2 promoter represents a promoter for gene transcription.

Example 3

A method for constructing a bacterium comprising the recombinant plasmid pNCM02-KOD-PULU-SG described in example 1, said method comprising the steps of:

first step, preparation of the culture Medium

(1) Preparation of G7 seed Medium

Liquid culture medium comprising glucose 1.0%, peptone 1.0%, beef extract 0.5%, yeast extract 0.2%, and pH7.0;

(2) the G7 solid culture medium is G7 liquid culture medium added with 2% agar powder.

(3) Neomycin resistance selection medium was G7 solid medium supplemented with 10ug/ml neomycin.

(4) The fermentation medium of G7 is glucose 1.0%, peptone 1.0%, beef extract 0.5%, yeast extract 0.2%, pH 7.0; MnSO40.001% (w/v, same below), FeSO40.0001%, ZnSO40.0001%

(5) When preparing the electrotransformation competent cells, the cells are reselected and washed by using the sterilized deionized water.

(6) G7 seed culture medium added with 20mM MgCl₂。

Second step, preparation of competent cells of Brevibacillus brevis SP3

The Brevibacillus brevis SP3 is derived from: purchased from Takara Bio Inc., Japan.

(1) The Bacillus brevis SP3 was streaked on a G7 solid medium plate and cultured in an inverted state at 37 ℃ for 12 hours.

(2) Culturing a seed solution: the Brevibacillus brevis SP3 single colony obtained in the step (1) is selected and inoculated in 3ml G7 seed culture medium, and cultured overnight at 37 ℃ and 220 rpm.

(3)30ml of G7 seed medium was added with 300. mu.L of the overnight-cultured Brevibacillus brevis SP3 obtained in step (2), and cultured at 37 ℃ and 220rpm for 3 hours until the OD600 became 0.8. Precooling at 4 ℃ for 20min, centrifuging at 5000rpm for 10min, and removing the supernatant culture medium to obtain a bacterial liquid.

(4) And (4) adding 30mL of precooled sterilized deionized water into the bacterial liquid obtained in the step (3), slowly resuspending the thalli, centrifuging at 4 ℃ and 5000rpm for 10min, and removing the supernatant culture medium to obtain the bacterial liquid.

(5) And (5) repeating the step (4) for three times, adding 3mL of sterilized ionized water for resuspension, and subpackaging each 80 mu L into 1.5mL of EP tube to obtain the bacterial liquid containing the competent cells of the brevibacillus brevis SP 3.

Thirdly, the recombinant plasmid pNCM02-KOD-PULU-SG is electrically transferred into Brevibacillus brevis SP3

(1)80 μ L Brevibacillus brevis SP3 competent cells were added with 10 μ L recombinant plasmid pNCM02-KOD-PULU-SG, mixed gently and ice-cooled for 10 min.

(2) Setting the parameter voltage to be 1.8KV, setting the pulse time to be 6ms, transferring the sample into a 1mm electric rotating cup for electric rotation, and immediately adding 700 mu L of electric rotation repairing culture medium.

(3) Transferring the electro-transformed bacterial liquid into a 1.5mL EP tube, putting the EP tube into the EP tube, and recovering the bacterial liquid for 1h by a shaking table at 37 ℃ and 220 rpm;

(4) after 1 hour, the bacterial liquid in the EP tube is centrifuged at 5000rpm for 3min, and is coated on a G7 solid culture medium plate containing 10 mu G/ml neomycin, namely a neomycin resistance screening culture medium plate, and is put into a cell culture box at 37 ℃ for culture, so that a monoclonal cell of the recombinant Brevibacillus brevis SP3, namely the bacterium containing the recombinant plasmid pNCM02-KOD-PULU-SG, is obtained.

Fourthly, PCR identification of monoclonal colonies of bacteria containing the recombinant plasmid pNCM02-KOD-PULU-SG

(1) And (3) carrying out cell colony stamping on the monoclonal cells in the neomycin resistance screening culture medium plate, and transferring the cells into a new neomycin resistance screening culture medium plate.

(2) After 12 hours, the edges of the single colonies obtained in step (1) were selected for PCR and verified. Confirming that the recombinant plasmid pNCM02-KOD-PULU-SG is successfully transferred into the Brevibacillus brevis to obtain the recombinant Brevibacillus brevis.

Example 4

An activity determination method for expressing pullulanase by recombinant brevibacillus brevis SP3 comprises the following steps:

first, seed culture Medium is inoculated

A single colony of recombinant Brevibacillus brevis was picked from the neomycin-resistant selection medium plate of example 3 and inoculated into 3mL G7 seed culture medium containing neomycin 10. mu.g/mL, followed by shake cultivation at 37 ℃ and 220rpm for 12 hours.

Secondly, fermenting the strains for producing the high-temperature resistant pullulanase

1mL of the seed medium was transferred into three flasks containing 50mL of the inoculum, and a fermentation experiment was carried out for 72 hours with the addition of 10. mu.g/mL neomycin. Every 8 hours, the enzyme activity of the high-temperature resistant pullulanase in the bacterial liquid is detected, and is shown in figure 4. When the fermentation is carried out for 32 hours, the temperature is 90 ℃, the pH value is 4.2, and the expressed high-temperature resistant pullulanase has the highest enzyme activity of 47.1U/mL. And simultaneously carrying out protein electrophoresis on the pullulanase bacterial liquid collected for 32h, wherein a high-temperature-resistant acidic pullulanase band is arranged at 84kDa in a lane 1 as shown in figure 5. Lane 2 is a protein electrophoresis Marker.

The enzyme activity determination method of the high-temperature resistant pullulanase comprises the following steps: and (3) measuring the activity of the high-temperature resistant pullulanase by adopting a spectrophotometry method.

(1) Numbering test tubes from a clean test tube, preparing a glucose concentration gradient solution, adding 0, 0.2, 0.4, 0.6, 0.8, 1.0, 1.2 and 1.4mL of 0.1 percent glucose solution into the test tube, adding deionized water until the total volume is 2.0mL, adding 3mL of 3, 5-dinitrosalicylic acid (DNS reagent) into the test tube, boiling for 15min, immediately adding 10mL of deionized water, precooling, carrying out colorimetric measurement at the wavelength of 550nm by using a spectrophotometer, and drawing a glucose standard curve.

(2) The 3, 5-dinitrosalicylic acid method (DNS method) is adopted, and the reaction system is as follows: 1.0mL of 0.5% pullulanose solution is added with 1.0mL of acetic acid-sodium acetate buffer solution with pH of 4.2, 1.0mL of bacterial liquid (a control group is 1.0mL of blank G7 culture medium) containing high-temperature resistant pullulanase in a shake flask obtained by fermenting the solution in the step 1 every 8 hours is added, the mixture is subjected to water bath in a water bath kettle at the temperature of 90 ℃ for 30min, 3.0mL of 3, 5-dinitrosalicylic acid is added, the mixture is subjected to boiling water bath for 10min, the mixture is taken out and cooled by running water, and the light absorption value is measured at the wavelength of 550 nm. And (3) then, calculating enzyme activity according to the glucose standard curve in the step (1).

One unit of enzyme activity is defined as: under the above reaction conditions, the amount of enzyme required for decomposing pullulan per minute to release 1. mu. mol of glucose was expressed as 1 enzyme activity unit in U/mL.

In conclusion, the recombinant Brevibacillus brevis SP3 strain can realize the heterologous expression of the high-temperature resistant pullulanase in the KOD1 strain. The recombinant strain has high application value in the fermentation production of the high-temperature resistant pullulanase. Meanwhile, the idea is widened for the starch deep processing technology.

It should be understood that equivalents and modifications of the technical solution and inventive concept thereof may occur to those skilled in the art, and all such modifications and alterations should fall within the scope of the appended claims.

Sequence listing

<110> silver Xeno Biotech Co., Ltd

<120> recombinant plasmid for expressing high-temperature resistant pullulanase and construction method and application thereof

<130>RIB2020

<160>7

<170>SIPOSequenceListing 1.0

<210>1

<211>2298

<212>DNA

<213> Artificial sequence ()

<400>1

ggaaaaaaag gaggactgct gctgatcctg ctgatcctgg tatccatcgc ttccggatgc 60

atctccgaat ccaacgaaaa ccaaactgct actgcttcca ctgtaccacc aacttccgta 120

actccatccc aatcctccac tccaactact tccacttcca cttacggacc atccgaaaga 180

actgaactga aactgccatc cgtaaactac actccaatct acgtaggaat cgaaaaagga 240

tgcccatccg gaagagtacc agtaaaattc acttacaacc caggaaacaa aactgtaaaa 300

tccgtatccc tgagaggatc cttcaacaac tggggagaat ggccaatgga actgaaaaac 360

ggaacttggg aaactactgt atgcctgaga ccaggaagat acgaatacaa atacttcatc 420

aacggacaat gggtaaaaga catgtccgac gacggaactg gaagaccata cgacccagac 480

gctgacgctt acgctccaga cggatacgga ggaaaaaacg ctgtaagagt agtagaagga 540

agagaagctt tctacgtaga attcgaccca agagacccag cttacctgtc catcgctgac 600

aaaagaactg tagtaagatt cgaagctaaa agagacactg tagaatccgc tgtactggta 660

actgaccacg gaaactacac tatgaaactg caagtatggt gggacttcgg agaaacttgg 720

agagctgaaa tgccagtaga accagctgac tactacatcc tggtaacttc ctccgacgga 780

ggaaaattcg ctgtactgaa cacttccgaa tccccattct tccacttcga cggagtagaa 840

ggattcccac aactggaatg ggtatccaac ggaatcactt accaaatctt cccagacaga 900

ttcaacaacg gaaacaaatc caacgacgct ctggctctgg accacgacga actgatcctg 960

aaccaagtaa acccaggaca accaatcctg tccaactggt ccgacccaat cactccactg 1020

cactgctgcc accaatactt cggaggagac atcaaaggaa tcactgaaaa actggactac 1080

ctgcaatccc tgggagtaac tatcatctac atcaacccaa tcttcctgtc cggatccgct 1140

cacggatacg acacttacga ctactacaga ctggacccaa aattcggaac tgaagacgaa 1200

ctgagagaat tcctggacga agctcacaga agaggaatga gagtaatctt cgacttcgta 1260

ccaaaccact gcggaatcgg aaacccagct ttcctggacg tatgggaaaa aggaaacgaa 1320

tccccatact gggactggtt cttcgtaaaa aaatggccat tcaaactggg agacggatcc 1380

gcttacgtag gatggtgggg attcggatcc ctgccaaaac tgaacactgc taaccaagaa 1440

gtaagagaat acctgatcgg agctgctctg cactggatcg aattcggatt cgacggaatc 1500

agagtagacg taccaaacga agtactggac ccaggaactt tcttcccaga actgagaaaa 1560

gctgtaaaag aaaaaaaacc agacgcttac ctggtaggag aaatctggac tctgtcccca 1620

gaatgggtaa aaggagacag attcgactcc ctgatgaact acgctctggg aagagacatc 1680

ctgctgaact acgctaaagg actgctgtcc ggagaatccg ctatgaaaat gatgggaaga 1740

tactacgctt cctacggaga aaacgtagta gctatgggat tcaacctggt agactcccac 1800

gacacttcca gagtactgac tgacctggga ggaggaaaac tgggagacac tccatccaac 1860

gaatccatcc aaagactgaa actgctgtcc actctgctgt acgctctgcc aggaactcca 1920

gtaactttcc aaggagacga aagaggactg ctgggagaca aaggacacta cgacgaacaa 1980

agatacccaa tccaatggga cactgtaaac gaagacgtac tgaaccacta cagagctctg 2040

gctgaactga gaaaaagagt accagctctg agatcctccg ctatgagatt ctacactgct 2100

aaaggaggag taatggcttt cttcagagga caccacgacg aagtactggt agtagctaac 2160

tcctggaaaa aaccagctct gctggaactg ccagaaggag aatggaaagt aatctggcca 2220

gaagacttct ccccagaact gctgagagga actgtagaag taccagctat cggaatcatc 2280

atcctggaaa gaggataa 2298

<210>2

<211>1005

<212>DNA

<213> Artificial sequence ()

<400>2

atgggggttt cttttaatat tatgtgtcct aatagtagca tttattcaga tgaaaaatca 60

agggttttag tggacaagac aaaaagtgga aaagtgagac cttggagaga aaagaaaatc 120

gctaatgttg attactttga acttctgcat attcttgaat ttaaaaaggc tgaaagagta 180

aaagattgtg ctgaaatatt agagtataaa caaaatcgtg aaacaggcga aagaaagttg 240

tatcgagtgt ggttttgtaa atccaggctt tgtccaatgt gcaactggag gagagcaatg 300

aaacatggca ttcagtcaca aaaggttgtt gctgaagtta ttaaacaaaa gccaacagtt 360

cgttggttgt ttctcacatt aacagttaaa aatgtttatg atggcgaaga attaaataag 420

agtttgtcag atatggctca aggatttcgc cgaatgatgc aatataaaaa aattaataaa 480

aatcttgttg gttttatgcg tgcaacggaa gtgacaataa ataataaaga taattcttat 540

aatcagcaca tgcatgtatt ggtatgtgtg gaaccaactt attttaagaa tacagaaaac 600

tacgtgaatc aaaaacaatg gattcaattt tggaaaaagg caatgaaatt agactatgat 660

ccaaatgtaa aagttcaaat gattcgaccg aaaaataaat ataaatcgga tatacaatcg 720

gcaattgacg aaactgcaaa atatcctgta aaggatacgg attttatgac cgatgatgaa 780

gaaaagaatt tgaaacgttt gtctgatttg gaggaaggtt tacaccgtaa aaggttaatc 840

tcctatggtg gtttgttaaa agaaatacat aaaaaattaa accttgatga cacagaagaa 900

ggcgatttga ttcatacaga tgatgacgaa aaagccgatg aagatggatt ttctattatt 960

gcaatgtgga attgggaacg gaaaaattat tttattaaag agtag 1005

<210>3

<211>772

<212>DNA

<213> Artificial sequence ()

<400>3

atgagaatag tgaatggacc aataataatg actagagaag aaagaatgaa gattgtccat 60

gaaattaagg aacgaatatt ggataaatat ggggatgatg ttaaggctat tggtgtttat 120

ggctctcttg gtcgtcagac tgatgggccc tattcggata ttgagatgat gtgtgtcatg 180

tcaacagagg aagcagagtt cagccatgaa tggacaaccg gtgagtggaa ggtggaagtg 240

aattttgata gcgaagagat tctactagat tatgcatctc aggtggaatc agattggccg 300

cttacacatg gtcaattttt ctctattttg ccgatttatg attcaggtgg atacttagag 360

aaagtgtatc aaactgctaa atcggtagaa gcccaaacgt tccacgatgc gatttgtgcc 420

cttatcgtag aagagctgtt tgaatatgca ggcaaatggc gtaatattcg tgtgcaagga 480

ccgacaacat ttctaccatc cttgactgta caggtagcaa tggcaggtgc catgttgatt 540

ggtctgcatc atcgcatctg ttatacgacg agcgcttcgg tcttaactga agcagttaag 600

caatcagatc ttccttcagg ttatgaccat ctgtgccagt tcgtaatgtc tggtcaactt 660

tccgactctg agaaacttct ggaatcgcta gagaatttct ggaatgggat tcaggagtgg 720

acagaacgac acggatatat agtggatgtg tcaaaacgca taccattttg aa 772

<210>4

<211>861

<212>DNA

<213> Artificial sequence ()

<400>4

atgagtattc aacatttccg tgtccccctt attccctttt ttgcggcatt ttgccttcct 60

gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca 120

cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc 180

gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc 240

cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg 300

gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta 360

tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc 420

ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt 480

gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg 540

cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct 600

tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc 660

tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct 720

cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac 780

acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc 840

tcactgatta agcattggta a 861

<210>5

<211>589

<212>DNA

<213> Artificial sequence ()

<400>5

ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc 60

agcggtggtt tgtttgccgg atcaagagct accaactctt tttccgaagg taactggctt 120

cagcagagcg cagataccaa atactgttct tctagtgtag ccgtagttag gccaccactt 180

caagaactct gtagcaccgc ctacatacct cgctctgcta atcctgttac cagtggctgc 240

tgccagtggc gataagtcgt gtcttaccgg gttggactca agacgatagt taccggataa 300

ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag cccagcttgg agcgaacgac 360

ctacaccgaa ctgagatacc tacagcgtga gctatgagaa agcgccacgc ttcccgaagg 420

gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga acaggagagc gcacgaggga 480

gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc acctctgact 540

tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc ctatggaaa 589

<210>6

<211>5225

<212>DNA

<213> Artificial sequence ()

<400>6

tgatccgaca taatggacag gtgaataacg aaccacgaaa aaaactttaa atttttttcg 60

aaggcgccgc aacttttgat tcgctcaggc gtttaatagg atgtaattgt gagcggataa 120

caattattct gcatggcttt cctgcgaaag gaggtgacac gcgcttgcag gattcgggct 180

ttaaaaagaa agatagatta acaacaaata ttccccaaga acaatttgtt tatactagag 240

gaggagaaca caaggtcatg aaaaaaagaa gggtcgttaa cagtgtattg cttctgctac 300

tgctagctag tgcactcgca cttactgttg ctcccatggc tttcgctgca ggatccgtcg 360

actctagact cgaggaattc ggtaccccgg gttcgaaatc gataagcttc ggcattatag 420

tgcggaggct ttttcgcatg caggtaggga acaattacat tgtctttgat tgtaaaaatg 480

ctgttgacag gacactaaat ggtgtcgtat tctcaaagta acaccatttg gtgtccaatt 540

gcaagtcatt tggtaacctt aattggatca gacaaggtaa aggataaaac agcacaattc 600

caagaaaaac acgatttaga acctaaaaag aacgaatttg aactaactca taaccgagag 660

gtaaaaaaag aacgaagtcg agatcaggga atgagtttat aaaataaaaa aagcacctga 720

aaaggtgtct ttttttgatg gttttgaact tgttctttct tatcttgata catatagaaa 780

taacgtcatt tttattttag ttgctgaaag gtgcgttgaa gtgttggtat gtatgtgttt 840

taaagtattg aaaaccctta aaattggttg cacagaaaaa ccccatctgt taaagttata 900

agtgactaaa caaataacta aatagatggg ggtttctttt aatattatgt gtcctaatag 960

tagcatttat tcagatgaaa aatcaagggt tttagtggac aagacaaaaa gtggaaaagt 1020

gagaccttgg agagaaaaga aaatcgctaa tgttgattac tttgaacttc tgcatattct 1080

tgaatttaaa aaggctgaaa gagtaaaaga ttgtgctgaa atattagagt ataaacaaaa 1140

tcgtgaaaca ggcgaaagaa agttgtatcg agtgtggttt tgtaaatcca ggctttgtcc 1200

aatgtgcaac tggaggagag caatgaaaca tggcattcag tcacaaaagg ttgttgctga 1260

agttattaaa caaaagccaa cagttcgttg gttgtttctc acattaacag ttaaaaatgt 1320

ttatgatggc gaagaattaa ataagagttt gtcagatatg gctcaaggat ttcgccgaat 1380

gatgcaatat aaaaaaatta ataaaaatct tgttggtttt atgcgtgcaa cggaagtgac 1440

aataaataat aaagataatt cttataatca gcacatgcat gtattggtat gtgtggaacc 1500

aacttatttt aagaatacag aaaactacgt gaatcaaaaa caatggattc aattttggaa 1560

aaaggcaatg aaattagact atgatccaaa tgtaaaagtt caaatgattc gaccgaaaaa 1620

taaatataaa tcggatatac aatcggcaat tgacgaaact gcaaaatatc ctgtaaagga 1680

tacggatttt atgaccgatg atgaagaaaa gaatttgaaa cgtttgtctg atttggagga 1740

aggtttacac cgtaaaaggt taatctccta tggtggtttg ttaaaagaaa tacataaaaa 1800

attaaacctt gatgacacag aagaaggcga tttgattcat acagatgatg acgaaaaagc 1860

cgatgaagat ggattttcta ttattgcaat gtggaattgg gaacggaaaa attattttat 1920

taaagagtag ttcaacaaac gggccagttt gttgaagatt agatgctata attgttatta 1980

aaaggattga aggatgctta ggaagacgag ttattaatag ctgaataaga acggtgctct 2040

ccaaatattc ttatttagaa aagcaaatct aaaattatct gaaaagggaa tgagaatagt 2100

gaatggacca ataataatga ctagagaaga aagaatgaag attgtccatg aaattaagga 2160

acgaatattg gataaatatg gggatgatgt taaggctatt ggtgtttatg gctctcttgg 2220

tcgtcagact gatgggccct attcggatat tgagatgatg tgtgtcatgt caacagagga 2280

agcagagttc agccatgaat ggacaaccgg tgagtggaag gtggaagtga attttgatag 2340

cgaagagatt ctactagatt atgcatctca ggtggaatca gattggccgc ttacacatgg 2400

tcaatttttc tctattttgc cgatttatga ttcaggtgga tacttagaga aagtgtatca 2460

aactgctaaa tcggtagaag cccaaacgtt ccacgatgcg atttgtgccc ttatcgtaga 2520

agagctgttt gaatatgcag gcaaatggcg taatattcgt gtgcaaggac cgacaacatt 2580

tctaccatcc ttgactgtac aggtagcaat ggcaggtgcc atgttgattg gtctgcatca 2640

tcgcatctgt tatacgacga gcgcttcggt cttaactgaa gcagttaagc aatcagatct 2700

tccttcaggt tatgaccatc tgtgccagtt cgtaatgtct ggtcaacttt ccgactctga 2760

gaaacttctg gaatcgctag agaatttctg gaatgggatt caggagtgga cagaacgaca 2820

cggatatata gtggatgtgt caaaacgcat accattttga acgatgacct ctaataattg 2880

ttaatcatgt tggttacgta tttattaact tctcctagta ttagtaatta tcatggctgt 2940

catggcgcat taacggaata aagggtgtgc ttaaatcggg cctgcatgac gaaagggcct 3000

cgtgatacgc ctatttttat aggttaatgt catgataata atggtttctt agacgtcagg 3060

tggcactttt cggggaaatg tgcgcggaac ccctatttgt ttatttttct aaatacattc 3120

aaatatgtat ccgctcatga gacaataacc ctgataaatg cttcaataat attgaaaaag 3180

gaagagtatg agtattcaac atttccgtgt cccccttatt cccttttttg cggcattttg 3240

ccttcctgtt tttgctcacc cagaaacgct ggtgaaagta aaagatgctg aagatcagtt 3300

gggtgcacga gtgggttaca tcgaactgga tctcaacagc ggtaagatcc ttgagagttt 3360

tcgccccgaa gaacgttttc caatgatgag cacttttaaa gttctgctat gtggcgcggt 3420

attatcccgt attgacgccg ggcaagagca actcggtcgc cgcatacact attctcagaa 3480

tgacttggtt gagtactcac cagtcacaga aaagcatctt acggatggca tgacagtaag 3540

agaattatgc agtgctgcca taaccatgag tgataacact gcggccaact tacttctgac 3600

aacgatcgga ggaccgaagg agctaaccgc ttttttgcac aacatggggg atcatgtaac 3660

tcgccttgat cgttgggaac cggagctgaa tgaagccata ccaaacgacg agcgtgacac 3720

cacgatgcct gtagcaatgg caacaacgtt gcgcaaacta ttaactggcg aactacttac 3780

tctagcttcc cggcaacaat taatagactg gatggaggcg gataaagttg caggaccact 3840

tctgcgctcg gcccttccgg ctggctggtt tattgctgat aaatctggag ccggtgagcg 3900

tgggtctcgc ggtatcattg cagcactggg gccagatggt aagccctccc gtatcgtagt 3960

tatctacacg acggggagtc aggcaactat ggatgaacga aatagacaga tcgctgagat 4020

aggtgcctca ctgattaagc attggtaact gtcagaccaa gtttactcat atatacttta 4080

gattgattta aaacttcatt tttaatttaa aaggatctag gtgaagatcc tttttgataa 4140

tctcatgacc aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag accccgtaga 4200

aaagatcaaa ggatcttctt gagatccttt ttttctgcgc gtaatctgct gcttgcaaac 4260

aaaaaaacca ccgctaccag cggtggtttg tttgccggat caagagctac caactctttt 4320

tccgaaggta actggcttca gcagagcgca gataccaaat actgttcttc tagtgtagcc 4380

gtagttaggc caccacttca agaactctgt agcaccgcct acatacctcg ctctgctaat 4440

cctgttacca gtggctgctg ccagtggcga taagtcgtgt cttaccgggt tggactcaag 4500

acgatagtta ccggataagg cgcagcggtc gggctgaacg gggggttcgt gcacacagcc 4560

cagcttggag cgaacgacct acaccgaact gagataccta cagcgtgagc tatgagaaag 4620

cgccacgctt cccgaaggga gaaaggcgga caggtatccg gtaagcggca gggtcggaac 4680

aggagagcgc acgagggagc ttccaggggg aaacgcctgg tatctttata gtcctgtcgg 4740

gtttcgccac ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct 4800

atggaaaaac gccagcaacg cggccttttt acggttcctg gccttttgct ggccatgcag 4860

gctgaataaa agatacgaga gacctctctt gtatcttttt tattttgagt ggttttgtcc 4920

gttacactag aaaaccgaaa gacaataaaa attttattct tgctgagtct ggctttcggt 4980

aagctagaca aaacggacaa aataaaaatt ggcaagggtt taaaggtgga gattttttga 5040

gtgatcttct caaaaaatac tacctgtccc ttgctgattt ttaaacgagc acgagagcaa 5100

aacccccctt tgctgaggtg gcagagggca ggtttttttg tttctttttt ctcgtaaaaa 5160

aaagaaaggt cttaaaggtt ttatggtttt ggtcggcact gccgacagcc tcgcagagca 5220

cacac 5225

<210>7

<211>766

<212>PRT

<213> anaerobic hyperthermophiles (Thermococcus kodakarensis KOD1)

<400>7

Met Gly Lys Lys Gly Gly Leu Leu Leu Ile Leu Leu Ile Leu Val Ser

1 5 10 15

Ile Ala Ser Gly Cys Ile Ser Glu Ser Asn Glu Asn Gln Thr Ala Thr

20 25 30

Ala Ser Thr Val Pro Pro Thr Ser Val Thr Pro Ser Gln Ser Ser Thr

35 40 45

Pro Thr Thr Ser Thr Ser Thr Tyr Gly Pro Ser Glu Arg Thr Glu Leu

50 55 60

Lys Leu Pro Ser Val Asn Tyr Thr Pro Ile Tyr Val Gly Ile Glu Lys

65 70 75 80

Gly Cys Pro Ser Gly Arg Val Pro Val Lys Phe Thr Tyr Asn Pro Gly

85 90 95

Asn Lys Thr Val Lys Ser Val Ser Leu Arg Gly Ser Phe Asn Asn Trp

100 105 110

Gly Glu Trp Pro Met Glu Leu Lys Asn Gly Thr Trp Glu Thr Thr Val

115 120 125

Cys Leu Arg Pro Gly Arg Tyr Glu Tyr Lys Tyr Phe Ile Asn Gly Gln

130 135 140

Trp Val Lys Asp Met Ser Asp Asp Gly Thr Gly Arg Pro Tyr Asp Pro

145 150 155 160

Asp Ala Asp Ala Tyr Ala Pro Asp Gly Tyr Gly Gly Lys Asn Ala Val

165 170 175

Arg Val Val Glu Gly Arg Glu Ala Phe Tyr Val Glu Phe Asp Pro Arg

180 185 190

Asp Pro Ala Tyr Leu Ser Ile Ala Asp Lys Arg Thr Val Val Arg Phe

195 200 205

Glu Ala Lys Arg Asp Thr Val Glu Ser Ala Val Leu Val Thr Asp His

210 215 220

Gly Asn Tyr Thr Met Lys Leu Gln Val Trp Trp Asp Phe Gly Glu Thr

225 230 235 240

Trp Arg Ala Glu Met Pro Val Glu Pro Ala Asp Tyr Tyr Ile Leu Val

245 250 255

Thr Ser Ser Asp Gly Gly Lys Phe Ala Val Leu Asn Thr Ser Glu Ser

260 265 270

Pro Phe Phe His Phe Asp Gly Val Glu Gly Phe Pro Gln Leu Glu Trp

275 280 285

Val Ser Asn Gly Ile Thr Tyr Gln Ile Phe Pro Asp Arg Phe Asn Asn

290 295 300

Gly Asn Lys Ser Asn Asp Ala Leu Ala Leu Asp His Asp Glu Leu Ile

305 310 315 320

Leu Asn Gln Val Asn Pro Gly Gln Pro Ile Leu Ser Asn Trp Ser Asp

325 330 335

Pro Ile Thr Pro Leu His Cys Cys His Gln Tyr Phe Gly Gly Asp Ile

340 345 350

Lys Gly Ile Thr Glu Lys Leu Asp Tyr Leu Gln Ser Leu Gly Val Thr

355 360 365

Ile Ile Tyr Ile Asn Pro Ile Phe Leu Ser Gly Ser Ala His Gly Tyr

370 375 380

Asp Thr Tyr Asp Tyr Tyr Arg Leu Asp Pro Lys Phe Gly Thr Glu Asp

385 390 395 400

Glu Leu Arg Glu Phe Leu Asp Glu Ala His Arg Arg Gly Met Arg Val

405 410 415

Ile Phe Asp Phe Val Pro Asn His Cys Gly Ile Gly Asn Pro Ala Phe

420 425 430

Leu Asp Val Trp Glu Lys Gly Asn Glu Ser Pro Tyr Trp Asp Trp Phe

435 440 445

Phe Val Lys Lys Trp Pro Phe Lys Leu Gly Asp Gly Ser Ala Tyr Val

450 455 460

Gly Trp Trp Gly Phe Gly Ser Leu Pro Lys Leu Asn Thr Ala Asn Gln

465 470 475 480

Glu Val Arg Glu Tyr Leu Ile Gly Ala Ala Leu His Trp Ile Glu Phe

485 490 495

Gly Phe Asp Gly Ile Arg Val Asp Val Pro Asn Glu Val Leu Asp Pro

500 505 510

Gly Thr Phe Phe Pro Glu Leu Arg Lys Ala Val Lys Glu Lys Lys Pro

515 520 525

Asp Ala Tyr Leu Val Gly Glu Ile Trp Thr Leu Ser Pro Glu Trp Val

530 535 540

Lys Gly Asp Arg Phe Asp Ser Leu Met Asn Tyr Ala Leu Gly Arg Asp

545 550 555 560

Ile Leu Leu Asn Tyr Ala Lys Gly Leu Leu Ser Gly Glu Ser Ala Met

565 570 575

Lys Met Met Gly Arg Tyr Tyr Ala Ser Tyr Gly Glu Asn Val Val Ala

580 585 590

Met Gly Phe Asn Leu Val Asp Ser His Asp Thr Ser Arg Val Leu Thr

595 600 605

Asp Leu Gly Gly Gly Lys Leu Gly Asp Thr Pro Ser Asn Glu Ser Ile

610 615 620

Gln Arg Leu Lys Leu Leu Ser Thr Leu Leu Tyr Ala Leu Pro Gly Thr

625 630 635 640

Pro Val Thr Phe Gln Gly Asp Glu Arg Gly Leu Leu Gly Asp Lys Gly

645 650 655

His Tyr Asp Glu Gln Arg Tyr Pro Ile Gln Trp Asp Thr Val Asn Glu

660 665 670

Asp Val Leu Asn His Tyr Arg Ala Leu Ala Glu Leu Arg Lys Arg Val

675 680 685

Pro Ala Leu Arg Ser Ser Ala Met Arg Phe Tyr Thr Ala Lys Gly Gly

690 695 700

Val Met Ala Phe Phe Arg Gly His His Asp Glu Val Leu Val Val Ala

705 710 715 720

Asn Ser Trp Lys Lys Pro Ala Leu Leu Glu Leu Pro Glu Gly Glu Trp

725 730 735

Lys Val Ile Trp Pro Glu Asp Phe Ser Pro Glu Leu Leu Arg Gly Thr

740 745 750

Val Glu Val Pro Ala Ile Gly Ile Ile Ile Leu Glu Arg Gly

755 760 765

Claims (10)

1. A recombinant plasmid pNCM02-KOD-PULU-SG for expressing high-temperature resistant pullulanase, wherein the structure of the recombinant plasmid pNCM02-KOD-PULU-SG comprises the following base sequence fragments arranged from upstream to downstream:

A. artificially synthesizing the obtained KOD-PULU-SG gene fragment;

a RepB replicon;

nmr neomycin resistance expression element;

ampr ampicillin-resistant expression elements;

an ori replicon;

wherein the base sequence of the KOD-PULU-SG gene obtained by artificial synthesis is shown in SEQ ID No. 1;

the base sequence of RepB is shown in SEQ ID No. 2;

the base sequence of the AmpR ampicillin resistance expression element is shown in SEQ ID No. 4;

the base sequence of the NmR neomycin resistance expression element is shown as SEQ ID No. 3;

the base sequence of ORI is shown in SEQ ID No. 5.

2. A method for constructing the recombinant plasmid pNCM02-KOD-PULU-SG according to claim 1, which comprises the following steps:

(1) according to a high-temperature pullulanase sequence of Thermococcus kodakaraensis KOD1 strain published on NCBI, performing codon preference analysis on Brevibacillus brevis by using Jcat Codonadaptitation Tool software to finally obtain an optimized KOD-PULU-SG gene base sequence shown as SEQ ID No.1, and artificially synthesizing to obtain the KOD-PULU-SG gene;

(2) amplifying the KOD-PULU-SG gene and the pNCM02 plasmid artificially synthesized in the step (1) by using polymerase chain reaction, eliminating a reaction template by using Dpn I enzyme after reaction, and cleaning by using a DNA cleaning kit to obtain the amplified KOD-PULU-SG gene and a pNCM02 plasmid, wherein the base sequence of the pNCM02 plasmid is shown as SEQ ID No. 6;

(3) and (3) performing a ligation reaction by using the amplified KOD-PULU-SG gene obtained in the step (2) and the pNCM02 plasmid by using a one-step-clone kit, transferring the ligated product into Escherichia coli DH5alpha competent cells, and screening a transformant for a recombinant strain by using an ampicillin resistance plate to obtain the recombinant plasmid pNCM 02-KOD-PULU-SG.

3. The method according to claim 2, wherein in the step (1), the amino acid sequence of the thermostable pullulanase of Thermococcuskoda akarensis KOD1 is shown as SQE ID No.7, and the encoded gene sequence in Brevibacillus brevis is shown as SQE ID No.1, namely the optimized KOD-PULU-SG gene sequence, by optimizing according to the preference of Brevibacillus brevis chlorosis SP3 codon, adding a stop codon at the downstream and artificially synthesizing the codon.

4. The method of claim 2, wherein in step (2), the process conditions are as follows:

1. the KOD-PULU-SG gene amplification method comprises the following steps: using Novowed company

Max Super-Fidelity DNApolymerase kit is used for carrying out polymerase chain reaction, primers used in the reaction are KPS-F and KPS-R, sequences are respectively as follows

KPS-F：

CTCCCATGGCTTTCGCTGCAGCAGGAAAAAAAGGAGGACTGCTGCTG；

KPS-R：

CACTATAATGCCGAAGCTTATCCTCTTTCCAGGATGATGATTCCG。

The polymerase chain reaction system is as follows:

system of Volume,. mu.L PhantaMix 25 KPS-F 1 KPS-R 1 KOD-PULU-SG template 1 ddH₂O 22 Total volume 50

Amplification conditions of 1, performing pre-denaturation at 95 ℃ for 10min in the first step, 2, performing denaturation at 95 ℃ for 15S in the second step, performing annealing at 55 ℃ for 15S, and extending at 72 ℃ for 2min, and 3, repeating the second step for 32 cycles; 4. the third step is to fill the tail end for 10min at 72 ℃; 5. cooling to 4 ℃ until the reaction is completed; adding Fastdigest Dpn I enzyme to eliminate the reaction template;

the Dpn I enzyme digestion reaction system is as follows:

after reacting for 1h, purifying DNA by using a DNA cleaning kit of Axygen company to finally obtain the amplified KOD-PULU-SG fragment 50uL of 126 ng/uL; the agarose gel electrophoresis picture of the KOD-PULU-SG fragment is shown in FIG. 1;

2. the amplification method of the plasmid pNCM02 comprises the following steps: using Novowed company

Max Super-FidelityDNApolymerase kit is used for carrying out polymerase chain reaction, primers used in the reaction are NC-F and NC-R, and the sequences are respectively as follows:

NC-F：GATAAGCTTCGGCATTATAGTGCGGAGG；

NC-R：TCCTGCTG-CAGCGAAAGCCATGGGAG；

the polymerase chain reaction system is as follows:

system of Volume,. mu.L PhantaMix 25 NC-F 1 NC-R 1 pNCM02 plasmid 1 ddH₂O 22 Total volume 50

Amplification conditions 1. first step, performing pre-denaturation at 95 ℃ for 10 min; 2. second, denaturation at 95 ℃ for 15S, annealing at 55 ℃ for 15S, and extension at 72 ℃ for 4min, 3. repeating the second step for 32 cycles; 4. the third step is to fill the tail end for 10min at 72 ℃; 5. cooling to 4 ℃ until the reaction is completed; adding Fastdigest Dpn I enzyme to eliminate the reaction template;

the Dpn I enzyme digestion reaction system is as follows:

system of Volume,. mu.L PCR reaction solution 43 FastDigetDpnI enzyme 2 10XFastDigestBuffer 5 Total volume 50

After 1 hour of the reaction, DNA was purified using a DNA clean-up kit from Axygen corporation to obtain 119ng/uL of pNCM02 plasmid 50uL, and the agarose gel electrophoresis pattern of the pNCM02 plasmid is shown in FIG. 2.

5. The method of claim 2,

in step (3), the KOD-PULU-SG fragment and the pNCM02 plasmid after amplification are ligated by the following method:

(1) using Novowed company

II One Step Cloning Kit, the reaction system is as follows:

(2) reacting at 37 ℃ for 30min to obtain a recombinant product of the pNCM02 plasmid and the KOD-PULU-SG fragment, namely a ligation product;

(3) chemically converting the cryopreserved escherichia coli DH5 α cells into competent cells, putting the competent cells on ice, adding 20 mu L of the ligation product obtained in the step (2), mixing, and standing for 25min to obtain a mixture;

(4) putting the mixture prepared in the step (3) into a water bath kettle at 42 ℃ for 90s by heat shock, putting back on ice and standing for 5 min;

(5) adding the mixture treated in the step (4) into 700 mu L of LB culture medium, recovering the mixture on a shaking table at 37 ℃ and 220rpm for 1h, and coating an ampicillin resistant plate, wherein the LB culture medium comprises the following components: 5g/L yeast powder, 10g/L peptone and 10g/L NaCl;

(6) after the mixture processed in the step (5) is used as a monoclonal stamp, the primers KPS-F and KPS-R are used for verifying positive colonies, and finally, successfully-connected recombinant colonies of the pNCM02-KOD-PULU-SG plasmid are screened out;

(7) culturing the recombinant colony screened in the step (6), and extracting to obtain the recombinant plasmid pNCM 02-KOD-PULU-SG.

6. A bacterium comprising the recombinant plasmid pNCM02-KOD-PULU-SG according to claim 1.

7. The method of constructing bacteria according to claim 6, characterized in that it comprises the following steps:

and (3) electrically transforming the recombinant plasmid pNCM02-KOD-PULU-SG into Brevibacillus brevis SP3 to obtain the recombinant Brevibacillus brevis.

8. Construction method according to claim 7, characterized in that it comprises the following steps:

(1) adding the recombinant plasmid pNCM02-KOD-PULU-SG into competent cells of Brevibacillus brevis SP3, gently mixing uniformly, and carrying out ice bath for 10min to obtain a mixture;

(2) setting a parameter voltage of 1.8KV, and setting a pulse time of 6ms, transferring the mixture obtained in the step (1) into an electric transfer cup for electric transfer, and then adding an electric transfer repair culture medium to obtain an electric-transferred bacterial liquid;

(3) transferring the electro-transformed bacterial liquid obtained in the step (2) to an EP (EP) tube, and putting the EP tube into a shaking table for resuscitation for 1h, wherein the working conditions of the shaking table are as follows: 37 ℃ at 220 rpm;

(4) and (4) carrying out centrifugal treatment on the bacterial liquid obtained in the step (3), wherein the centrifugal operation conditions are as follows: 5000rpm for 3min, then spreading the bacillus brevis to a G7 solid culture medium containing 10 mug/ml neomycin, and putting the bacillus brevis into a cell culture box at 37 ℃ for culture to obtain the recombinant brevibacillus brevis;

wherein,

the composition of the G7 liquid medium was as follows: 1.0 wt% of glucose, 1.0 wt% of peptone, 0.5 wt% of beef extract, 0.2 wt% of yeast extract and pH 7.0;

the G7 solid culture medium in the step (4) is the G7 liquid culture medium added with 2 wt% agar powder;

when preparing the electrotransformation competent cells, the cells are reselected and washed by using the sterilized deionized water.

The components of the electrotransformation repair culture medium in the step (2) are as follows: adding 20mM MgCl into the G7 liquid culture medium₂。

9. A formulation comprising the bacterium of claim 6.

10. Use of the bacterium according to claim 6 in the fields of fermentation, starch processing, and high temperature resistant pullulanase production.

Images