CN114605509B

CN114605509B - YH 66-01475 protein and application of encoding gene thereof in regulating and controlling bacterial arginine yield

Info

Publication number: CN114605509B
Application number: CN202210247165.3A
Authority: CN
Inventors: 孟刚; 魏爱英; 贾慧萍; 蔡卫卫; 田斌; 付丽霞
Original assignee: Ningxia Eppen Biotech Co ltd
Current assignee: Ningxia Eppen Biotech Co ltd
Priority date: 2022-03-14
Filing date: 2022-03-14
Publication date: 2024-06-04
Anticipated expiration: 2042-03-14
Also published as: CN114605509A

Abstract

The invention discloses YH 66-01475 protein and application of a coding gene thereof in regulating and controlling bacterial arginine yield. The YH 66-01475 mutant disclosed by the invention is a protein obtained by mutating the 32 nd amino acid residue of YH 66-01475 protein from arginine to cysteine. The invention firstly obtains YH66_01475 ^C94T through single-point mutation of YH66_01475 gene, and then discovers that the YH66_01475 gene or mutant gene thereof can regulate and control the bacterial L-arginine yield through fermentation culture of constructed YH66_01475 or mutant gene over-expression recombinant bacteria and YH66_01475 knockout recombinant bacteria. The invention discovers that YH 66-01475 gene participates in the biosynthesis of arginine for the first time, and has great application value for cultivating high-yield and high-quality strains and industrialized production of arginine.

Description

YH 66-01475 protein and application of encoding gene thereof in regulating and controlling bacterial arginine yield

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an application of YH 66-01475 protein and a coding gene thereof in regulating and controlling bacterial arginine yield.

Background

L-arginine is a semi-essential amino acid of human and animals, has important biochemical and physiological significance, and is widely applied to the food and pharmaceutical industries, especially in the pharmaceutical industry field, and is concerned as a therapeutic drug for improving human immunity, preventing and treating cardiovascular diseases and the like.

Along with the increasing market demand of L-arginine, breeding high-yield and stable production strains promotes accumulation of L-arginine in microorganisms, further improving the yield of L-arginine is always a hot spot for the development of L-arginine fermentation industrial technology and fermentation engineering research, and is also always accompanied with the development of L-arginine fermentation industry, thereby having important significance for promoting the progress of L-arginine industrialization.

Corynebacterium (Corynebacterium) microorganisms achieve biosynthesis of L-arginine by a loop-step pathway, and L-arginine is synthesized from L-glutamic acid via N-acetylglutamic acid (N-acetylglutamate), N-acetylglutamyl phosphate (N-acetylglutamyl phosphate), N-acetylglutamic acid semialdehyde (N-acetylglutamate semialdehyde), N-acetylornithine (N-acetylornithine), ornithine (ornithine), citrulline (citrulline) and argininosuccinic acid (argininosuccinate).

The corynebacterium microorganisms commonly used for producing L-arginine by the current fermentation method are corynebacterium glutamicum, but the corynebacterium glutamicum is limited in L-arginine yield because the corynebacterium glutamicum is subjected to feedback inhibition of intracellular arginine.

Disclosure of Invention

The technical problem to be solved by the invention is how to improve the arginine yield.

In order to solve the technical problems, the invention firstly provides a YH66_01475 mutant.

The YH66_01475 mutant provided by the invention is a protein obtained by mutating the 32 nd amino acid residue of YH66_01475 protein from arginine to other amino acid residues;

the YH 66-01475 protein is any one of the following A1) -A3):

a1 A protein consisting of the amino acid sequence shown in SEQ ID No. 2;

a2 Protein related to bacterial arginine production obtained by substituting and/or deleting and/or adding one or more amino acid residues except the 32 nd amino acid residue in the amino acid sequence shown in A1);

A3 A protein derived from bacteria and having more than 95% identity with A1) or A2) and associated with arginine production by bacteria.

The protein according to A2) above, wherein the substitution and/or deletion and/or addition of one or more amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues.

The term "identity" as used herein in the protein of A3) above refers to sequence similarity to the natural amino acid sequence. "identity" includes amino acid sequences having 95% or more, or 96% or more, or 97% or more, or 98% or more, or 99% or more identity to the amino acid sequence shown in SEQ ID No.2 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to evaluate the identity between related sequences.

The protein described in the above A1), A2) or A3) can be synthesized artificially or can be obtained by synthesizing the coding gene and then biologically expressing.

Further, the YH66_01475 mutant is a protein obtained by mutating the 32 nd amino acid residue of the YH66_01475 protein from arginine to cysteine (corresponding to YH66_01475 ^C94T protein in the examples of the present invention).

Further, the YH 66-01475 mutant (YH 66-01475 ^C94T protein) is a protein composed of the amino acid sequence shown in SEQ ID No. 4.

In order to solve the technical problems, the invention also provides a biological material related to the YH66_01475 mutant.

The biological material related to YH 66-01475 mutant provided by the invention is any one of the following B1) to B4):

b1 Nucleic acid molecules encoding the YH 66-01475 mutants described above;

B2 An expression cassette comprising the nucleic acid molecule of B1);

B3 A recombinant vector comprising the nucleic acid molecule of B1) or a recombinant vector comprising the expression cassette of B2);

B4 A recombinant microorganism comprising the nucleic acid molecule of B1), a recombinant microorganism comprising the expression cassette of B2), or a recombinant microorganism comprising the recombinant vector of B3).

In order to solve the technical problems, the invention also provides novel application of the YH 66-01475 protein or the biological material related to the YH 66-01475 protein or the YH 66-01475 mutant or the biological material related to the YH 66-01475 mutant.

The present invention provides the use of the YH66_01475 protein described above or a biological material associated with the YH66_01475 protein described above or the YH66_01475 mutant described above or a biological material associated with the YH66_01475 mutant described above in any one of X1) to X3) as follows:

X1) regulating bacterial arginine production;

x2) constructing arginine producing engineering bacteria;

X3) preparing arginine;

the biological material related to yh66_01475 protein is any one of the following D1) to D4):

d1 A nucleic acid molecule encoding the YH66_01475 protein;

d2 An expression cassette comprising D1) said nucleic acid molecule;

D3 A recombinant vector comprising D1) said nucleic acid molecule, or a recombinant vector comprising D2) said expression cassette;

D4 A recombinant microorganism comprising D1) said nucleic acid molecule, or a recombinant microorganism comprising D2) said expression cassette, or a recombinant microorganism comprising D3) said recombinant vector.

In the above biological material or application, the nucleic acid molecule encoding YH66_01475 mutant of B1) is any one of the following C1) or C2):

c1 A DNA molecule with a nucleotide sequence of SEQ ID No. 3;

C2 A DNA molecule which is obtained by modifying and/or substituting and/or deleting and/or adding one or more nucleotides of the nucleotide sequence shown in SEQ ID No.3, has more than 90 percent of identity with the DNA molecule shown in C1) and has the same function.

D1 The nucleic acid molecule encoding YH66_01475 protein is any one of E1) or E2) as follows:

e1 A DNA molecule with a nucleotide sequence of SEQ ID No. 1;

E2 A DNA molecule which is obtained by modifying and/or substituting and/or deleting and/or adding one or more nucleotides of the nucleotide sequence shown in SEQ ID No.1, has more than 90 percent of identity with the DNA molecule shown in E1) and has the same function.

Wherein the DNA molecule shown in SEQ ID No.1 is YH 66-01475 gene in Corynebacterium glutamicum (Corynebacterium glutamicum) CGMCC No.20516, and the amino acid sequence of the coded YH 66-01475 protein is shown in SEQ ID No. 2. In the invention, the YH66_01475 ^C94T gene shown in SEQ ID No.3 is obtained by introducing point mutation, and the amino acid sequence of the coded YH66_01475 ^C94T protein is shown in SEQ ID No. 4.

The nucleotide sequence encoding the YH 66-01475 protein or YH 66-01475 mutant of the invention can be easily mutated by a person skilled in the art using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 90% or more identity to the nucleotide sequence encoding the YH66_01475 protein or YH66_01475 mutant are all nucleotide sequences derived from the present invention and are equivalent to the sequences of the present invention as long as they encode the YH66_01475 protein or YH66_01475 mutant and have the same function.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes nucleotide sequences having 90% or more, or 91% or more, or 92% or more, or 93% or more, or 94% or more, or 95% or more, or 96% or more, or 97% or more, or 98% or more, or 99% or more identity with the nucleotide sequence of the protein consisting of the amino acid sequence shown in SEQ ID No.2 or SEQ ID No.4 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to evaluate the identity between related sequences.

The stringent conditions are hybridization in a solution of 2 XSSC, 0.1% SDS at 68℃and washing the membrane 2 times for 5min each; alternatively, hybridization and washing the membrane in 0.5 XSSC, 0.1% SDS solution at 68℃for 15min each; alternatively, hybridization and washing of the membrane were performed at 65℃in a solution of 0.1 XSSPE (or 0.1 XSSC) and 0.1% SDS.

In the above biological materials or applications, the expression cassette of B2) containing the nucleic acid molecule encoding the YH66_01475 mutant refers to DNA capable of expressing the YH66_01475 mutant in a host cell, which DNA may include not only a promoter for initiating transcription of the YH66_01475 mutant gene, but also a terminator for terminating transcription of the YH66_01475 mutant gene. Further, the expression cassette may also include an enhancer sequence. D2 The expression cassette containing a nucleic acid molecule encoding the YH66_01475 protein refers to DNA capable of expressing the YH66_01475 protein in a host cell, which DNA may include not only a promoter that initiates transcription of the YH66_01475 gene, but also a terminator that terminates transcription of the YH66_01475 gene. Further, the expression cassette may also include an enhancer sequence.

In the above biological materials or applications, the vector of B3) or D3) may be a plasmid, cosmid, phage or viral vector. The plasmid may specifically be a pK18mobsacB plasmid or pXMJ plasmid.

In a specific embodiment of the present invention, the recombinant vector is recombinant vector pK 18-YH2_ 01475 ^C94T.

In another embodiment of the invention, the recombinant vector is recombinant vector pK18-YH 66-01475 OE or recombinant vector pK18-YH 66-01475 ^C94T OE.

In yet another embodiment of the present invention, the recombinant vector is recombinant vector pXMJ-YH 66-01475 or recombinant vector pXMJ19-YH 66-01475 ^C94T.

In the above biological material, the microorganism of B4) or D4) may be yeast, bacteria, algae or fungi.

Further, the bacterium may be any bacterium having an arginine producing ability, such as a bacterium from the genus Brevibacterium (Brevibacterium), corynebacterium (Corynebacterium), escherichia, aerobacter (Aerobacter), micrococcus (Micrococcus), flavobacterium (Flavobacterium), or Bacillus, or the like.

Still further, the bacteria include, but are not limited to, corynebacterium glutamicum (Corynebacterium glutamicum), brevibacterium flavum (Brevibacterium flavum), brevibacterium lactofermentum (Brevibacterium lactofermentum), micrococcus glutamicum (Micrococcus glutamicus), brevibacterium ammoniagenes (Brevibacterum ammoniagenes), escherichia coli (ESCHERICHIA COLI), and Aerobacter aerogenes (Aerobacter aerogenes).

In one embodiment of the present invention, the microorganism is Corynebacterium glutamicum (Corynebacterium glutamicum) CGMCC No.20516, the strain is named YPARG01 and has been deposited in China general microbiological culture Collection center (CGMCC) of China Commission for culture Collection of microorganisms (address: beijing Chaoyang North Star West road 1, institute of microorganisms, national academy of sciences) at 8 and 10 of 2020, and the deposit registration number is CGMCC No.20516.

In the above application, the regulation is positive regulation. In particular, when the content or activity of YH 66-01475 protein or YH 66-01475 mutant in bacteria is increased, the arginine production of said bacteria is increased; when yh66_01475 protein content or activity in bacteria is reduced, the bacterial arginine production is reduced.

In order to solve the technical problems, the invention also provides a novel application of a substance for improving the content and/or activity of YH66_01475 protein or YH66_01475 mutant or a substance for improving the expression level of YH66_01475 gene or YH66_01475 mutant gene.

The invention provides the use of a substance which increases the content and/or activity of the YH66_01475 protein or YH66_01475 mutant or of a substance which increases the expression level of the YH66_01475 gene or YH66_01475 mutant gene in any one of the following Y1) to Y3):

y1) increases bacterial arginine production;

Y2) constructing arginine producing engineering bacteria;

Y3) arginine is prepared.

Further, the material for increasing the expression level of YH 66-01475 gene may be YH 66-01475 gene or a recombinant vector containing YH 66-01475 gene.

The material for improving the expression level of the YH66_01475 mutant gene can be a YH66_01475 mutant gene or a recombinant vector containing the YH66_01475 mutant gene.

Further, the recombinant vector containing the yh66_01475 gene may specifically be the recombinant vector pK18-yh66_01475OE or the recombinant vector pXMJ-yh66_ 01475.

The recombinant vector containing the YH66_01475 mutant gene can be specifically the recombinant vector pK18-YH66_01475 ^C94T OE or the recombinant vector pXMJ-YH 66_01475 ^C94T.

In order to solve the technical problems, the invention also provides a method for improving the yield of the bacterial arginine.

The method for improving the bacterial arginine yield provided by the invention is M1) or M2) as follows:

The M1) comprises the following steps: the YH 66-01475 gene in the bacterial genome is replaced by a YH 66-01475 mutant gene, so that the yield of the bacterial arginine is improved;

the M2) comprises the following steps: the content and/or activity of YH 66-01475 protein or YH 66-01475 mutant in bacteria are improved, or the expression level of YH 66-01475 gene or YH 66-01475 mutant gene in bacteria is improved, so that the yield of arginine in bacteria is improved.

In order to solve the technical problems, the invention also provides a construction method of the arginine producing engineering bacteria.

The construction method of the arginine producing engineering bacteria provided by the invention is as follows N1) or N2):

The N1) comprises the following steps: replacing YH 66-01475 genes in bacterial genome with YH 66-01475 mutant genes to obtain the arginine-producing engineering bacteria;

The N2) comprises the steps of: increasing the content and/or activity of YH 66-01475 protein or YH 66-01475 mutant in bacteria or increasing the gene expression level of YH 66-01475 gene or YH 66-01475 mutant in bacteria to obtain the arginine producing engineering bacteria;

In any of the above applications or methods, the YH66_01475 mutant is specifically YH66_01475 ^C94T protein, and specifically a protein composed of the amino acid sequence shown in SEQ ID No. 4.

The YH 66-01475 mutant gene is specifically YH 66-01475 ^C94T gene, and specifically a DNA molecule shown in SEQ ID No. 3.

The application of the arginine producing engineering bacteria constructed by the construction method of the arginine producing engineering bacteria in preparing arginine also belongs to the protection scope of the invention.

In order to solve the technical problems, the invention finally provides a method for preparing arginine.

The method for preparing arginine provided by the invention comprises the following steps: fermenting and culturing the arginine-producing engineering bacteria constructed according to the construction method of the arginine-producing engineering bacteria to obtain the arginine.

The fermentation culture method may be performed according to a conventional test method in the prior art. Conventional test methods after optimization and improvement can also be used. The culture medium used for the fermentation culture is shown in Table 3 in the examples. The fermentation culture conditions are shown in Table 4 in the examples.

In any of the above applications or methods, the arginine is specifically L-arginine.

The invention firstly obtains the YH66_01475 ^C94T gene by carrying out single-point mutation on the YH66_01475 gene, and then discovers that the YH66_01475 gene or the mutant gene thereof can regulate and control the L-arginine yield of bacteria by carrying out fermentation culture on the constructed YH66_01475 or the over-expression recombinant strain of the mutant gene and the YH66_01475 knockout recombinant strain. The YH 66-01475 gene is found to participate in the biosynthesis of arginine for the first time, and has great application value for cultivating high-yield and high-quality strains conforming to industrial production and industrial production of arginine.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

EXAMPLE 1 construction of recombinant vector containing coding region of YH 66-01475 Gene containing Point mutation

According to NCBI published genomic sequence of Brevibacterium flavum (Brevibacterium flavum) ATCC15168, two pairs of primers for amplifying the coding region of YH66_01475 gene were designed and synthesized, and a point mutation was introduced into the coding region (SEQ ID No. 1) of YH66_01475 gene of Corynebacterium glutamicum (Corynebacterium glutamicum) CGMCC 20516 (the wild type YH66_01475 gene was confirmed to remain on the chromosome of the strain by sequencing) in an allele substitution manner, the point mutation being mutation of the 94 th cytosine (C) in the nucleotide sequence (SEQ ID No. 1) of YH66_01475 gene to thymine (T), to obtain a DNA molecule (mutated YH66_01475 gene) shown in SEQ ID No.3, and named YH66_01475 ^C94T.

Wherein the DNA molecule shown in SEQ ID No.1 encodes a protein with the amino acid sequence of SEQ ID No.2 (the name of the protein is protein YH 66-01475). The DNA molecule shown in SEQ ID No.3 encodes a mutein of the amino acid sequence SEQ ID No.4 (said mutein being named YH 66-01475 ^C94T). The 32 nd cysteine (C) in the amino acid sequence (SEQ ID No. 4) of the mutant protein YH 66-01475 ^C94T is mutated from arginine (R).

Site-directed mutagenesis of the gene was performed using NEBuilder recombination techniques, and the primers were designed as follows (synthesized by Invitrogen, shanghai), with the base in bold red as the mutation site:

P1：5'-CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGAGTTGGATCCATGACCT-3'；

P2：

P3：

P4：5'-CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCTACGGCCTAATCCTCACCGC-3'。

The construction method comprises the following steps: PCR amplification is carried out by taking Brevibacterium flavum ATCC15168 as a template and adopting primers P1/P2 and P3/P4 respectively to obtain two DNA fragments (YH 66-01475 Up and YH 66-01475 Down) with mutation bases and YH 66-01475 gene coding regions with the sizes of 670bp and 668bp respectively.

The PCR amplification system is as follows: 10 XEx Taq Buffer 5. Mu.L, dNTP mix (2.5 mM each) 4. Mu.L, mg ²⁺ (25 mM) 4. Mu.L, primer (10 pM) 2. Mu.L each, ex Taq (5U/. Mu.L) 0.25. Mu.L, and total volume 50. Mu.L.

The PCR amplification reaction procedure was: pre-denaturation at 94℃for 5min, (denaturation at 94℃for 30s; annealing at 52℃for 30s; extension at 72℃for 40s;30 cycles), over-extension at 72℃for 10min.

The two DNA fragments (YH 66-01475 Up and YH 66-01475 Down) were separated and purified by agarose gel electrophoresis, and then ligated with the pK18mobsacB plasmid (obtained from Addgene, inc., digested with Xbal I/BamH I) purified by digestion (Xbal I/BamH I) at 50℃for 30 minutes using NEBuilder enzyme (obtained from NEB, inc.), and the resultant monoclonal obtained after transformation of the ligation product was identified by PCR to obtain a positive recombinant vector pK18-YH 66-01475 ^C94T containing a kanamycin resistance marker. The recombinant vector pK18-YH66_01475 ^C94T with correct restriction enzyme was sent to sequencing company for sequencing and identification, and the recombinant vector pK18-YH66_01475 ^C94T containing the correct point mutation (C-T) was stored for later use.

The YH66_01475 ^C94T Up-Down DNA fragment (YH66_ 01475Up-Down, SEQ ID No. 5) in the recombinant vector pK18-YH66_01475 ^C94T has a size of 1304bp, and can cause mutation of cytosine (C) at position 94 of the YH66_01475 gene coding region in the strain Corynebacterium glutamicum CGMCC 20516 to thymine (T) due to the mutation site, and finally cause arginine (R) at position 32 of the encoded protein to be changed to cysteine (C).

The recombinant vector pK18-YH66_01475 ^C94T is a recombinant vector obtained by replacing a fragment (small fragment) between Xbal I and/or BamH I recognition sites of the pK18mobsacB vector with a DNA fragment shown at positions 37-1266 of SEQ ID No.5 in the sequence Listing, and keeping the other sequences of the pK18mobsacB vector unchanged.

Recombinant vector pK18-YH66_01475 ^C94T contains the DNA molecule shown in positions 1-714 of mutant gene YH66_01475 ^C94T shown in SEQ ID No. 3.

Example 2 construction of an engineering Strain comprising the Gene YH 66-01475 ^C94T

The construction method comprises the following steps: the allelic substitution plasmid (pK 18-YH66_01475 ^C94T) in example 1 was transformed into Corynebacterium glutamicum (Corynebacterium glutamicum) CGMCC 20516 by electric shock, and then cultured in a medium, the composition of the medium and the culture conditions are shown in Table 1, and single colonies generated by the culture were identified by the primer P1 and the universal primer M13R in example 1, respectively, so that the strain capable of amplifying 1311bp size band was a positive strain. Positive strains were cultured on a medium containing 15% sucrose, single colonies generated by the culture were cultured on a medium containing kanamycin and a medium not containing kanamycin, respectively, strains grown on a medium not containing kanamycin were selected, and strains not grown on a medium containing kanamycin were further identified by PCR using the following primers (synthesized by shanghai invitrogen corporation):

P5：5'-TCAACAGCACACCACTGAGG-3'；

P6：5'-GTCGTGGACCCACCCAAAAC-3'。

The PCR amplified product (259 bp) obtained was subjected to SSCP (Single-Strand Conformation Polymorphis) electrophoresis (plasmid pK18-YH 66-01475 ^C94T amplified fragment was used as positive control, brevibacterium flavum ATCC15168 amplified fragment was used as negative control, and water was used as blank control) after denaturing at a high temperature of 95℃for 10min and ice bath for 5min, and the preparation of PAGE and electrophoresis conditions of SSCP electrophoresis were as shown in Table 2, and the electrophoresis positions were different due to the difference of the fragment structures, so that the strain with the fragment electrophoresis position inconsistent with the position of the negative control fragment and consistent with the position of the positive control fragment was the strain with successful allelic replacement. The positive strain YH 66-01475 gene fragment was amplified again by primer P5/P6 PCR and ligated to PMD19-T vector for sequencing, and the strain with mutation in the base sequence (C-T) was the positive strain with successful allelic replacement by sequence alignment and designated YPR-055.

Recombinant YPR-055 contains mutated gene YH 66-01475 ^C94T shown in SEQ ID No. 3.

TABLE 1 composition of the culture medium and culture conditions

Composition of the components	Formulation of
		Sucrose	10g/L
Polypeptone	10g/L
		Beef extract	10g/L
Yeast powder	5g/L
		Urea	2g/L
Sodium chloride	2.5g/L
		Agar powder	20g/L
Water and its preparation method
		pH	7.0
Culture conditions	32℃

TABLE 2 preparation of PAGE for SSCP electrophoresis and electrophoresis conditions

Example 3 construction of engineering strains on genomes overexpressing the YH 66-01475 Gene or the YH 66-01475 ^C94T Gene

According to the genome sequence of Brevibacterium flavum ATCC15168 published by NCBI, three pairs of primers for amplifying an upstream and downstream homologous arm fragment and a coding region and a promoter region of YH 66-01475 or YH 66-01475 ^C94T gene are designed and synthesized, and YH 66-01475 or YH 66-01475 ^C94T genes are introduced into corynebacterium glutamicum CGMCC 20516 in a homologous recombination mode.

Primers were designed as follows (synthesized by the company epivitrogen, shanghai):

P7：5'-CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCATGACGGCTGACTGGACTC-3'；

P8：5'-TCCTGGCTGG CGGCGTTTAAAATCGGACTC CTTAAATGGG-3'；

P9：5'-CCCATTTAAG GAGTCCGATTTTAAACGCCG CCAGCCAGGA-3'；

P10：5'-CTATGTGAGT AGTCGATTTAAACTCCAAAG TTCCCCCCCG-3'；

P11：5'-CGGGGGGGAA CTTTGGAGTTTAAATCGACT ACTCACATAG-3'；

P12：5'-CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCTGCATAAGAAACAACCACTT-3'。

The construction method comprises the following steps: the method comprises the steps of respectively carrying out PCR amplification by using Brevibacterium flavum ATCC15168 or YPR-055 as a template and respectively adopting primers P7/P8, P9/P10 and P11/P12 to obtain an upstream homology arm segment 806bp (corresponding to a corynebacterium glutamicum CGMCC 20516YH66_03350 gene and a promoter region thereof or a spacer region with the last gene, a sequence is shown as SEQ ID No. 6), a YH66_01475 gene and a promoter segment 2146bp (a sequence is shown as SEQ ID No. 7) or a YH66_01475 ^C94T gene and a promoter segment 2146bp (a sequence is shown as SEQ ID No. 8) and a downstream homology arm segment 783bp (corresponding to a corynebacterium glutamicum CGMCC 20516YH66_03355 gene and a partial spacer region with the YH66_03350 gene, and a sequence is shown as SEQ ID No. 9). After the PCR reaction is finished, 3 fragments obtained by amplifying each template are respectively subjected to electrophoresis recovery by adopting a column type DNA gel recovery kit. The 3 fragments recovered were ligated with the purified pK18mobsacB plasmid (from Addgene) digested with Xbal I/BamH I at 50℃for 30min, and the resultant single clone was transformed with the NEBuilder enzyme (from NEB) and identified by PCR using M13 primer to obtain positive integrative plasmids (recombinant vectors) containing kanamycin resistance markers, pK18-YH 66-01475 OE and pK18-YH 66-01475 ^C94T OE, respectively, and recombinants were obtained by integrating the plasmids into the genome by kanamycin screening.

The PCR reaction system is as follows: 10 XEx Taq Buffer 5. Mu.L, dNTP mix (2.5 mM each) 4. Mu.L, mg ²⁺ (25 mM) 4. Mu.L, primer (10 pM) 2. Mu.L each, ex Taq (5U/. Mu.L) 0.25. Mu.L, and total volume 50. Mu.L.

The PCR reaction procedure was: pre-denaturing for 5min at 94℃and denaturing for 30s at 94 ℃; annealing at 52 ℃ for 30s; extending at 72℃for 60s (30 cycles), and over-extending at 72℃for 10min.

The integrated plasmids (pK 18-YH 66-01475 OE and pK18-YH 66-01475 ^C94T OE) with correct sequence are respectively and electrically transformed into Corynebacterium glutamicum CGMCC 20516, cultured in a culture medium, the components and culture conditions of the culture medium are shown in Table 1, single colonies generated by the culture are identified by PCR through P13/P14 primers, the strain containing 2167bp fragments is amplified by PCR as positive strain, and the strain without fragments amplified is primordium. The positive strain is cultivated on a culture medium containing 15% of sucrose, single colony generated by cultivation is further subjected to PCR identification by using a P15/P16 primer, and the strain amplified into 1669bp fragments is positive strain of YH 66-01475 or YH 66-01475 ^C94T gene integrated on the genome of corynebacterium glutamicum CGMCC 20516, which are named YPR-056 (without mutation point) and YPR-057 (with mutation point), respectively.

Recombinant bacterium YPR-056 contains double copies of YH 66-01475 gene shown in SEQ ID No. 1; specifically, the recombinant strain YPR-056 is obtained by replacing the spacer region of the upper homology arm YH 66-03350 and the lower homology arm YH 66-03355 in the genome of the corynebacterium glutamicum CGMCC 20516 with YH 66-01475 gene and keeping other nucleotides in the genome of the corynebacterium glutamicum CGMCC 20516 unchanged. The recombinant bacterium containing the double-copy YH 66-01475 gene can obviously and stably improve the expression level of the YH 66-01475 gene.

Recombinant bacterium YPR-057 contains mutant YH 66-01475 ^C94T gene shown as SEQ ID No. 3; specifically, the recombinant strain YPR-057 is obtained by replacing the spacer region of the upper homology arm YH 66-03350 and the lower homology arm YH 66-03355 in the genome of the corynebacterium glutamicum CGMCC 20516 with YH 66-01475 ^C94T gene and keeping other nucleotides in the genome of the corynebacterium glutamicum CGMCC 20516 unchanged.

The PCR identification primers are shown below:

P13:5'-GTCCGCTCTGTTGGTGTTCA-3' (corresponding to the outside of upper homology arm yh66_03350);

P14:5'-GCAACGTGGTGTTCCGCATG-3' (corresponding to inside YH 66-01475 gene);

p15:5'-CCAGCGCCAGTTGGTGTCTG-3' (corresponding to inside YH 66-01475 gene);

P16:5'-TGGAGGAATATTCGGCCCAG-3' (corresponding to the outer side of the lower homology arm YH66_ 03355).

Example 4 construction of engineering strains over-expressing YH 66-01475 Gene or YH 66-01475 ^C94T Gene on plasmids

According to the NCBI published genomic sequence of Brevibacterium flavum ATCC15168, a pair of primers for amplifying the coding region and the promoter region of YH66_01475 or YH66_01475 ^C94T gene were designed and synthesized as follows (synthesized by Shanghai Invitrogen):

p17:5'-GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCTTAAACGCCGCCAGCCAGGA-3' (underlined nucleotide sequence is the sequence on pXMJ);

P18:5'-ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACAACTCCAAAGTTCCCCCCCG-3' (underlined nucleotide sequence is the sequence on pXMJ).

The construction method comprises the following steps: the preparation method comprises the steps of respectively carrying out PCR amplification by using Brevibacterium flavum ATCC15168 or YPR-055 as a template and adopting a primer P17/P18 to obtain a YH66_01475 gene with the size of 2176bp and a promoter fragment thereof (the sequence is shown as SEQ ID No. 12) and a YH66_01475 ^C94T gene and a promoter fragment thereof (the sequence is shown as SEQ ID No. 13), carrying out electrophoresis on amplified products, purifying and recovering the amplified products by using a column type DNA gel recovery kit, connecting the recovered DNA fragments with a shuttle plasmid pXMJ19 obtained by EcoRI digestion by using NEBuilder enzyme (purchased from NEB company) at 50 ℃ for 30min, carrying out PCR identification on a monoclonal M13 primer obtained after conversion of the connected products to obtain positive over-expression plasmids pXMJ-YH 66_01475 (containing YH66_01475 genes) and pXMJ-YH 66_01475 ^C94T (containing YH66_01475 ^C94T genes), and sequencing the plasmids. Since the plasmid contains a chloramphenicol resistance marker, it is possible to select whether the plasmid is transformed into a strain by chloramphenicol.

The PCR reaction procedure was: pre-denaturing for 5min at 94℃and denaturing for 30s at 94 ℃; annealing at 52 ℃ for 30s; extending at 72℃for 120s (30 cycles), and over-extending at 72℃for 10min.

The correctly sequenced pXMJ-YH 66-01475 and pXMJ19-YH 66-01475 ^C94T plasmids were respectively electrotransformed into Corynebacterium glutamicum CGMCC 20516, cultured in medium, the medium composition and culture conditions are shown in Table 1, single colonies generated by the culture were identified by PCR with the primers M13R (-48)/P18, and strains containing 2215bp fragments were amplified as positive strains, which were designated YPR-058 (without mutation point) and YPR-059 (with mutation point).

Recombinant bacterium YPR-058 contains YH66_01475 gene shown in SEQ ID No. 1; recombinant YPR-059 contains the mutated YH 66-01475 ^C94T gene shown in SEQ ID No. 3.

Example 5 construction of an engineering Strain with deletion of YH 66-01475 Gene on genome

Two pairs of primers for amplifying the two end fragments of the coding region of YH 66-01475 gene were synthesized as upstream and downstream homology arm fragments according to the genomic sequence of Brevibacterium flavum ATCC15168 published by NCBI. Primers were designed as follows (synthesized by the company epivitrogen, shanghai):

P19：5'-CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAATTCCCTGTCGGTGAAGCA-3'；

P20：5'-TTTTAAGAAGGTTGAACACAGCTTTACGACGCCTCCCCCT-3'；

P21：5'-AGGGGGAGGCGTCGTAAAGCTGTGTTCAACCTTCTTAAAA-3'；

P22：5'-CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCTGTCCAAAGCCGCGGTGGAT-3'。

the construction method comprises the following steps: PCR amplification was performed using Brevibacterium flavum ATCC15168 as a template and the primers P19/P20 and P21/P22, respectively, to obtain 660bp of the upstream homology arm fragment of YH 66-01475 and 642bp of the downstream homology arm fragment of YH 66-01475. The amplified products were electrophoresed and purified using a column type DNA gel recovery kit, and the recovered DNA fragment was ligated with pK18mobsacB plasmid (purchased from Addgene Co.) purified after Xbal I/BamH I cleavage, which contained the entire knockout YH 66-01475 homology arm fragment 1262bp (sequence shown in SEQ ID No. 14) and kanamycin resistance as selection markers, using NEBuilder enzyme (purchased from NEB Co.) at 50℃for 30min, and the resulting monoclonal M13 primer after ligation product transformation was subjected to PCR identification to obtain a positive knockout vector pK 18-. DELTA.YH2-01475, which was sequenced.

The PCR amplification reaction system is as follows: 10 XEx Taq Buffer 5. Mu.L, dNTP mix (2.5 mM each) 4. Mu.L, mg ²⁺ (25 mM) 4. Mu.L, primer (10 pM) 2. Mu.L each, ex Taq (5U/. Mu.L) 0.25. Mu.L, and total volume 50. Mu.L.

The PCR amplification reaction procedure was: pre-denaturing for 5min at 94℃and denaturing for 30s at 94 ℃; annealing at52 ℃ for 30s; extending at 72 ℃ for 90s (30 cycles), and overextensing at 72 ℃ for 10min.

The knock-out plasmid pK 18-DeltaYH66_ 01475 which was sequenced correctly was electrotransformed into Corynebacterium glutamicum CGMCC 20516, cultured in medium, the medium composition and culture conditions are shown in Table 1, and single colonies generated by the culture were identified by PCR using the following primers (synthesized by Shanghai in vitro Co.).

P23:5'-AATTCCCTGTCGGTGAAGCA-3' (corresponding to the encoding region of the Corynebacterium glutamicum CGMCC 20516YH66_01470 gene);

P24:5'-TGTCCAAAGCCGCGGTGGAT-3' (corresponding to the coding region of the Corynebacterium glutamicum CGMCC 20516YH66_01480 gene).

The PCR simultaneously amplifies the strains with the bands of 1188bp and 3039bp to be positive strains, and only the strains with the bands of 3039bp to be primordial strains. Positive strains are respectively cultured on a medium containing kanamycin and a medium not containing kanamycin after being screened on a 15% sucrose medium, the strains which do not grow on the medium not containing kanamycin are selected to grow on the medium not containing kanamycin, and the strains which do not grow on the medium containing kanamycin are further identified by PCR (polymerase chain reaction) by adopting a P23/P24 primer, so that the strain with the 1188bp band is amplified to be the positive strain with the YH66_01475 gene coding region knocked out. The positive strain YH 66-01475 fragment was amplified again by PCR with the P23/P24 primer and ligated into the pMD19-T vector for sequencing, the correctly sequenced strain was designated YPR-060.

The recombinant strain YPR-060 is obtained by knocking out YH66_01475 gene on the genome of the corynebacterium glutamicum CGMCC 20516 and keeping other nucleotides in the genome of the corynebacterium glutamicum CGMCC 20516 unchanged.

Example 6L-arginine fermentation experiment

The strains constructed in the above examples and the original strain Corynebacterium glutamicum CGMCC 20516 were subjected to fermentation experiments in a BLBIO-5GC-4-H type fermenter (available from Shanghai Biotechnology Co., ltd.) with the culture medium shown in Table 3 and the control process shown in Table 4. Each strain was repeated three times and the results are shown in table 5.

As shown in Table 5, the gene coding region of YH 66-01475 was subjected to point mutation YH 66-01475 ^C94T and overexpression in Corynebacterium glutamicum, which contributed to the improvement of L-arginine production and conversion rate, while the gene was knocked out or weakened, which was detrimental to the accumulation of L-arginine.

TABLE 3 fermentation Medium formulation (balance water)

TABLE 4 fermentation control Process

TABLE 5L-arginine fermentation test results

Strain	OD_562nm	L-arginine production (g/L)
			Corynebacterium glutamicum CGMCC 20516	75.3	87.9
YPR-055	76.9	89.1
			YPR-056	76.6	89.1
YPR-057	76.8	89.3
			YPR-058	77.9	89.2
YPR-059	77.4	89.4
			YPR-060	73.2	86.3

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Sequence listing

<110> Ningxia Yipin biotechnology Co., ltd

<120> YH66_01475 protein and application of encoding gene thereof in regulating and controlling bacterial arginine yield

<160> 14

<170> PatentIn version 3.5

<210> 1

<211> 1851

<212> DNA

<213> Artificial Sequence

<400> 1

atgtctccta acgatgcatt catctccgca cctgccaaga tcgaaacccc agttgggcct 60

cgcaatgaag gccagccagc atggaataag cagcgtggct cctcaatgcc agttaaccgc 120

tacatgcctt tcgaggttga ggtagaagat atttctctgc cggaccgcac ttggccagat 180

aaaaaaatca ccgttgcacc tcagtggtgt gctgttgacc tgcgtgacgg caaccaggct 240

ctgattgatc cgatgtctcc tgagcgtaag cgccgcatgt ttgagctgct ggttcagatg 300

ggattcaagg aaatcgaggt cggtttccct tcagcttccc agactgattt tgatttcgtt 360

cgtgagatca tcgaaaagga catgatccct gacgatgtca ccattcaggt tctggttcag 420

gctcgtgagc acctgattcg ccgtactttt gaagcttgcg aaggcgcaaa aaacgttatc 480

gtgcacttct acaactcaac ctccatcctg cagcgcaacg tggtgttccg catggacaag 540

gtgcaggtga agaagctggc taccgatgcc gctgaactga tcaagaccgt cgctcaggat 600

tacccagaca ccaactggcg ctggcagtac tcccctgagt ccttcaccgg cactgaggtt 660

gagtacgcca aggaagttgt ggacgcagtt gttgaggtca tggatccaac tcctgagaac 720

ccaatgatca tcaacctgcc tttcaccgtt gagatgatca cccctaacgt ttacgcagac 780

tccattgaat ggatgcaccg caatctaaac cgtcgtgatt ccattatcct gtccctgcac 840

ccgcacaatg accgtggcac cggcgttggc gcagctgagc tgggctacat ggctggcgct 900

gaccgcatcg aaggctgcct gttcggcaac ggcgagcgca ccggcaacgt ctgcctggtc 960

accctggcac tgaacatgct gacccagggc gttgaccctc agctggactt caccgatata 1020

cgccagatcc gcagcaccgt tgaatactgc aaccagctgc gcgttcctga gcgccaccca 1080

tacggcggcg acctggtctt caccgctttc tccggttccc accaggacgc tgtgaacaag 1140

ggtctggacg ccatggctgc caaggttcag ccaggtgcta gctccactga agtttcttgg 1200

gagcagctgc gcgacaccga atgggaggtt ccttacctgc ctatcgatcc aaaggatgtc 1260

ggtcgcgact acgaggctgt tatccgcgtg aactcccagt ccggcaaggg cggcgttgct 1320

tacatcatga agaccgatca cggtctgcag atccctcgct ccatgcaggt tgagttctcc 1380

accgttgtcc agaacgtcac cgacgctgag ggcggcgagg tcaactccaa ggcaatgtgg 1440

gatatcttcg ccaccgagta cctggagcgc accgcaccag ttgagcagat cgcgctgcgc 1500

gtcgagaacg ctcagaccga aaacgaggat gcatccatca ccgccgagct catccacaac 1560

ggcaaggacg tcaccgtcga tggccacggc aacggcccac tggctgctta cgccaacgcg 1620

ctggagaagc tgggcatcga cgttgagatc caggaataca accagcacgc ccgcacctcg 1680

ggcgacgatg cagaagcagc cgcctacgtg ctggctgagg tcaacggccg caaggtctgg 1740

ggcgtcggca tcgctggctc catcacctac gcttcgctga aggcagtgac ctccgccgta 1800

aaccgcgcgc tggacgtcaa ccacgaggca gtcctggctg gcggcgttta a 1851

<210> 2

<211> 616

<212> PRT

<213> Artificial Sequence

<400> 2

Met Ser Pro Asn Asp Ala Phe Ile Ser Ala Pro Ala Lys Ile Glu Thr

1 5 10 15

Pro Val Gly Pro Arg Asn Glu Gly Gln Pro Ala Trp Asn Lys Gln Arg

20 25 30

Gly Ser Ser Met Pro Val Asn Arg Tyr Met Pro Phe Glu Val Glu Val

35 40 45

Glu Asp Ile Ser Leu Pro Asp Arg Thr Trp Pro Asp Lys Lys Ile Thr

50 55 60

Val Ala Pro Gln Trp Cys Ala Val Asp Leu Arg Asp Gly Asn Gln Ala

65 70 75 80

Leu Ile Asp Pro Met Ser Pro Glu Arg Lys Arg Arg Met Phe Glu Leu

85 90 95

Leu Val Gln Met Gly Phe Lys Glu Ile Glu Val Gly Phe Pro Ser Ala

100 105 110

Ser Gln Thr Asp Phe Asp Phe Val Arg Glu Ile Ile Glu Lys Asp Met

115 120 125

Ile Pro Asp Asp Val Thr Ile Gln Val Leu Val Gln Ala Arg Glu His

130 135 140

Leu Ile Arg Arg Thr Phe Glu Ala Cys Glu Gly Ala Lys Asn Val Ile

145 150 155 160

Val His Phe Tyr Asn Ser Thr Ser Ile Leu Gln Arg Asn Val Val Phe

165 170 175

Arg Met Asp Lys Val Gln Val Lys Lys Leu Ala Thr Asp Ala Ala Glu

180 185 190

Leu Ile Lys Thr Val Ala Gln Asp Tyr Pro Asp Thr Asn Trp Arg Trp

195 200 205

Gln Tyr Ser Pro Glu Ser Phe Thr Gly Thr Glu Val Glu Tyr Ala Lys

210 215 220

Glu Val Val Asp Ala Val Val Glu Val Met Asp Pro Thr Pro Glu Asn

225 230 235 240

Pro Met Ile Ile Asn Leu Pro Phe Thr Val Glu Met Ile Thr Pro Asn

245 250 255

Val Tyr Ala Asp Ser Ile Glu Trp Met His Arg Asn Leu Asn Arg Arg

260 265 270

Asp Ser Ile Ile Leu Ser Leu His Pro His Asn Asp Arg Gly Thr Gly

275 280 285

Val Gly Ala Ala Glu Leu Gly Tyr Met Ala Gly Ala Asp Arg Ile Glu

290 295 300

Gly Cys Leu Phe Gly Asn Gly Glu Arg Thr Gly Asn Val Cys Leu Val

305 310 315 320

Thr Leu Ala Leu Asn Met Leu Thr Gln Gly Val Asp Pro Gln Leu Asp

325 330 335

Phe Thr Asp Ile Arg Gln Ile Arg Ser Thr Val Glu Tyr Cys Asn Gln

340 345 350

Leu Arg Val Pro Glu Arg His Pro Tyr Gly Gly Asp Leu Val Phe Thr

355 360 365

Ala Phe Ser Gly Ser His Gln Asp Ala Val Asn Lys Gly Leu Asp Ala

370 375 380

Met Ala Ala Lys Val Gln Pro Gly Ala Ser Ser Thr Glu Val Ser Trp

385 390 395 400

Glu Gln Leu Arg Asp Thr Glu Trp Glu Val Pro Tyr Leu Pro Ile Asp

405 410 415

Pro Lys Asp Val Gly Arg Asp Tyr Glu Ala Val Ile Arg Val Asn Ser

420 425 430

Gln Ser Gly Lys Gly Gly Val Ala Tyr Ile Met Lys Thr Asp His Gly

435 440 445

Leu Gln Ile Pro Arg Ser Met Gln Val Glu Phe Ser Thr Val Val Gln

450 455 460

Asn Val Thr Asp Ala Glu Gly Gly Glu Val Asn Ser Lys Ala Met Trp

465 470 475 480

Asp Ile Phe Ala Thr Glu Tyr Leu Glu Arg Thr Ala Pro Val Glu Gln

485 490 495

Ile Ala Leu Arg Val Glu Asn Ala Gln Thr Glu Asn Glu Asp Ala Ser

500 505 510

Ile Thr Ala Glu Leu Ile His Asn Gly Lys Asp Val Thr Val Asp Gly

515 520 525

His Gly Asn Gly Pro Leu Ala Ala Tyr Ala Asn Ala Leu Glu Lys Leu

530 535 540

Gly Ile Asp Val Glu Ile Gln Glu Tyr Asn Gln His Ala Arg Thr Ser

545 550 555 560

Gly Asp Asp Ala Glu Ala Ala Ala Tyr Val Leu Ala Glu Val Asn Gly

565 570 575

Arg Lys Val Trp Gly Val Gly Ile Ala Gly Ser Ile Thr Tyr Ala Ser

580 585 590

Leu Lys Ala Val Thr Ser Ala Val Asn Arg Ala Leu Asp Val Asn His

595 600 605

Glu Ala Val Leu Ala Gly Gly Val

610 615

<210> 3

<211> 1851

<212> DNA

<213> Artificial Sequence

<400> 3

atgtctccta acgatgcatt catctccgca cctgccaaga tcgaaacccc agttgggcct 60

cgcaatgaag gccagccagc atggaataag cagtgtggct cctcaatgcc agttaaccgc 120

tacatgcctt tcgaggttga ggtagaagat atttctctgc cggaccgcac ttggccagat 180

aaaaaaatca ccgttgcacc tcagtggtgt gctgttgacc tgcgtgacgg caaccaggct 240

ctgattgatc cgatgtctcc tgagcgtaag cgccgcatgt ttgagctgct ggttcagatg 300

ggattcaagg aaatcgaggt cggtttccct tcagcttccc agactgattt tgatttcgtt 360

cgtgagatca tcgaaaagga catgatccct gacgatgtca ccattcaggt tctggttcag 420

gctcgtgagc acctgattcg ccgtactttt gaagcttgcg aaggcgcaaa aaacgttatc 480

gtgcacttct acaactcaac ctccatcctg cagcgcaacg tggtgttccg catggacaag 540

gtgcaggtga agaagctggc taccgatgcc gctgaactga tcaagaccgt cgctcaggat 600

tacccagaca ccaactggcg ctggcagtac tcccctgagt ccttcaccgg cactgaggtt 660

gagtacgcca aggaagttgt ggacgcagtt gttgaggtca tggatccaac tcctgagaac 720

ccaatgatca tcaacctgcc tttcaccgtt gagatgatca cccctaacgt ttacgcagac 780

tccattgaat ggatgcaccg caatctaaac cgtcgtgatt ccattatcct gtccctgcac 840

ccgcacaatg accgtggcac cggcgttggc gcagctgagc tgggctacat ggctggcgct 900

gaccgcatcg aaggctgcct gttcggcaac ggcgagcgca ccggcaacgt ctgcctggtc 960

accctggcac tgaacatgct gacccagggc gttgaccctc agctggactt caccgatata 1020

cgccagatcc gcagcaccgt tgaatactgc aaccagctgc gcgttcctga gcgccaccca 1080

tacggcggcg acctggtctt caccgctttc tccggttccc accaggacgc tgtgaacaag 1140

ggtctggacg ccatggctgc caaggttcag ccaggtgcta gctccactga agtttcttgg 1200

gagcagctgc gcgacaccga atgggaggtt ccttacctgc ctatcgatcc aaaggatgtc 1260

ggtcgcgact acgaggctgt tatccgcgtg aactcccagt ccggcaaggg cggcgttgct 1320

tacatcatga agaccgatca cggtctgcag atccctcgct ccatgcaggt tgagttctcc 1380

accgttgtcc agaacgtcac cgacgctgag ggcggcgagg tcaactccaa ggcaatgtgg 1440

gatatcttcg ccaccgagta cctggagcgc accgcaccag ttgagcagat cgcgctgcgc 1500

gtcgagaacg ctcagaccga aaacgaggat gcatccatca ccgccgagct catccacaac 1560

ggcaaggacg tcaccgtcga tggccacggc aacggcccac tggctgctta cgccaacgcg 1620

ctggagaagc tgggcatcga cgttgagatc caggaataca accagcacgc ccgcacctcg 1680

ggcgacgatg cagaagcagc cgcctacgtg ctggctgagg tcaacggccg caaggtctgg 1740

ggcgtcggca tcgctggctc catcacctac gcttcgctga aggcagtgac ctccgccgta 1800

aaccgcgcgc tggacgtcaa ccacgaggca gtcctggctg gcggcgttta a 1851

<210> 4

<211> 616

<212> PRT

<213> Artificial Sequence

<400> 4

Met Ser Pro Asn Asp Ala Phe Ile Ser Ala Pro Ala Lys Ile Glu Thr

1 5 10 15

Pro Val Gly Pro Arg Asn Glu Gly Gln Pro Ala Trp Asn Lys Gln Cys

20 25 30

Gly Ser Ser Met Pro Val Asn Arg Tyr Met Pro Phe Glu Val Glu Val

35 40 45

Glu Asp Ile Ser Leu Pro Asp Arg Thr Trp Pro Asp Lys Lys Ile Thr

50 55 60

Val Ala Pro Gln Trp Cys Ala Val Asp Leu Arg Asp Gly Asn Gln Ala

65 70 75 80

Leu Ile Asp Pro Met Ser Pro Glu Arg Lys Arg Arg Met Phe Glu Leu

85 90 95

Leu Val Gln Met Gly Phe Lys Glu Ile Glu Val Gly Phe Pro Ser Ala

100 105 110

Ser Gln Thr Asp Phe Asp Phe Val Arg Glu Ile Ile Glu Lys Asp Met

115 120 125

Ile Pro Asp Asp Val Thr Ile Gln Val Leu Val Gln Ala Arg Glu His

130 135 140

Leu Ile Arg Arg Thr Phe Glu Ala Cys Glu Gly Ala Lys Asn Val Ile

145 150 155 160

Val His Phe Tyr Asn Ser Thr Ser Ile Leu Gln Arg Asn Val Val Phe

165 170 175

Arg Met Asp Lys Val Gln Val Lys Lys Leu Ala Thr Asp Ala Ala Glu

180 185 190

Leu Ile Lys Thr Val Ala Gln Asp Tyr Pro Asp Thr Asn Trp Arg Trp

195 200 205

Gln Tyr Ser Pro Glu Ser Phe Thr Gly Thr Glu Val Glu Tyr Ala Lys

210 215 220

Glu Val Val Asp Ala Val Val Glu Val Met Asp Pro Thr Pro Glu Asn

225 230 235 240

Pro Met Ile Ile Asn Leu Pro Phe Thr Val Glu Met Ile Thr Pro Asn

245 250 255

Val Tyr Ala Asp Ser Ile Glu Trp Met His Arg Asn Leu Asn Arg Arg

260 265 270

Asp Ser Ile Ile Leu Ser Leu His Pro His Asn Asp Arg Gly Thr Gly

275 280 285

Val Gly Ala Ala Glu Leu Gly Tyr Met Ala Gly Ala Asp Arg Ile Glu

290 295 300

Gly Cys Leu Phe Gly Asn Gly Glu Arg Thr Gly Asn Val Cys Leu Val

305 310 315 320

Thr Leu Ala Leu Asn Met Leu Thr Gln Gly Val Asp Pro Gln Leu Asp

325 330 335

Phe Thr Asp Ile Arg Gln Ile Arg Ser Thr Val Glu Tyr Cys Asn Gln

340 345 350

Leu Arg Val Pro Glu Arg His Pro Tyr Gly Gly Asp Leu Val Phe Thr

355 360 365

Ala Phe Ser Gly Ser His Gln Asp Ala Val Asn Lys Gly Leu Asp Ala

370 375 380

Met Ala Ala Lys Val Gln Pro Gly Ala Ser Ser Thr Glu Val Ser Trp

385 390 395 400

Glu Gln Leu Arg Asp Thr Glu Trp Glu Val Pro Tyr Leu Pro Ile Asp

405 410 415

Pro Lys Asp Val Gly Arg Asp Tyr Glu Ala Val Ile Arg Val Asn Ser

420 425 430

Gln Ser Gly Lys Gly Gly Val Ala Tyr Ile Met Lys Thr Asp His Gly

435 440 445

Leu Gln Ile Pro Arg Ser Met Gln Val Glu Phe Ser Thr Val Val Gln

450 455 460

Asn Val Thr Asp Ala Glu Gly Gly Glu Val Asn Ser Lys Ala Met Trp

465 470 475 480

Asp Ile Phe Ala Thr Glu Tyr Leu Glu Arg Thr Ala Pro Val Glu Gln

485 490 495

Ile Ala Leu Arg Val Glu Asn Ala Gln Thr Glu Asn Glu Asp Ala Ser

500 505 510

Ile Thr Ala Glu Leu Ile His Asn Gly Lys Asp Val Thr Val Asp Gly

515 520 525

His Gly Asn Gly Pro Leu Ala Ala Tyr Ala Asn Ala Leu Glu Lys Leu

530 535 540

Gly Ile Asp Val Glu Ile Gln Glu Tyr Asn Gln His Ala Arg Thr Ser

545 550 555 560

Gly Asp Asp Ala Glu Ala Ala Ala Tyr Val Leu Ala Glu Val Asn Gly

565 570 575

Arg Lys Val Trp Gly Val Gly Ile Ala Gly Ser Ile Thr Tyr Ala Ser

580 585 590

Leu Lys Ala Val Thr Ser Ala Val Asn Arg Ala Leu Asp Val Asn His

595 600 605

Glu Ala Val Leu Ala Gly Gly Val

610 615

<210> 5

<211> 1304

<212> DNA

<213> Artificial Sequence

<400> 5

cagtgccaag cttgcatgcc tgcaggtcga ctctagagga gttggatcca tgacctcaac 60

aactgcgtcc acaacttcct tggcgtactc aacctcagtg ccggtgaagg actcagggga 120

gtactgccag cgccagttgg tgtctgggta atcctgagcg acggtcttga tcagttcagc 180

ggcatcggta gccagcttct tcacctgcac cttgtccatg cggaacacca cgttgcgctg 240

caggatggag gttgagttgt agaagtgcac gataacgttt tttgcgcctt cgcaagcttc 300

aaaagtacgg cgaatcaggt gctcacgagc ctgaaccaga acctgaatgg tgacatcgtc 360

agggatcatg tccttttcga tgatctcacg aacgaaatca aaatcagtct gggaagctga 420

agggaaaccg acctcgattt ccttgaatcc catctgaacc agcagctcaa acatgcggcg 480

cttacgctca ggagacatcg gatcaatcag agcctggttg ccgtcacgca ggtcaacagc 540

acaccactga ggtgcaacgg tgattttttt atctggccaa gtgcggtccg gcagagaaat 600

atcttctacc tcaacctcga aaggcatgta gcggttaact ggcattgagg agccacactg 660

cttattccat gctggctggc cttcattgcg aggcccaact ggggtttcga tcttggcagg 720

tgcggagatg aatgcatcgt taggagacat tgtgttcaac cttcttaaaa agttttgggt 780

gggtccacga ccggcaacac caaactccgc gacgggatgc cggtcgtgtt aagacctctg 840

ggacccgccg cggcgaagaa gaagtagatt cgcacgcgaa gtcatgtggt gaagcataca 900

acaactttgt ggtgtgggta gcaactcggg gggagttttc ttttaaaaaa gcttttcgac 960

gcccagttcc agtgctgtca tgtctcgggg gggaactttg gagttttacc ttttcgatcc 1020

ggccggcatt gtgcttgtac gagacagtgc aatggtggaa acaatcatca ccaagagtgc 1080

gatgcccatg gcgatccatt cccagtccac gacttggaat ttttcgccca gaaccaagta 1140

gcccaaactg aaggcgacaa ttggttcggc aatggtcatg gcgggtagcg atttttgtag 1200

ttcgccagcg ttaaaggaat actgctgcac gattgttcca agtaatgcgg tgaggattag 1260

gccgtagggt accgagctcg aattcgtaat catggtcata gctg 1304

<210> 6

<211> 806

<212> DNA

<213> Artificial Sequence

<400> 6

cagtgccaag cttgcatgcc tgcaggtcga ctctagcatg acggctgact ggactcgact 60

tccatacgag gttctggaga agatctccac ccgcatcacc aacgaagttc cagatgtgaa 120

ccgcgtggtt ttggacgtaa cctccaagcc accaggaacc atcgaatggg agtaggcctt 180

aaatgagcct tcgttaagcg gcaatcacct tattggagat tgtcgctttt cccatttctc 240

cgggttttct ggaacttttt gggcgtatgc tgggaatgat tctattattg ccaaatcaga 300

aagcaggaga gacccgatga gcgaaatcct agaaacctat tgggcacccc actttggaaa 360

aaccgaagaa gccacagcac tcgtttcata cctggcacaa gcttccggcg atcccattga 420

ggttcacacc ctgttcgggg atttaggttt agacggactc tcgggaaact acaccgacac 480

tgagattgac ggctacggcg acgcattcct gctggttgca gcgctatccg tgttgatggc 540

tgaaaacaaa gcaacaggtg gcgtgaatct gggtgagctt gggggagctg ataaatcgat 600

ccggctgcat gttgaatcca aggagaacac ccaaatcaac accgcattga agtattttgc 660

gctctcccca gaagaccacg cagcagcaga tcgcttcgat gaggatgacc tgtctgagct 720

tgccaacttg agtgaagagc tgcgcggaca gctggactaa ttgtctccca tttaaggagt 780

ccgattttaa acgccgccag ccagga 806

<210> 7

<211> 2146

<212> DNA

<213> Artificial Sequence

<400> 7

cccatttaag gagtccgatt ttaaacgccg ccagccagga ctgcctcgtg gttgacgtcc 60

agcgcgcggt ttacggcgga ggtcactgcc ttcagcgaag cgtaggtgat ggagccagcg 120

atgccgacgc cccagacctt gcggccgttg acctcagcca gcacgtaggc ggctgcttct 180

gcatcgtcgc ccgaggtgcg ggcgtgctgg ttgtattcct ggatctcaac gtcgatgccc 240

agcttctcca gcgcgttggc gtaagcagcc agtgggccgt tgccgtggcc atcgacggtg 300

acgtccttgc cgttgtggat gagctcggcg gtgatggatg catcctcgtt ttcggtctga 360

gcgttctcga cgcgcagcgc gatctgctca actggtgcgg tgcgctccag gtactcggtg 420

gcgaagatat cccacattgc cttggagttg acctcgccgc cctcagcgtc ggtgacgttc 480

tggacaacgg tggagaactc aacctgcatg gagcgaggga tctgcagacc gtgatcggtc 540

ttcatgatgt aagcaacgcc gcccttgccg gactgggagt tcacgcggat aacagcctcg 600

tagtcgcgac cgacatcctt tggatcgata ggcaggtaag gaacctccca ttcggtgtcg 660

cgcagctgct cccaagaaac ttcagtggag ctagcacctg gctgaacctt ggcagccatg 720

gcgtccagac ccttgttcac agcgtcctgg tgggaaccgg agaaagcggt gaagaccagg 780

tcgccgccgt atgggtggcg ctcaggaacg cgcagctggt tgcagtattc aacggtgctg 840

cggatctggc gtatatcggt gaagtccagc tgagggtcaa cgccctgggt cagcatgttc 900

agtgccaggg tgaccaggca gacgttgccg gtgcgctcgc cgttgccgaa caggcagcct 960

tcgatgcggt cagcgccagc catgtagccc agctcagctg cgccaacgcc ggtgccacgg 1020

tcattgtgcg ggtgcaggga caggataatg gaatcacgac ggtttagatt gcggtgcatc 1080

cattcaatgg agtctgcgta aacgttaggg gtgatcatct caacggtgaa aggcaggttg 1140

atgatcattg ggttctcagg agttggatcc atgacctcaa caactgcgtc cacaacttcc 1200

ttggcgtact caacctcagt gccggtgaag gactcagggg agtactgcca gcgccagttg 1260

gtgtctgggt aatcctgagc gacggtcttg atcagttcag cggcatcggt agccagcttc 1320

ttcacctgca ccttgtccat gcggaacacc acgttgcgct gcaggatgga ggttgagttg 1380

tagaagtgca cgataacgtt ttttgcgcct tcgcaagctt caaaagtacg gcgaatcagg 1440

tgctcacgag cctgaaccag aacctgaatg gtgacatcgt cagggatcat gtccttttcg 1500

atgatctcac gaacgaaatc aaaatcagtc tgggaagctg aagggaaacc gacctcgatt 1560

tccttgaatc ccatctgaac cagcagctca aacatgcggc gcttacgctc aggagacatc 1620

ggatcaatca gagcctggtt gccgtcacgc aggtcaacag cacaccactg aggtgcaacg 1680

gtgatttttt tatctggcca agtgcggtcc ggcagagaaa tatcttctac ctcaacctcg 1740

aaaggcatgt agcggttaac tggcattgag gagccacgct gcttattcca tgctggctgg 1800

ccttcattgc gaggcccaac tggggtttcg atcttggcag gtgcggagat gaatgcatcg 1860

ttaggagaca ttgtgttcaa ccttcttaaa aagttttggg tgggtccacg accggcaaca 1920

ccaaactccg cgacgggatg ccggtcgtgt taagacctct gggacccgcc gcggcgaaga 1980

agaagtagat tcgcacgcga agtcatgtgg tgaagcatac aacaactttg tggtgtgggt 2040

agcaactcgg ggggagtttt cttttaaaaa agcttttcga cgcccagttc cagtgctgtc 2100

atgtctcggg ggggaacttt ggagtttaaa tcgactactc acatag 2146

<210> 8

<211> 2146

<212> DNA

<213> Artificial Sequence

<400> 8

cccatttaag gagtccgatt ttaaacgccg ccagccagga ctgcctcgtg gttgacgtcc 60

agcgcgcggt ttacggcgga ggtcactgcc ttcagcgaag cgtaggtgat ggagccagcg 120

atgccgacgc cccagacctt gcggccgttg acctcagcca gcacgtaggc ggctgcttct 180

gcatcgtcgc ccgaggtgcg ggcgtgctgg ttgtattcct ggatctcaac gtcgatgccc 240

agcttctcca gcgcgttggc gtaagcagcc agtgggccgt tgccgtggcc atcgacggtg 300

acgtccttgc cgttgtggat gagctcggcg gtgatggatg catcctcgtt ttcggtctga 360

gcgttctcga cgcgcagcgc gatctgctca actggtgcgg tgcgctccag gtactcggtg 420

gcgaagatat cccacattgc cttggagttg acctcgccgc cctcagcgtc ggtgacgttc 480

tggacaacgg tggagaactc aacctgcatg gagcgaggga tctgcagacc gtgatcggtc 540

ttcatgatgt aagcaacgcc gcccttgccg gactgggagt tcacgcggat aacagcctcg 600

tagtcgcgac cgacatcctt tggatcgata ggcaggtaag gaacctccca ttcggtgtcg 660

cgcagctgct cccaagaaac ttcagtggag ctagcacctg gctgaacctt ggcagccatg 720

gcgtccagac ccttgttcac agcgtcctgg tgggaaccgg agaaagcggt gaagaccagg 780

tcgccgccgt atgggtggcg ctcaggaacg cgcagctggt tgcagtattc aacggtgctg 840

cggatctggc gtatatcggt gaagtccagc tgagggtcaa cgccctgggt cagcatgttc 900

agtgccaggg tgaccaggca gacgttgccg gtgcgctcgc cgttgccgaa caggcagcct 960

tcgatgcggt cagcgccagc catgtagccc agctcagctg cgccaacgcc ggtgccacgg 1020

tcattgtgcg ggtgcaggga caggataatg gaatcacgac ggtttagatt gcggtgcatc 1080

cattcaatgg agtctgcgta aacgttaggg gtgatcatct caacggtgaa aggcaggttg 1140

atgatcattg ggttctcagg agttggatcc atgacctcaa caactgcgtc cacaacttcc 1200

ttggcgtact caacctcagt gccggtgaag gactcagggg agtactgcca gcgccagttg 1260

gtgtctgggt aatcctgagc gacggtcttg atcagttcag cggcatcggt agccagcttc 1320

ttcacctgca ccttgtccat gcggaacacc acgttgcgct gcaggatgga ggttgagttg 1380

tagaagtgca cgataacgtt ttttgcgcct tcgcaagctt caaaagtacg gcgaatcagg 1440

tgctcacgag cctgaaccag aacctgaatg gtgacatcgt cagggatcat gtccttttcg 1500

atgatctcac gaacgaaatc aaaatcagtc tgggaagctg aagggaaacc gacctcgatt 1560

tccttgaatc ccatctgaac cagcagctca aacatgcggc gcttacgctc aggagacatc 1620

ggatcaatca gagcctggtt gccgtcacgc aggtcaacag cacaccactg aggtgcaacg 1680

gtgatttttt tatctggcca agtgcggtcc ggcagagaaa tatcttctac ctcaacctcg 1740

aaaggcatgt agcggttaac tggcattgag gagccacact gcttattcca tgctggctgg 1800

ccttcattgc gaggcccaac tggggtttcg atcttggcag gtgcggagat gaatgcatcg 1860

ttaggagaca ttgtgttcaa ccttcttaaa aagttttggg tgggtccacg accggcaaca 1920

ccaaactccg cgacgggatg ccggtcgtgt taagacctct gggacccgcc gcggcgaaga 1980

agaagtagat tcgcacgcga agtcatgtgg tgaagcatac aacaactttg tggtgtgggt 2040

agcaactcgg ggggagtttt cttttaaaaa agcttttcga cgcccagttc cagtgctgtc 2100

atgtctcggg ggggaacttt ggagtttaaa tcgactactc acatag 2146

<210> 9

<211> 783

<212> DNA

<213> Artificial Sequence

<400> 9

cgggggggaa ctttggagtt taaatcgact actcacatag ggtcgggcta gtcattctga 60

tcagcgaatt ccacgttcac atcgccaatt ccagagttca caaccagatt cagcattgga 120

ccttctagat cagcattgtg ggcggtgaga tctccaacat cacagcgcgc tgtgcccaca 180

ccggcggtac aacttaggct cacgggcaca tcatcgggca gggtgaccat gacttcgccg 240

atccctgagg tgatttggat gttttgttcc tgatccaatt gggtgaggtg gctgaaatcg 300

aggttcattt cacccacgcc agaggtgtag ctgctgagga gttcatcgtt ggtggggatg 360

agattgacat cgccgattcc agggtcgtct tcaaagtaga tgggatcgat atttgaaata 420

aacaggcctg cgagggcgct catgacaact ccggtaccaa ctacaccgcc gacaatccat 480

ggccacacat ggcgcttttt ctgaggcttt tgtggaggga cttgtacatc ccaggtgttg 540

tattggtttt gggcaagtgg atcccaatga ggcgcttcgg gggtttgttg cgcgaagggt 600

gcatagtagc cctcaacggg ggtgatagtg cttagatctg gttggggttg tgggtagaga 660

tcttcgtttt tcatggtggc atcctcagaa acagtgaatt cagtggtgag tagtccgcgg 720

ggtggaagtg gttgtttctt atgcagggta ccgagctcga attcgtaatc atggtcatag 780

ctg 783

<210> 10

<211> 2167

<212> DNA

<213> Artificial Sequence

<400> 10

gtccgctctg ttggtgttca aggcgatggc cgcacctacg gacacccaat cgtgctgcgc 60

ccagtgtctt ccgaagacgc catgacggct gactggactc gacttccata cgaggttctg 120

gagaagatct ccacccgcat caccaacgaa gttccagatg tgaaccgcgt ggttttggac 180

gtaacctcca agccaccagg aaccatcgaa tgggagtagg ccttaaatga gccttcgtta 240

agcggcaatc accttattgg agattgtcgc ttttcccatt tctccgggtt ttctggaact 300

ttttgggcgt atgctgggaa tgattctatt attgccaaat cagaaagcag gagagacccg 360

atgagcgaaa tcctagaaac ctattgggca ccccactttg gaaaaaccga agaagccaca 420

gcactcgttt catacctggc acaagcttcc ggcgatccca ttgaggttca caccctgttc 480

ggggatttag gtttagacgg actctcggga aactacaccg acactgagat tgacggctac 540

ggcgacgcat tcctgctggt tgcagcgcta tccgtgttga tggctgaaaa caaagcaaca 600

ggtggcgtga atctgggtga gcttggggga gctgataaat cgatccggct gcatgttgaa 660

tccaaggaga acacccaaat caacaccgca ttgaagtatt ttgcgctctc cccagaagac 720

cacgcagcag cagatcgctt cgatgaggat gacctgtctg agcttgccaa cttgagtgaa 780

gagctgcgcg gacagctgga ctaattgtct cccatttaag gagtccgatt ttaaacgccg 840

ccagccagga ctgcctcgtg gttgacgtcc agcgcgcggt ttacggcgga ggtcactgcc 900

ttcagcgaag cgtaggtgat ggagccagcg atgccgacgc cccagacctt gcggccgttg 960

acctcagcca gcacgtaggc ggctgcttct gcatcgtcgc ccgaggtgcg ggcgtgctgg 1020

ttgtattcct ggatctcaac gtcgatgccc agcttctcca gcgcgttggc gtaagcagcc 1080

agtgggccgt tgccgtggcc atcgacggtg acgtccttgc cgttgtggat gagctcggcg 1140

gtgatggatg catcctcgtt ttcggtctga gcgttctcga cgcgcagcgc gatctgctca 1200

actggtgcgg tgcgctccag gtactcggtg gcgaagatat cccacattgc cttggagttg 1260

acctcgccgc cctcagcgtc ggtgacgttc tggacaacgg tggagaactc aacctgcatg 1320

gagcgaggga tctgcagacc gtgatcggtc ttcatgatgt aagcaacgcc gcccttgccg 1380

gactgggagt tcacgcggat aacagcctcg tagtcgcgac cgacatcctt tggatcgata 1440

ggcaggtaag gaacctccca ttcggtgtcg cgcagctgct cccaagaaac ttcagtggag 1500

ctagcacctg gctgaacctt ggcagccatg gcgtccagac ccttgttcac agcgtcctgg 1560

tgggaaccgg agaaagcggt gaagaccagg tcgccgccgt atgggtggcg ctcaggaacg 1620

cgcagctggt tgcagtattc aacggtgctg cggatctggc gtatatcggt gaagtccagc 1680

tgagggtcaa cgccctgggt cagcatgttc agtgccaggg tgaccaggca gacgttgccg 1740

gtgcgctcgc cgttgccgaa caggcagcct tcgatgcggt cagcgccagc catgtagccc 1800

agctcagctg cgccaacgcc ggtgccacgg tcattgtgcg ggtgcaggga caggataatg 1860

gaatcacgac ggtttagatt gcggtgcatc cattcaatgg agtctgcgta aacgttaggg 1920

gtgatcatct caacggtgaa aggcaggttg atgatcattg ggttctcagg agttggatcc 1980

atgacctcaa caactgcgtc cacaacttcc ttggcgtact caacctcagt gccggtgaag 2040

gactcagggg agtactgcca gcgccagttg gtgtctgggt aatcctgagc gacggtcttg 2100

atcagttcag cggcatcggt agccagcttc ttcacctgca ccttgtccat gcggaacacc 2160

acgttgc 2167

<210> 11

<211> 1669

<212> DNA

<213> Artificial Sequence

<400> 11

ccagcgccag ttggtgtctg ggtaatcctg agcgacggtc ttgatcagtt cagcggcatc 60

ggtagccagc ttcttcacct gcaccttgtc catgcggaac accacgttgc gctgcaggat 120

ggaggttgag ttgtagaagt gcacgataac gttttttgcg ccttcgcaag cttcaaaagt 180

acggcgaatc aggtgctcac gagcctgaac cagaacctga atggtgacat cgtcagggat 240

catgtccttt tcgatgatct cacgaacgaa atcaaaatca gtctgggaag ctgaagggaa 300

accgacctcg atttccttga atcccatctg aaccagcagc tcaaacatgc ggcgcttacg 360

ctcaggagac atcggatcaa tcagagcctg gttgccgtca cgcaggtcaa cagcacacca 420

ctgaggtgca acggtgattt ttttatctgg ccaagtgcgg tccggcagag aaatatcttc 480

tacctcaacc tcgaaaggca tgtagcggtt aactggcatt gaggagccac actgcttatt 540

ccatgctggc tggccttcat tgcgaggccc aactggggtt tcgatcttgg caggtgcgga 600

gatgaatgca tcgttaggag acattgtgtt caaccttctt aaaaagtttt gggtgggtcc 660

acgaccggca acaccaaact ccgcgacggg atgccggtcg tgttaagacc tctgggaccc 720

gccgcggcga agaagaagta gattcgcacg cgaagtcatg tggtgaagca tacaacaact 780

ttgtggtgtg ggtagcaact cggggggagt tttcttttaa aaaagctttt cgacgcccag 840

ttccagtgct gtcatgtctc gggggggaac tttggagttt aaatcgacta ctcacatagg 900

gtcgggctag tcattctgat cagcgaattc cacgttcaca tcgccaattc cagagttcac 960

aaccagattc agcattggac cttctagatc agcattgtgg gcggtgagat ctccaacatc 1020

acagcgcgct gtgcccacac cggcggtaca acttaggctc acgggcacat catcgggcag 1080

ggtgaccatg acttcgccga tccctgaggt gatttggatg ttttgttcct gatccaattg 1140

ggtgaggtgg ctgaaatcga ggttcatttc acccacgcca gaggtgtagc tgctgaggag 1200

ttcatcgttg gtggggatga gattgacatc gccgattcca gggtcgtctt caaagtagat 1260

gggatcgata tttgaaataa acaggcctgc gagggcgctc atgacaactc cggtaccaac 1320

tacaccgccg acaatccatg gccacacatg gcgctttttc tgaggctttt gtggagggac 1380

ttgtacatcc caggtgttgt attggttttg ggcaagtgga tcccaatgag gcgcttcggg 1440

ggtttgttgc gcgaagggtg catagtagcc ctcaacgggg gtgatagtgc ttagatctgg 1500

ttggggttgt gggtagagat cttcgttttt catggtggca tcctcagaaa cagtgaattc 1560

agtggtgagt agtccgcggg gtggaagtgg ttgtttctta tgcaacgccc accacatggc 1620

taaaaggcaa aggtaagtaa tggctgctgc tgggccgaat attcctcca 1669

<210> 12

<211> 2176

<212> DNA

<213> Artificial Sequence

<400> 12

gcttgcatgc ctgcaggtcg actctagagg atccccttaa acgccgccag ccaggactgc 60

ctcgtggttg acgtccagcg cgcggtttac ggcggaggtc actgccttca gcgaagcgta 120

ggtgatggag ccagcgatgc cgacgcccca gaccttgcgg ccgttgacct cagccagcac 180

gtaggcggct gcttctgcat cgtcgcccga ggtgcgggcg tgctggttgt attcctggat 240

ctcaacgtcg atgcccagct tctccagcgc gttggcgtaa gcagccagtg ggccgttgcc 300

gtggccatcg acggtgacgt ccttgccgtt gtggatgagc tcggcggtga tggatgcatc 360

ctcgttttcg gtctgagcgt tctcgacgcg cagcgcgatc tgctcaactg gtgcggtgcg 420

ctccaggtac tcggtggcga agatatccca cattgccttg gagttgacct cgccgccctc 480

agcgtcggtg acgttctgga caacggtgga gaactcaacc tgcatggagc gagggatctg 540

cagaccgtga tcggtcttca tgatgtaagc aacgccgccc ttgccggact gggagttcac 600

gcggataaca gcctcgtagt cgcgaccgac atcctttgga tcgataggca ggtaaggaac 660

ctcccattcg gtgtcgcgca gctgctccca agaaacttca gtggagctag cacctggctg 720

aaccttggca gccatggcgt ccagaccctt gttcacagcg tcctggtggg aaccggagaa 780

agcggtgaag accaggtcgc cgccgtatgg gtggcgctca ggaacgcgca gctggttgca 840

gtattcaacg gtgctgcgga tctggcgtat atcggtgaag tccagctgag ggtcaacgcc 900

ctgggtcagc atgttcagtg ccagggtgac caggcagacg ttgccggtgc gctcgccgtt 960

gccgaacagg cagccttcga tgcggtcagc gccagccatg tagcccagct cagctgcgcc 1020

aacgccggtg ccacggtcat tgtgcgggtg cagggacagg ataatggaat cacgacggtt 1080

tagattgcgg tgcatccatt caatggagtc tgcgtaaacg ttaggggtga tcatctcaac 1140

ggtgaaaggc aggttgatga tcattgggtt ctcaggagtt ggatccatga cctcaacaac 1200

tgcgtccaca acttccttgg cgtactcaac ctcagtgccg gtgaaggact caggggagta 1260

ctgccagcgc cagttggtgt ctgggtaatc ctgagcgacg gtcttgatca gttcagcggc 1320

atcggtagcc agcttcttca cctgcacctt gtccatgcgg aacaccacgt tgcgctgcag 1380

gatggaggtt gagttgtaga agtgcacgat aacgtttttt gcgccttcgc aagcttcaaa 1440

agtacggcga atcaggtgct cacgagcctg aaccagaacc tgaatggtga catcgtcagg 1500

gatcatgtcc ttttcgatga tctcacgaac gaaatcaaaa tcagtctggg aagctgaagg 1560

gaaaccgacc tcgatttcct tgaatcccat ctgaaccagc agctcaaaca tgcggcgctt 1620

acgctcagga gacatcggat caatcagagc ctggttgccg tcacgcaggt caacagcaca 1680

ccactgaggt gcaacggtga tttttttatc tggccaagtg cggtccggca gagaaatatc 1740

ttctacctca acctcgaaag gcatgtagcg gttaactggc attgaggagc cacgctgctt 1800

attccatgct ggctggcctt cattgcgagg cccaactggg gtttcgatct tggcaggtgc 1860

ggagatgaat gcatcgttag gagacattgt gttcaacctt cttaaaaagt tttgggtggg 1920

tccacgaccg gcaacaccaa actccgcgac gggatgccgg tcgtgttaag acctctggga 1980

cccgccgcgg cgaagaagaa gtagattcgc acgcgaagtc atgtggtgaa gcatacaaca 2040

actttgtggt gtgggtagca actcgggggg agttttcttt taaaaaagct tttcgacgcc 2100

cagttccagt gctgtcatgt ctcggggggg aactttggag ttgttttggc ggatgagaga 2160

agattttcag cctgat 2176

<210> 13

<211> 2176

<212> DNA

<213> Artificial Sequence

<400> 13

gcttgcatgc ctgcaggtcg actctagagg atccccttaa acgccgccag ccaggactgc 60

ctcgtggttg acgtccagcg cgcggtttac ggcggaggtc actgccttca gcgaagcgta 120

ggtgatggag ccagcgatgc cgacgcccca gaccttgcgg ccgttgacct cagccagcac 180

gtaggcggct gcttctgcat cgtcgcccga ggtgcgggcg tgctggttgt attcctggat 240

ctcaacgtcg atgcccagct tctccagcgc gttggcgtaa gcagccagtg ggccgttgcc 300

gtggccatcg acggtgacgt ccttgccgtt gtggatgagc tcggcggtga tggatgcatc 360

ctcgttttcg gtctgagcgt tctcgacgcg cagcgcgatc tgctcaactg gtgcggtgcg 420

ctccaggtac tcggtggcga agatatccca cattgccttg gagttgacct cgccgccctc 480

agcgtcggtg acgttctgga caacggtgga gaactcaacc tgcatggagc gagggatctg 540

cagaccgtga tcggtcttca tgatgtaagc aacgccgccc ttgccggact gggagttcac 600

gcggataaca gcctcgtagt cgcgaccgac atcctttgga tcgataggca ggtaaggaac 660

ctcccattcg gtgtcgcgca gctgctccca agaaacttca gtggagctag cacctggctg 720

aaccttggca gccatggcgt ccagaccctt gttcacagcg tcctggtggg aaccggagaa 780

agcggtgaag accaggtcgc cgccgtatgg gtggcgctca ggaacgcgca gctggttgca 840

gtattcaacg gtgctgcgga tctggcgtat atcggtgaag tccagctgag ggtcaacgcc 900

ctgggtcagc atgttcagtg ccagggtgac caggcagacg ttgccggtgc gctcgccgtt 960

gccgaacagg cagccttcga tgcggtcagc gccagccatg tagcccagct cagctgcgcc 1020

aacgccggtg ccacggtcat tgtgcgggtg cagggacagg ataatggaat cacgacggtt 1080

tagattgcgg tgcatccatt caatggagtc tgcgtaaacg ttaggggtga tcatctcaac 1140

ggtgaaaggc aggttgatga tcattgggtt ctcaggagtt ggatccatga cctcaacaac 1200

tgcgtccaca acttccttgg cgtactcaac ctcagtgccg gtgaaggact caggggagta 1260

ctgccagcgc cagttggtgt ctgggtaatc ctgagcgacg gtcttgatca gttcagcggc 1320

atcggtagcc agcttcttca cctgcacctt gtccatgcgg aacaccacgt tgcgctgcag 1380

gatggaggtt gagttgtaga agtgcacgat aacgtttttt gcgccttcgc aagcttcaaa 1440

agtacggcga atcaggtgct cacgagcctg aaccagaacc tgaatggtga catcgtcagg 1500

gatcatgtcc ttttcgatga tctcacgaac gaaatcaaaa tcagtctggg aagctgaagg 1560

gaaaccgacc tcgatttcct tgaatcccat ctgaaccagc agctcaaaca tgcggcgctt 1620

acgctcagga gacatcggat caatcagagc ctggttgccg tcacgcaggt caacagcaca 1680

ccactgaggt gcaacggtga tttttttatc tggccaagtg cggtccggca gagaaatatc 1740

ttctacctca acctcgaaag gcatgtagcg gttaactggc attgaggagc cacactgctt 1800

attccatgct ggctggcctt cattgcgagg cccaactggg gtttcgatct tggcaggtgc 1860

ggagatgaat gcatcgttag gagacattgt gttcaacctt cttaaaaagt tttgggtggg 1920

tccacgaccg gcaacaccaa actccgcgac gggatgccgg tcgtgttaag acctctggga 1980

cccgccgcgg cgaagaagaa gtagattcgc acgcgaagtc atgtggtgaa gcatacaaca 2040

actttgtggt gtgggtagca actcgggggg agttttcttt taaaaaagct tttcgacgcc 2100

cagttccagt gctgtcatgt ctcggggggg aactttggag ttgttttggc ggatgagaga 2160

agattttcag cctgat 2176

<210> 14

<211> 1262

<212> DNA

<213> Artificial Sequence

<400> 14

cagtgccaag cttgcatgcc tgcaggtcga ctctagaatt ccctgtcggt gaagcaggca 60

gaggagcgag gattttctca gcgctttact gcagaaactg atgtggcggg agctgcgaaa 120

tttcaaaagt tgcttcccgt cggtttgtac ttgattcgtg agatcacgcc tgagaatccg 180

cataaggatt ataaaacttc tgagccgttc ttgatcacgt tgcctgtggg taatgtgaca 240

ggcgatgcgt ggcagtgtga tgtggtgatc aagacaaagg agactccgga cccagaccca 300

gatccgactc cgaccccaac ttcaccacag ccccctactt cgacagaaac cacgacgact 360

ccgctggtac ctacccctcc gatcacgccg ccagctgagg atataactgg cagcaccact 420

gagaaagatc cgagtcgccc tagtattctg gcgtctaccg gtgccaacgt gttgtggctg 480

gtaggtggag cattactggc tgttattgct ggtgtgttct ttgttcttcg tggacgtaga 540

tctaaagact cctaaagtaa aaaaggttct gccctcactc cacatggagt gagggcagaa 600

cctttcggtg tgtagggcct agggggaggc gtcgtaaagc tgtgttcaac cttcttaaaa 660

agttttgggt gggtccacga ccggcaacac caaactccgc gacgggatgc cggtcgtgtt 720

aagacctctg ggacccgccg cggcgaagaa gaagtagatt cgcacgcgaa gtcatgtggt 780

gaagcataca acaactttgt ggtgtgggta gcaactcggg gggagttttc ttttaaaaaa 840

gcttttcgac gcccagttcc agtgctgtca tgtctcgggg gggaactttg gagttttacc 900

ttttcgatcc ggccggcatt gtgcttgtac gagacagtgc aatggtggaa acaatcatca 960

ccaagagtgc gatgcccatg gcgatccatt cccagtccac gacttggaat ttttcgccca 1020

gaaccaagta gcccaaactg aaggcgacaa ttggttcggc aatggtcatg gcgggtagcg 1080

atttttgtag ttcgccagcg ttaaaggaat actgctgcac gattgttcca agtaatgcgg 1140

tgaggattag gccgtagcct tcccagttca agatgagtcc cgttatgcct tgatggacaa 1200

aaagatccac cgcggctttg gacagggtac cgagctcgaa ttcgtaatca tggtcatagc 1260

tg 1262

Claims

1. A YH 66-01475 protein mutant, wherein the amino acid sequence of the YH 66-01475 protein mutant is shown in SEQ ID No. 4.

2. A biological material associated with the yh66_01475 protein mutant of claim 1, which is any one of the following B1) to B4):

b1 A nucleic acid molecule encoding the yh66_01475 protein mutant of claim 1;

B2 An expression cassette comprising the nucleic acid molecule of B1);

B3 A recombinant vector comprising the nucleic acid molecule of B1);

b4 Recombinant corynebacterium glutamicum containing the nucleic acid molecule of B1).

3. The biomaterial according to claim 2, characterized in that: the nucleotide sequence of the nucleic acid molecule is shown as SEQ ID No. 3.

Use of YH66_01475 protein or a biological material related to YH66_01475 protein or a YH66_01475 protein mutant according to claim 1 or a biological material according to B1) to B3) according to claim 2 or 3) in any one of the following X1) to X3):

x1) increasing the yield of L-arginine in Corynebacterium glutamicum;

x2) constructing corynebacterium glutamicum producing L-arginine;

X3) preparing L-arginine;

The amino acid sequence of YH 66-01475 protein is shown as SEQ ID No. 2;

The biological material related to YH66_01475 protein is any one of the following D1) to D3):

d1 A nucleic acid molecule encoding the YH66_01475 protein;

d2 An expression cassette comprising D1) said nucleic acid molecule;

D3 A recombinant vector comprising the nucleic acid molecule of D1).

5. A method for increasing the production of L-arginine in corynebacterium glutamicum, said method being M1) or M2) as follows:

The M1) comprises the following steps: the gene encoding YH 66-01475 protein in the genome of the corynebacterium glutamicum is replaced by the gene encoding YH 66-01475 protein mutant, so that the yield of L-arginine in the corynebacterium glutamicum is improved;

The M2) comprises the following steps: the content and/or the activity of YH 66-01475 protein or YH 66-01475 protein mutant in the corynebacterium glutamicum are improved, and the yield of L-arginine in the corynebacterium glutamicum is improved;

The amino acid sequence of YH 66-01475 protein is shown as SEQ ID No. 2;

The amino acid sequence of the YH 66-01475 protein mutant is shown as SEQ ID No. 4.

6. The construction method of the L-arginine producing engineering bacteria comprises the following steps of N1) or N2):

The N1) comprises the following steps: replacing a gene encoding YH 66-01475 protein in a corynebacterium glutamicum genome with a gene encoding YH 66-01475 protein mutant to obtain the L-arginine producing engineering bacterium;

the N2) comprises the steps of: the content and/or activity of YH 66-01475 protein or YH 66-01475 protein mutant in corynebacterium glutamicum are improved, and the L-arginine producing engineering bacterium is obtained;

The amino acid sequence of YH 66-01475 protein is shown as SEQ ID No. 2;

7. The use of the L-arginine producing engineering bacteria constructed by the method according to claim 6 in the preparation of L-arginine.

8. A method for preparing L-arginine comprising the steps of: fermenting and culturing the L-arginine-producing engineering bacteria constructed by the method of claim 6 to obtain the L-arginine.