CN115161333B - A reverse screening marker of Streptococcus suis, Streptococcus suis containing the reverse screening marker and application thereof - Google Patents

Abstract

The invention discloses a reverse screening marker of Streptococcus suis, Streptococcus suis containing the reverse screening marker and application thereof. The reverse screening is marked as the pheS gene encoding the α subunit of Streptococcus suis phenylalanine tRNA synthetase after mutation, and the mutated pheS gene leads to the α subunit of the encoded Streptococcus suis phenylalanine tRNA synthetase The T261S and A315G double substitution mutations occurred in the base, and the PheS mutant competed with the wild PheS protein of the strain itself, and misincorporated p-Cl-Phe into the synthesized protein during translation, so that p-Cl-Phe existed Under these conditions, the strain expressing the PheS mutant died, and the strain not expressing the PheS mutant survived. Utilizing this high-efficiency reverse screening marker, the present invention also establishes an efficient method for the traceless gene manipulation of Streptococcus suis, which is used to realize traceless gene manipulations such as deletion, gene fusion, and gene mutation of Streptococcus suis. The physiological and pathological mechanism of Streptococcus suis and the preparation of vaccine strains have good application prospects.

Description

A reverse screening marker of Streptococcus suis, pig chain containing the reverse screening marker Bacillus and its application

technical field

The invention relates to a reverse screening marker of Streptococcus suis, and also relates to Streptococcus suis containing the reverse screening marker and application thereof. The invention belongs to the field of biotechnology.

Background technique

Streptococcus suis is a Gram-positive bacterium that causes meningitis, arthritis, sepsis and death in pigs. In addition, it can be transmitted to humans through contact with sick pigs, causing human meningitis, streptococcal toxic shock-like syndrome, and death. Therefore, Streptococcus suis is an important zoonotic pathogen, which seriously threatens the pig industry and human public health. In the past two decades, Streptococcus suis has received more and more attention, and some important progress has been made in the study of its physiological and pathological mechanisms, as well as in the preparation and production of vaccines. Genetic manipulation techniques play a key role in this process. However, the previous gene manipulation techniques either introduced resistance gene markers, or adopted non-resistance gene manipulation, but the efficiency was relatively low, and it was difficult to perform complex and multi-gene manipulations. However, whether it is to further conduct in-depth, complex and objective physiological and pathological research, or to develop and prepare vaccine strains that cannot carry resistance gene markers and require multi-gene manipulation, it is necessary to efficiently and seamlessly delete, fuse or mutate the relevant genes . Therefore, the lack of an efficient traceless gene operating system has become a bottleneck limiting the research and vaccine preparation of Streptococcus suis, and an efficient reverse screening marker is the key to realize efficient traceless gene operation of bacteria.

There are two reverse screening markers currently reported for the establishment of Streptococcus suis, namely Bacillus subtilis saccharanase SacB and Vibrio parahaemolyticus toxin YoeB. In the report of SacB as a reverse screening marker for Streptococcus suis, the article simply introduced the use of the natural sacB gene and its promoter of Bacillus subtilis as a reverse screening marker, without specific methods, let alone its efficiency. We used the natural sacB gene and its promoter of Bacillus subtilis used in the report to screen hundreds of sucrose-tolerant colonies, but no target clone was found, indicating that the screening efficiency was lower than 1%. In the report using YeoB as a reverse screening marker, the induction of YeoB cannot completely inhibit the growth of Streptococcus suis, which fundamentally limits its screening efficiency. Therefore, this method not only needs to enrich the target clone through multiple passages and adding inducers, but even so, its screening efficiency cannot reach 100% at the highest level, and in most cases it is only about 50%. Therefore, the efficiency of the currently reported reverse selection markers for Streptococcus suis is low, and it is necessary to develop more efficient reverse selection markers for the traceless gene manipulation of Streptococcus suis.

In recent years, it has been found that mutants of the pheS gene encoding the α subunit of phenylalanine tRNA synthetase can be used as reverse selection markers in bacteria. A294G single amino acid substitution mutant (amino acid position refers to Escherichia coli PheS protein) was developed earlier and has been applied in various bacteria. However, the screening efficiency of such single substitution mutants is low, requiring high concentrations of p-Cl-phe (>5mM) and the use of nutrient-limited media. Further studies found that the T251S/A294G double substitution mutant has higher p-Cl-phe incorporation efficiency, so it is speculated that it may produce higher screening efficiency, which was confirmed in Bacillus subtilis and Streptococcus mutans , the screening efficiency reached 100%.

The PheS mutant competes with the strain's own wild-type PheS protein and misincorporates the phenylalanine analogue p-Cl-phe into the synthesized protein during translation, thereby expressing in the presence of p-Cl-phe Strains that express the PheS mutant die, and strains that do not express the PheS mutant survive. This reverse screening principle determines that the PheS reverse screening marker established in other bacteria cannot be used in Streptococcus suis, but requires: 1) identification of its own pheS gene for Streptococcus suis; 2) identification of T251 and A294 Substituting mutations for the corresponding amino acids; 3) Introducing a large number of synonymous mutations, while keeping the protein sequence consistent with the wild PheS protein, minimizing the similarity of the nucleic acid sequence and avoiding recombination between the two; 4) Screening for Streptococcus suis Driven by a strong promoter, the expression of the mutant PheS protein is increased to compete with the wild PheS protein.

Based on this, the present invention sets out to the identification of Streptococcus suis PheS protein and mutated amino acid, develops a kind of high-efficiency Streptococcus suis reverse selection marker by introducing double mutation, synonymous mutation and screening promoter, and determines its action condition and efficiency.

Contents of the invention

One of the objectives of the present invention is to provide a reverse screening marker for Streptococcus suis.

The second object of the present invention is to provide Streptococcus suis containing the reverse selection marker and its application in gene editing of Streptococcus suis.

The third object of the present invention is to provide a traceless gene editing method of Streptococcus suis.

In order to achieve the above object, the present invention adopts the following technical means:

First, the present invention proposes a reverse screening marker for Streptococcus suis, the reverse screening marker is the mutated pheS gene encoding the α subunit of Streptococcus suis phenylalanine tRNA synthetase, and the mutated pheS gene The T261S and A315G double substitution mutations in the encoded phenylalanine tRNA synthetase α subunit of Streptococcus suis caused the PheS mutant to compete with the wild PheS protein of the strain itself, and the phenylalanine analogues were translated into -Chloro-phenylalanine (p-Cl-Phe) is misincorporated into synthesized proteins so that in the presence of p-Cl-Phe, strains expressing PheS mutants die and strains that do not express PheS mutants Survive.

Wherein, preferably, the nucleotide sequence of the mutated pheS gene encoding the alpha subunit of phenylalanine tRNA synthetase of Streptococcus suis is shown in SEQ ID NO.1.

Wherein, preferably, the amino acid sequence of the mutated PheS mutant encoded by the pheS gene encoding the alpha subunit of phenylalanine tRNA synthetase of Streptococcus suis is shown in SEQ ID NO.2.

Secondly, the present invention also proposes a Streptococcus suis containing the reverse selection marker.

Wherein, preferably, the expression of the reverse selection marker is driven by promoters P ₀₁₇₇ , P ₀₅₃₀ , P ₁₅₀₃ , P ₁₈₁₅ or P ₁₈₆₈ .

Wherein, preferably, described Streptococcus suis is prepared by the following method:

(1) Synthesis of mPheS mutant gene

Synthesizing the mPheS mutant gene sequence shown in SEQ ID NO.1;

(2) Construction of mPheS and strong promoter fusion fragment P-mPheS

1) Cloning of mPheS and 5 strong promoter fragments:

Design PCR primers, the nucleotide sequence is as follows:

P ₀₁₇₇ -F:5'- CCGGCGGAAGAAGGAGTAA TTGGTAAGAGAAATGTGAGTG-3'

P ₀₁₇₇ -R:5'- GTTGTTGCTCGATGTTAGACAT ATCTTTATAAGACATGATATCCTC-3'

P ₀₅₃₀ -F:5'- CCGGCGGAAGAAGGAGTAA GTAGGATAACTGAATGGAGAA-3'

P ₀₅₃₀ -R:5'- GTTGTTGCTCGATGTTAGACAT TTTGGTAAAAGCCTCCAATAA-3'

P ₁₅₀₃ -F:5'- CCGGCGGAAGAAGGAGTAA TGTTTCGCCAGAGGCTT-3'

P ₁₅₀₃ -R:5'- GTTGTTGCTCGATGTTAGACAT TATATTACTCTCCTTTGAGTTT-3'

P ₁₈₁₅ -F:5'- CCGGCGGAAGAAGGAGTAA CAGCGCCTCAAAAACTA-3'

P ₁₈₁₅ -R:5'- GTTGTTGCTCGATGTTAGACAT AAGTCTCCATATAAGTACTTC-3'

P ₁₈₆₈ -F:5'- CCGGCGGAAGAAGGAGTAAAAAAACAGCAAGGATTGTAG -3'

P ₁₈₆₈ -R:5'- GTTGTTGCTCGATGTTAGACAT AAAACACCTCTGTTTTCTTT-3'

mPheS-F:5'-ATGTCTAACATCGAGCAAC-3'

mPheS-R:5'-TTAGAATTGTTCTGAGAAACGAAC-3'

Use the mPheS gene synthesized in step (1) as a template, and use mPheS-F/mPheS- _R as primers to obtain the amplification product of the _mPheS gene; -R, P ₀₅₃₀ -F/P ₀₅₃₀ -R, P ₁₅₀₃ -F/P ₁₅₀₃ -R, P ₁₈₁₅ -F/P ₁₈₁₅ -R, P ₁₈₆₈ -F/P ₁₈₆₈ -R were used as primers to obtain 5 promoters P Amplification products of ₀₁₇₇ , P ₀₅₃₀ , P ₁₅₀₃ , P ₁₈₁₅ , P ₁₈₆₈ ;

3) Construction of fusion fragment P-mPheS

The amplified products of each promoter and the amplified product of mPheS were mixed as templates, and fusion was carried out by _overlap extension PCR. _P0530 -mPheS, _P1503 -mPheS, _P1815 -mPheS and _P1868 -mPheS;

(3) Integration of the P-mPheS fusion fragment into the genome of Streptococcus suis through the erythromycin resistance gene (erm)

1) Amplification of the upstream sequence of Streptococcus suis ssu05_0630 gene and the downstream sequence containing erm gene

Design PCR primers, the nucleotide sequence is as follows:

UP ₀₆₃₀ -F:5'-TGCTAACGATGCTACAAATGC-3'

UP ₀₆₃₀ -R:5'-TTACTCCTTCTTCCGCCGG-3'

Erm-DN ₀₆₃₀ -F:5'- CGTTCGTTTCTCAGAACAATTCTAA AGAAGGAGGGATTCGTCATG-3'

Erm-DN ₀₆₃₀ -R:5'-CAAAGATAGCGGTGGTCGT-3'

Using UP ₀₆₃₀ -F/UP ₀₆₃₀ -R and Erm-DN ₀₆₃₀ -F/Erm-DN ₀₆₃₀ -R as primers respectively, the ssu05_0630 gene deletion strain of Streptococcus suis substituted with erm gene for ssu05_0630 gene (Chen Ping, Liu Ran, Huang Mengmeng, Zhu Jinlu, Xie Fang, Ni Hongbo, Liu Siguo, Zhang Yueling. Identification and functional study of protein with N-acetylglucosaminidase activity in Streptococcus suis type 2 strain 05ZYH33. Chinese Journal of Preventive Veterinary Medicine, 2019, 41(05): 462 The genomic DNA of -467) is template, carry out PCR amplification, obtain ssu05_0630 gene upstream sequence amplification product UP ₀₆₃₀ and the ssu05_0630 gene downstream sequence amplification product Erm-DN ₀₆₃₀ containing erm gene;

2) Construction of fusion fragment UP ₀₆₃₀ -P-mPheS-Erm-DN ₀₆₃₀

Combine the UP ₀₆₃₀ and Erm-DN ₀₆₃₀ fragments with the above five fusion fragments P-mPheS respectively as templates, use UP ₀₆₃₀ -F/UP ₀₆₃₀ -R as primers, adopt the above PCR reaction conditions, and perform overlap extension PCR to amplify Five corresponding fusion fragments were obtained, named UP-P ₀₁₇₇ -mPheS-Erm-DN, UP-P ₀₅₃₀ -mPheS-Erm-DN, UP-P ₁₅₀₃ -mPheS-Erm-DN, UP-P ₁₈₁₅ -mPheS -Erm-DN and UP-P ₁₈₆₈ -mPheS-Erm-DN;

3) Peptide-induced transformation and integration identification

Synthesize the polypeptide shown in SEQ ID NO.3 with a purity of 95%, dissolve it in deionized water to a final concentration of 5mM, and store it at -20°C after aliquoting; 100 inoculated in fresh TSBS medium, under the conditions of 37°C and 5% CO ₂ , cultured statically for 1.5h, 2h, 2.5h and 3h; at each time point, 50μl of bacterial liquid was taken, mixed with 2.5μl of polypeptide and 1μg of step 2) to obtain The five fusion fragments of UP-P-mPheS-Erm-DN were mixed separately, and after the mixture was incubated for 4 hours, the TSAS plate (TSAS-Erm) added with erythromycin was coated;

Design PCR primers, the nucleotide sequence is as follows:

SeqF: 5'-GCGGAGCCCTTACCAG-3'

SeqR: 5'-AATACAGAAGTTAAACGATTTGT-3'

Pick a single colony on the TSAS-Erm plate, and use SeqF/SeqR primers to carry out PCR identification after cultivation. The sizes detected by 1% agarose electrophoresis are 2004bp, 1820bp, 1717bp, 1872bp and 1777bp respectively, confirming that each UP-P-mPheS- The Erm-DN fragment was integrated into the target site, indicating that the fragment of P-mPheS-Erm integrated in the genome was obtained, referred to as PPE; these strains were named gP ₀₁₇₇ PE, gP ₀₅₃₀ PE, gP ₁₅₀₃ PE, gP ₁₈₁₅ PE and gP ₁₈₆₈ PE.

Again, the present invention also proposes the application of the Streptococcus suis in the traceless gene editing of Streptococcus suis.

Finally, the present invention also proposes a traceless gene editing method for Streptococcus suis, which includes the following steps: amplifying the upstream UP1 and downstream sequence DN1 of the mutant gene from the Streptococcus suis WT strain; The fragment PPE containing the promoter, reverse selection marker and erythromycin resistance gene was amplified from the DNA; the fusion DNA fragment UP1-PPE-DN1 was amplified by overlapping extension PCR; the fragment was transformed into Streptococcus suis WT strain and in Screened on the TSAS-Erm plate, the colonies were identified by PCR to obtain positive colonies, and an intermediate strain containing the reverse screening marker P-mPheS was obtained;

The upstream UP2 and downstream sequences DN2 of the mutant gene were amplified from the WT strain of Streptococcus suis; the upstream and downstream sequences of the mutant gene were either directly fused together, or fused with a specific gene or fragment, or fused with the mutant gene, and obtained for the first The second fragment of the secondary transformation; the fragment is transformed into the above-mentioned intermediate strain sensitive to p-Cl-phe, and reverse screening is carried out on the TSAS plate containing 0.05% p-Cl-phe; 100 colonies are randomly picked and cultured Afterwards, it is identified by PCR to obtain the target mutation.

Compared with the prior art, the beneficial effects of the present invention are:

Streptococcus suis is an important zoonotic pathogen, which seriously threatens the pig industry and human public health. The in-depth study of Streptococcus suis and the preparation of vaccines urgently need an effective traceless gene operating system, and the efficiency of the reverse screening marker directly determines the efficiency of the traceless gene operation. At present, two reverse selection markers based on SacB and YeoB have been developed in Streptococcus suis, but their efficiency is not high enough, and the operation is relatively complicated. In the present invention, under the genetic background of Streptococcus suis, we identified the pheS gene of Streptococcus suis, introduced mutations, screened the promoter, and explored suitable chlorinated amphetamine in Streptococcus suis through the genome integration pathway Acid (p-Cl-phe) action concentration, identification and screening efficiency, developed a high-efficiency reverse screening marker for Streptococcus suis based on the pheS mutant gene, and the screening efficiency reached 100%, which is currently the most efficient reverse screening marker for Streptococcus suis . Using this high-efficiency reverse screening marker, an efficient traceless gene manipulation strategy of Streptococcus suis was established, which is used to achieve efficient traceless gene deletion, gene fusion, gene mutation, and other traceless gene manipulations of Streptococcus suis. The physiological and pathological mechanism of Streptococcus suis and the preparation of vaccine strains have good application prospects.

Description of drawings

Figure 1 is a comparison of wtPheS and mPheS related sequences;

Figure 2 is the construction of different P-mPheS genome integrated strains and the detection of sensitivity to p-Cl-phe;

Fig. 3 is P ₁₅₀₃ -mPheS used as a reverse selection marker to construct ireB gene deletion strains;

Fig. 4 is a schematic diagram of a highly efficient traceless gene manipulation strategy for Streptococcus suis based on the P ₁₅₀₃ -mPheS reverse selection marker.

Detailed ways

The present invention will be further described through experiments and examples below. It should be understood that these examples are only for the purpose of illustration, and in no way limit the protection scope of the present invention.

Design and synthesis of embodiment 1 mPheS mutant gene

Using pheS of Streptococcus mutans to perform BLAST, the wild-type pheS gene (wtPheS) was identified from the genome of Streptococcus suis 05ZYH33 (GenBank: CP000407). Comparing the PheS proteins of E. coli, S. mutans, L. monocytogenes, acidophilus, and S. suis by ClustalW, amino acids T261 and A315 corresponding to T251 and A294 of E. coli PheS proteins were identified (Fig. 1A). The codons ACT and GCC were changed to TCA and GGT, respectively, to realize the T261S and A315G double substitution mutations (Fig. 1B, shown by the dotted rectangle). Then through the codon adaptation software Jcat and manual mutation, 275 synonymous mutations were finally introduced, and the similarity between the obtained mPheS gene (shown in SEQ ID NO.1) and the wtPheS gene was 73.7%, and the longest continuous identity between them was Sequences do not exceed 8 bp (Fig. 1B). Their corresponding mPheS (shown in SEQ ID NO.2) and wtPheS proteins have completely identical amino acid sequences except for the T261S/A315G double substitution ( FIG. 1C ). The mPheS gene was synthesized by BGI.

Example 2 Construction of mPheS and strong promoter fusion fragment P-mPheS

(1) Cloning of mPheS and 5 potential strong promoter fragments:

Design PCR primers, the nucleotide sequence is as follows:

P ₀₁₇₇ -F:5'- CCGGCGGAAGAAGGAGTAA TTGGTAAGAGAAATGTGAGTG-3'

P ₀₁₇₇ -R:5'- GTTGTTGCTCGATGTTAGACAT ATCTTTATAAGACATGATATCCTC-3'

P ₀₅₃₀ -F:5'- CCGGCGGAAGAAGGAGTAA GTAGGATAACTGAATGGAGAA-3'

P ₀₅₃₀ -R:5'- GTTGTTGCTCGATGTTAGACAT TTTGGTAAAAGCCTCCAATAA-3'

P ₁₅₀₃ -F:5'- CCGGCGGAAGAAGGAGTAA TGTTTCGCCAGAGGCTT-3'

P ₁₅₀₃ -R:5'- GTTGTTGCTCGATGTTAGACAT TATATTACTCTCCTTTGAGTTT-3'

P ₁₈₁₅ -F:5'- CCGGCGGAAGAAGGAGTAA CAGCGCCTCAAAAACTA-3'

P ₁₈₁₅ -R:5'- GTTGTTGCTCGATGTTAGACAT AAGTCTCCATATAAGTACTTC-3'

P ₁₈₆₈ -F:5'- CCGGCGGAAGAAGGAGTAAAAAAACAGCAAGGATTGTAG -3'

P ₁₈₆₈ -R:5'- GTTGTTGCTCGATGTTAGACAT AAAACACCTCTGTTTTCTTT-3'

mPheS-F:5'-ATGTCTAACATCGAGCAAC-3'

mPheS-R:5'-TTAGAATTGTTCTGAGAAACGAAC-3'

The PCR reaction system is:

The PCR reaction conditions were: denaturation at 98°C for 10s, annealing at 55°C for 5s, extension at 72°C for 5-10s/kb, 32 cycles. Except that the mPheS gene synthesized in Example 1 was used as a template for mPheS amplification, all others used the genomic DNA of Streptococcus suis 05ZYH33 strain as a template.

P ₀₁₇₇ -F/P ₀₁₇₇ -R, P ₀₅₃₀ -F/P ₀₅₃₀ -R, P ₁₅₀₃ -F/P 1503-R, P _{1815 -} F/P ₁₈₁₅ -R, P ₁₈₆₈ -F/P ₁₈₆₈ -R and mPheS-F/mPheS-R PCR products amplified by six pairs of primers are 5 promoters P ₀₁₇₇ , P ₀₅₃₀ , P ₁₅₀₃ , P ₁₈₁₅ , P ₁₈₆₈ and mPheS genes respectively, and the sizes detected by 1% agarose electrophoresis are 484bp , 300bp, 197bp, 352bp, 257bp and 1044bp (Figure 2A).

(2) Construction of the fusion fragment P-mPheS: according to the template and primer combinations shown in Table 1, each promoter fragment and the mPheS fragment were mixed as a template, and fusion was carried out by overlap extension PCR.

The PCR reaction conditions were the same as above, and the obtained product was the fusion fragment P-mPheS of mPheS and strong promoter, which were named as P ₀₁₇₇ -mPheS, P ₀₅₃₀ -mPheS, P ₁₅₀₃ -mPheS, P ₁₈₁₅ -mPheS and P ₁₈₆₈ -mPheS, after 1 The sizes detected by % agarose electrophoresis were 1528bp, 1344bp, 1241bp, 1396bp and 1301bp respectively (Fig. 2B).

Embodiment 3 integrates the P-mPheS fusion fragment into the Streptococcus suis genome by the erythromycin resistance gene (erm)

(1) Amplification of the upstream sequence of Streptococcus suis ssu05_0630 gene and the downstream sequence of ssu05_0630 gene containing erm gene

Design PCR primers, the nucleotide sequence is as follows:

UP ₀₆₃₀ -F:5'-TGCTAACGATGCTACAAATGC-3'

UP ₀₆₃₀ -R:5'-TTACTCCTTCTTCCGCCGG-3'

Erm-DN ₀₆₃₀ -F:5'- CGTTCGTTTCTCAGAACAATTCTAA AGAAGGAGGGATTCGTCATG-3'

Erm-DN ₀₆₃₀ -R:5'-CAAAGATAGCGGTGGTCGT-3'

Using UP ₀₆₃₀ -F/UP ₀₆₃₀ -R and Erm-DN ₀₆₃₀ -F/Erm-DN ₀₆₃₀ -R as primers respectively, the ssu05_0630 gene deletion strain of Streptococcus suis substituted with erm gene for ssu05_0630 gene (Chen Ping, Liu Ran, Huang Mengmeng, Zhu Jinlu, Xie Fang, Ni Hongbo, Liu Siguo, Zhang Yueling. Identification and functional study of protein with N-acetylglucosaminidase activity in Streptococcus suis type 2 strain 05ZYH33. Chinese Journal of Preventive Veterinary Medicine, 2019, 41(05): 462 -467) genomic DNA was used as a template for PCR amplification to obtain the amplification product UP ₀₆₃₀ of the upstream sequence of the ssu05_0630 gene and the amplification product Erm-DN ₀₆₃₀ of the downstream sequence of the ssu05_0630 gene containing the erm gene. The detected sizes of the products UP ₀₆₃₀ and Erm-DN ₀₆₃₀ were 1024bp and 2413bp, respectively (Fig. 2B).

(2) Construction of fusion fragment UP ₀₆₃₀ -P-mPheS-Erm-DN ₀₆₃₀

As shown in Table 2, the UP ₀₆₃₀ and Erm-DN ₀₆₃₀ fragments were combined with the above five P-mPheS fragments one by one, the mixture was used as a template, and UP ₀₆₃₀ -F/UP ₀₆₃₀ -R was used as a primer, and the above PCR reaction conditions were adopted to carry out Overlap extension PCR, amplified to obtain 5 corresponding fusion fragments UP-P ₀₁₇₇ -mPheS-Erm-DN, UP-P ₀₅₃₀ -mPheS-Erm-DN, UP-P ₁₅₀₃ -mPheS-Erm-DN, UP-P ₁₈₁₅ -mPheS-Erm-DN and UP-P ₁₈₆₈ -mPheS-Erm-DN. The sizes detected by 1% agarose electrophoresis were 4983bp, 4799bp, 4696bp, 4851bp and 4756bp respectively (Fig. 2C).

Table 2 Overlap extension PCR template and primer combinations

(3) Peptide-induced transformation and integration identification

Peptide-induced transformations were performed with reference to (Zaccaria et al., 2014). The polypeptide (shown in SEQ ID NO.3, GNWGTWVEE) was synthesized by GenScript (China) with a purity of 95%. Dissolve in deionized water to a final concentration of 5mM, and store at -20°C after aliquoting. Streptococcus suis 05ZYH33 strain was cultured overnight, inoculated in fresh TSBS medium at a ratio of 1:100, and cultured statically for 1.5h, 2h, 2.5h and 3h at 37°C and 5% CO ₂ . Take 50 μl of bacterial liquid at each time point and mix with 2.5 μl of polypeptide and 1 μg of 5 fusion fragments of UP-P-mPheS-Erm-DN obtained in step (2). After the mixture was incubated for 4 hours, erythromycin-supplemented TSAS plates (TSAS-Erm) were plated.

Design PCR primers, the nucleotide sequence is as follows:

SeqF: 5'-GCGGAGCCCTTACCAG-3'

SeqR: 5'-AATACAGAAGTTAAACGATTTGT-3'

Pick a single colony on the TSAS-Erm plate, and use SeqF/SeqR primers to carry out PCR identification after cultivation. The sizes detected by 1% agarose electrophoresis are 2004bp, 1820bp, 1717bp, 1872bp and 1777bp respectively (Figure 2D), confirm that each UP- The P-mPheS-Erm-DN fragment was integrated into the target site, indicating that the fragment integrated with P-mPheS-Erm in the genome, referred to as PPE, was obtained. These strains were named gP ₀₁₇₇ PE, gP ₀₅₃₀ PE, gP ₁₅₀₃ PE, gP ₁₈₁₅ PE and gP ₁₈₆₈ PE (g stands for genome integration) respectively (Fig. 2E).

Example 4 Sensitivity detection of different gPPE bacterial strains to p-Cl-phe

After the Streptococcus suis strain was cultured overnight, it was transferred to fresh medium and grown to OD _600nm 0.6, and 5 μl was dropped on the TSAS plate containing the specified concentration of p-Cl-phe. After static culture at 37°C and 5% CO ₂ for 24 hours, observe and take pictures to record the growth of the strain. The minimum inhibitory concentration (MIC) of p-Cl-phe to each strain was defined as the lowest concentration that inhibited the growth of the strain. The MICs of p-Cl-phe to gP ₀₁₇₇ PE, gP ₀₅₃₀ PE, gP ₁₅₀₃ PE, gP ₁₈₁₅ PE and gP ₁₈₆₈ PE strains were 0.02%, 0.01%, 0.01%, 0.08% and 0.06%, respectively (Fig. 2F), while The wild strain (WT) was not sensitive to p-Cl-phe below 0.15%. It shows that all five P-mPheS can endow the strain with sensitivity to p-Cl-phe, and the MIC of gP ₀₅₃₀ PE and gP ₁₅₀₃ PE is the lowest, indicating that the sensitivity endowed by P ₀₅₃₀ -mPheS and P ₁₅₀₃ -mPheS is the strongest, It is most suitable as a reverse screening marker for Streptococcus suis.

Example 5P ₁₅₀₃ -mPheS is used as the screening efficiency of reverse screening marker

To test the efficiency of P ₁₅₀₃ -mPheS as a reverse selection marker for S. suis, it was used for scarless deletion of ireB gene. Design PCR primers, the nucleotide sequence is as follows:

UP1-F:5'-GAAGAAGCTCCTGTTGTTGC-3'

UP1-R:5'-CTTCGGTAAATCCCATACTTAC-3'

PPE-F: 5'- GTAAGTATGGGATTTACCGAAG TGTTTCGCCAGAGGCTT-3'

PPE-R: 5'- GTCAATCCCATTCCCTTTC CCAAATTCCCCGTAGGC-3'

DN1-F: 5'-GAAAGGGAATGGGATTGAC-3'

DN1-R:5'-GCGTCTTCTGGGATAGGTT-3'

UP2-F:5'-ACAACGCCTGGTGGACG-3'

UP2-R: 5'-ACTTACACCTTTCTTTCCCT-3'

DN2-F: 5'- AGGGAAAGAAGGTGTAAGT TGAGAATAATGGGATTAGACGT-3'

DN2-R:5'-TGATAGGCTGGATAGTTTTGATA-3'

ireB-F:5'-GAAACGACTTCAAGTGGGC-3'

ireB-R:5'-GTTCGGTCAAACGCTCCA-3'

UP1-F/UP1-R and DN1-F/DN1-R primers were used to amplify the upstream UP1 and downstream sequence DN1 of ireB gene from Streptococcus suis WT strain; The P ₁₅₀₃ PE sequence (PPE for short) was amplified in the genomic DNA of the ₁₅₀₃ PE strain ( FIG. 3A ). The fusion DNA fragment UP1-PPE-DN1 was amplified by overlap extension PCR ( FIG. 3B ). The fragment was transformed into a Streptococcus suis WT strain and screened on a TSAS-Erm plate, and the colonies were identified by PCR to obtain positive colonies (Fig. 3C). Positive colonies were inoculated on TSAS plates supplemented with 0.05% p-Cl-phe to confirm their sensitivity to p-Cl-phe, and an intermediate strain containing the reverse selection marker P ₁₅₀₃ -mPheS was obtained ( FIG. 3D ).

Using UP2-F/UP2-R and DN2-F/DN2-R primers, respectively, the upstream sequence UP2 and downstream sequence DN2 of the ireB gene were amplified from the Streptococcus suis WT strain ( FIG. 3E ). The fusion DNA fragment UP2-DN2 was amplified by overlap extension PCR ( FIG. 3F ). The fragment was transformed into the above-mentioned intermediate strain sensitive to p-Cl-phe, and reverse selection was carried out on the TSAS plate containing 0.05% p-Cl-phe. 100 colonies were randomly selected, and after cultivation, they were identified by PCR with primers ireB-F/ireB-R. Among all the colonies picked to tolerate 0.05% p-Cl-phe, all of them contained the target ireB gene traceless deletion ( FIG. 3G ), illustrating that P ₁₅₀₃ -mPheS was used as a reverse selection marker, and its selection efficiency was 100%. This was further confirmed by three replicate experiments.

Example 6 Streptococcus suis traceless gene manipulation strategy using P ₁₅₀₃ -mPheS as reverse screening marker

The 100% screening efficiency of P ₁₅₀₃ -mPheS makes it possible to carry out efficient and traceless genetic manipulation of Streptococcus suis. Through the two steps of inserting and removing P ₁₅₀₃ -mPheS, and using p-Cl-phe as an inhibitor, a two-step high-efficiency and traceless gene manipulation strategy of Streptococcus suis was formed. As shown in Figure 4, this strategy requires only two fusion fragments and two transformations. First, the upstream and downstream sequences of the mutation site were fused with the P ₁₅₀₃ PE fragment containing the P ₁₅₀₃ -mPheS marker to obtain the UP-P ₁₅₀₃ PE-DN fragment for the first transformation, which was carried by the positive selection marker erm for selection to obtain intermediate strains containing P ₁₅₀₃ PE. Then, the upstream and downstream sequences of the mutation site are either directly fused together (for gene deletion), or to a specific gene or fragment (such as a fluorescent protein gene or FLAG tag for gene fusion), or to the mutant gene ( used for gene mutation), to obtain the second fragment for the second transformation, and to perform reverse selection by p-Cl-phe after transforming the intermediate strain, that is, to obtain the target mutation.

sequence listing

<110> Harbin Institute of Veterinary Medicine, Chinese Academy of Agricultural Sciences (Harbin Branch Center of China Center for Animal Health and Epidemiology)

<120> A reverse screening marker for Streptococcus suis, Streptococcus suis containing the reverse screening marker and application thereof

<141> 2022-06-23

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1044

<212>DNA

<213> artificial sequence

<400> 1

atgtctaaca tcgagcaaca acttgcagaa ctttcacaaa ctactttgga aaaacttaag 60

gaaattcaac accaaggtga aaaggaattg caagatcttc gtgtagctgt acttggcaaa 120

aaaggttcac ttactgattt gcttaaaggt cttaaggatt tgtcaaacga tatgaagcct 180

attgtaggca aacaagtaaa cgaagttcgt gacgttttga ctacagcttt cgaagagaca 240

gcacaaaaag ttgctgctgc taaaatccaa caacaattgg catcagaaac tatcgacgtt 300

actcttcctg gacgtcaagt aaaagttggt aaacgtcacg ttcttactca aacatcagaa 360

gaaatcgaag acatcttcct tggtatgggt ttccaaattg tagatggttt cgaagttgaa 420

aaagattatt ataacttcga acgtatgaac cttccaaaag accacccctgc tcgtgacatg 480

caagacactt tctacattac tgaagagatc ttgatgcgta ctcacacttc accagtacaa 540

gctcgtacta tggatcaaca cgacttctct aagggcgcac ttaaaatgat ctcaccaggc 600

cgtgtattcc gccgcgacac tgacgacgct actcactcac accaattcca ccaaatcgaa 660

ggtcttgtag ttggcgaaaa cgtttcaatg ggtgacttga aaggcacttt ggaaatgatc 720

attaaaaaaa tgttcggtga agaacgtcaa atccgtcttc gcccttctta tttccctttc 780

tcagaaccat cagtagaagt tgacgtatca tgtttcaaat gtggaggtga tggctgtaac 840

gtttgtaaaa aaactggttg gatcgaaatc ttgggtgctg gtatggttca cccacaagtt 900

cttgaaatgt caggtatcga ttctactaaa tactcaggtt tcggtttcgg cttgggacaa 960

gagcgtatcg ctatgttgcg ctacggaatt aacgatattc gtggcttcta ccaaggcgac 1020

gttcgtttct cagaacaatt ctaa 1044

<210> 2

<211> 347

<212> PRT

<213> artificial sequence

<400> 2

Met Ser Asn Ile Glu Gln Gln Leu Ala Glu Leu Ser Gln Thr Thr Leu

1 5 10 15

Glu Lys Leu Lys Glu Ile Gln His Gln Gly Glu Lys Glu Leu Gln Asp

20 25 30

Leu Arg Val Ala Val Leu Gly Lys Lys Gly Ser Leu Thr Asp Leu Leu

35 40 45

Lys Gly Leu Lys Asp Leu Ser Asn Asp Met Lys Pro Ile Val Gly Lys

50 55 60

Gln Val Asn Glu Val Arg Asp Val Leu Thr Thr Ala Phe Glu Glu Thr

65 70 75 80

Ala Gln Lys Val Ala Ala Ala Lys Ile Gln Gln Gln Leu Ala Ser Glu

85 90 95

Thr Ile Asp Val Thr Leu Pro Gly Arg Gln Val Lys Val Gly Lys Arg

100 105 110

His Val Leu Thr Gln Thr Ser Glu Glu Ile Glu Asp Ile Phe Leu Gly

115 120 125

Met Gly Phe Gln Ile Val Asp Gly Phe Glu Val Glu Lys Asp Tyr Tyr

130 135 140

Asn Phe Glu Arg Met Asn Leu Pro Lys Asp His Pro Ala Arg Asp Met

145 150 155 160

Gln Asp Thr Phe Tyr Ile Thr Glu Glu Ile Leu Met Arg Thr His Thr

165 170 175

Ser Pro Val Gln Ala Arg Thr Met Asp Gln His Asp Phe Ser Lys Gly

180 185 190

Ala Leu Lys Met Ile Ser Pro Gly Arg Val Phe Arg Arg Asp Thr Asp

195 200 205

Asp Ala Thr His Ser His Gln Phe His Gln Ile Glu Gly Leu Val Val

210 215 220

Gly Glu Asn Val Ser Met Gly Asp Leu Lys Gly Thr Leu Glu Met Ile

225 230 235 240

Ile Lys Lys Met Phe Gly Glu Glu Arg Gln Ile Arg Leu Arg Pro Ser

245 250 255

Tyr Phe Pro Phe Ser Glu Pro Ser Val Glu Val Asp Val Ser Cys Phe

260 265 270

Lys Cys Gly Gly Asp Gly Cys Asn Val Cys Lys Lys Thr Gly Trp Ile

275 280 285

Glu Ile Leu Gly Ala Gly Met Val His Pro Gln Val Leu Glu Met Ser

290 295 300

Gly Ile Asp Ser Thr Lys Tyr Ser Gly Phe Gly Phe Gly Leu Gly Gln

305 310 315 320

Glu Arg Ile Ala Met Leu Arg Tyr Gly Ile Asn Asp Ile Arg Gly Phe

325 330 335

Tyr Gln Gly Asp Val Arg Phe Ser Glu Gln Phe

340 345

<210> 3

<211> 9

<212> PRT

<213> artificial sequence

<400> 3

Gly Asn Trp Gly Thr Trp Val Glu Glu

1 5

Claims (7)

1. A reverse selectable marker for streptococcus suis, wherein the reverse selectable marker is a mutated pheS gene encoding a phenylalanine tRNA synthetase α subunit of streptococcus suis, wherein the mutated pheS gene results in T261S and a315G double substitution mutations of the encoded phenylalanine tRNA synthetase α subunit of streptococcus suis, wherein the pheS mutant comprises a phenylalanine analog p-chloro-phenylalanine (p-Cl-Phe) incorporated erroneously into a synthetic protein during translation by competing with a wild pheS protein of the strain, such that in the presence of p-Cl-Phe, the strain expressing the pheS mutant dies and the strain not expressing the pheS mutant survives, and wherein the mutated pheS gene encoding the phenylalanine tRNA synthetase α subunit of streptococcus suis has a nucleotide sequence as set forth in SEQ ID No. 1.

2. The inverted selection marker of streptococcus suis according to claim 1, wherein the amino acid sequence of the pheS mutant encoded by the pheS gene encoding the alpha subunit of phenylalanine tRNA synthetase of streptococcus suis after mutation is shown as SEQ ID No. 2.

3. A streptococcus suis comprising the reverse screening marker of claim 1 or 2.

4. A streptococcus suis as claimed in claim 3, wherein the reverse selectable marker consists of promoter P ₀₁₇₇ 、P ₀₅₃₀ 、P ₁₅₀₃ 、P ₁₈₁₅ Or P ₁₈₆₈ Driving the expression.

5. The streptococcus suis of claim 3, wherein said streptococcus suis is prepared by the process of:

(1) Synthesis of the mPES mutant Gene

Synthesizing an mPES mutant gene sequence shown in SEQ ID NO. 1;

(2) Construction of fusion fragment P-mPES of mPES and strong promoter

1) Cloning of the mphs with 5 strong promoter fragments:

PCR primers were designed and the nucleotide sequences were as follows:

P ₀₁₇₇ -F:

5’-CCGGCGGAAGAAGGAGTAATTGGTAAGAGAAATGTGAGTG-3’

P ₀₁₇₇ -R:

5’-GTTGTTGCTCGATGTTAGACATATCTTTATAAGACATGATATCCTC-3’

P ₀₅₃₀ -F:

5’-CCGGCGGAAGAAGGAGTAAGTAGGATAACTGAATGGAGAA-3’

P ₀₅₃₀ -R:

5’-GTTGTTGCTCGATGTTAGACATTTTGGTAAAAGCCTCCAATAA-3’

P ₁₅₀₃ -F:

5’-CCGGCGGAAGAAGGAGTAATGTTTCGCCAGAGGCTT-3’

P ₁₅₀₃ -R:

5’-GTTGTTGCTCGATGTTAGACATTATATTACTCTCCTTTGAGTTT-3’

P ₁₈₁₅ -F:

5’-CCGGCGGAAGAAGGAGTAACAGCGCCTCAAAAACTA-3’

P ₁₈₁₅ -R:

5’-GTTGTTGCTCGATGTTAGACATAAGTCCTCCATATAAGTACTTC-3’

P ₁₈₆₈ -F:

5’-CCGGCGGAAGAAGGAGTAAAAAAACAGCAAGGATTGTAG-3’

P ₁₈₆₈ -R:

5’-GTTGTTGCTCGATGTTAGACATAAAACACCTCTGTTTTCTTT-3’

mPheS-F:5’-ATGTCTAACATCGAGCAAC-3’

mPheS-R:5’-TTAGAATTGTTCTGAGAAACGAAC-3’

taking the mPIS gene synthesized in the step (1) as a template and taking the mPIS-F/mPIS-R as a primer to obtain an amplification product of the mPIS gene; the genome DNA of streptococcus suis 05ZYH33 strain is used as a template, and P is respectively used as a template ₀₁₇₇ -F/P ₀₁₇₇ -R、P ₀₅₃₀ -F/P ₀₅₃₀ -R、P ₁₅₀₃ -F/P ₁₅₀₃ -R、P ₁₈₁₅ -F/P ₁₈₁₅ -R、P ₁₈₆₈ -F/P ₁₈₆₈ R is primer to obtain 5 promoters P ₀₁₇₇ 、P ₀₅₃₀ 、P ₁₅₀₃ 、P ₁₈₁₅ 、P ₁₈₆₈ Is a product of amplification of (a);

2) Construction of fusion fragment P-mPHS

The amplified products of the promoters and the amplified products of the mPES are respectively mixed as templates, and fusion is carried out by overlapping extension PCR, so as to obtain products, namely fusion fragments P-mPES of the mPES and the strong promoters, which are respectively named P ₀₁₇₇ -mPheS、P ₀₅₃₀ -mPheS、P ₁₅₀₃ -mPheS、P ₁₈₁₅ -mPES and P ₁₈₆₈ -mPheS；

(3) Integration of P-mPES fusion fragments into Streptococcus suis genome by erythromycin resistance Gene (erm)

1) Streptococcus suis ssu05_0630 gene upstream sequence and erm gene-containing ssu05_0630 gene downstream sequence amplification

PCR primers were designed and the nucleotide sequences were as follows:

UP ₀₆₃₀ -F:5’-TGCTAACGATGCTACAAATGC-3’

UP ₀₆₃₀ -R:5’-TTACTCCTTCTTCCGCCGG-3’

Erm-DN ₀₆₃₀ -F:

5’-CGTTCGTTTCTCAGAACAATTCTAAAGAAGGAGGGATTCGTCATG-3’

Erm-DN ₀₆₃₀ -R:5’-CAAAGATAGCGGTGGTCGT-3’

respectively with UP ₀₆₃₀ -F/UP ₀₆₃₀ -R and Erm-DN ₀₆₃₀ -F/Erm-DN ₀₆₃₀ R is a primer, and the erm gene is used for replacing the genome DNA of a streptococcus suis ssu05_0630 gene deletion strain of the ssu05_0630 gene as a template, and PCR amplification is carried out to obtain an amplified product UP of an upstream sequence of the ssu05_0630 gene ₀₆₃₀ And the downstream sequence amplification product Erm-DN of the ssm-05_0630 gene ₀₆₃₀ ；

2) Fusion fragment UP ₀₆₃₀ -P-mPheS-Erm-DN ₀₆₃₀ Construction of (3)

UP is taken into account ₀₆₃₀ And Erm-DN ₀₆₃₀ Fragments and upperThe 5 fusion fragments P-mPES are respectively combined to be used as templates, and UP is used ₀₆₃₀ -F/UP ₀₆₃₀ R is a primer, overlap extension PCR is carried out by adopting the PCR reaction conditions, 5 corresponding fusion fragments are obtained by amplification, and the fusion fragments are respectively named as UP-P ₀₁₇₇ -mPheS-Erm-DN、UP-P ₀₅₃₀ -mPheS-Erm-DN、UP-P ₁₅₀₃ -mPheS-Erm-DN、UP-P ₁₈₁₅ -mPES-Erm-DN and UP-P ₁₈₆₈ -mPheS-Erm-DN；

3) Peptide-induced transformation and integration identification

Synthesizing polypeptide shown in SEQ ID NO.3 with purity of 95%, dissolving in deionized water to a final concentration of 5mM, subpackaging, and storing at-20deg.C for use; after overnight incubation of Streptococcus suis 05ZYH33 strain, it was inoculated at 1:100 into fresh TSBS medium, 37℃and 5% CO ₂ Under the condition, standing and culturing for 1.5h, 2h, 2.5h and 3h; 50 μl of bacterial liquid is taken at each time point, and is respectively mixed with 2.5 μl of polypeptide and 1 μg of fusion fragments of 5 UP-P-mPhs-Erm-DN obtained in the step 2), and after the mixture is cultured for 4 hours, a TSAS plate added with erythromycin is coated;

PCR primers were designed and the nucleotide sequences were as follows:

SeqF:5’-GCGGAGCCCTTACCAG-3’

SeqR:5’-AATACAGAAGTTAAACGATTTGT-3’

selecting single colony on a TSAS-Erm plate, culturing, carrying out PCR identification by adopting SeqF/SeqR primers, detecting the sizes of 2004bp, 1820bp, 1717bp, 1872bp and 1777bp respectively by 1% agarose electrophoresis, and confirming that each UP-P-mPES-Erm-DN fragment is integrated into a target site, which means that a fragment with P-mPES-Erm integrated in a genome, namely PPE for short is obtained; these strains were designated as gP respectively ₀₁₇₇ PE、gP ₀₅₃₀ PE、gP ₁₅₀₃ PE、gP ₁₈₁₅ PE and gP ₁₈₆₈ PE。

6. Use of streptococcus suis according to any one of claims 3-5 for the traceless gene editing of streptococcus suis.

7. A method for editing a streptococcus suis traceless gene, which is characterized by comprising the following steps: amplifying upstream UP1 and downstream DN1 sequences of mutant genes from a Streptococcus suis WT strain; amplifying from the genomic DNA of a Streptococcus suis strain of any one of claims 3-5 a fragment PPE comprising a promoter, a reverse selectable marker and an erythromycin resistance gene; amplifying to obtain a fusion DNA fragment UP1-PPE-DN1 by overlap extension PCR; fragment transformation of streptococcus suis WT strain and screening on TSAS-Erm plate, colony obtaining positive colony by PCR identification, obtaining intermediate strain containing reverse screening mark P-mPHS;

amplifying upstream UP2 and downstream DN2 sequences of mutant genes from a Streptococcus suis WT strain; the upstream and downstream sequences of the mutant gene are either fused directly together, fused to a specific gene or fragment, or fused to the mutant gene to obtain a second fragment for a second transformation; fragments were transformed with the above p-Cl-phe-sensitive intermediate strain and reverse screened on TSAS plates containing 0.05% p-Cl-phe; randomly picking colonies, culturing, and carrying out PCR identification on the colonies to obtain the target mutation.