CN111321245A - Molecular marker for detecting existence of BBC herbicide resistance of rice HIS1 gene and application thereof - Google Patents

Abstract

The invention discloses a molecular marker for detecting whether a rice HIS1 gene has BBC herbicide resistance and application thereof, which can quickly, efficiently, accurately and conveniently identify whether the rice strain HIS1 gene has BBC herbicide resistance, identify the recessive type of the rice HIS1 gene and provide a certain theoretical basis for the use of the BBC herbicide. The invention also discloses the application of the molecular marker in hybrid rice seed production, which can greatly improve the seed production purity, quickly, accurately and efficiently obtain true hybrid progeny, is simple to operate, greatly liberates labor force, can relieve the phenomenon of 'swinging' in the seed production process of a 'two-line method', and has important significance in improving the purity of hybrid rice seeds and improving germplasm resource innovation. The invention also discloses application of the molecular marker in transferring rice materials with the anti-sensitive/sensitive BBC herbicides, and the molecular marker has the advantages of wide applicability, simple operation, rapidness and accuracy.

Description

Molecular marker for detecting existence of BBC herbicide resistance of rice HIS1 gene and application thereof

Technical Field

The invention belongs to the technical field of molecular markers, and particularly relates to a molecular marker for detecting whether 28bp deletion exists in a rice HIS1 gene, an application of the molecular marker in identifying whether 28bp deletion exists in a rice HIS1 gene, and an application of the molecular marker in obtaining true hybrid progeny in hybrid rice seed production.

Background

Rice (Oryza sativaL) is one of the most important food crops in China and even the world, and more than 35 hundred million people in the world use rice as staple food, and plays a very important role in agricultural production and practice. During the whole life cycle of the rice, weeds are important factors influencing the quality of the rice, and the weeds and the rice are co-grown in the rice field and compete with each other for growth space and soil nutrients, so that the yield of the rice can be reduced by 10% -20%, and even the yield of the rice is reduced by over 90% in severe cases.

Currently, the most economical, rapid and effective way to weed is chemical weeding. A novel herbicide for rice field: the bicycloocotrione (BBC) herbicide is developed by SDS bio-company of Japan, and is a bicyclooctane albino type triketone herbicide. As a systemic conduction and stem leaf spray type herbicide, BBC has lower water solubility, enhanced downward mobility, reduced outflow loss in paddy field and reduced negative influence on environment; secondly, BBC has the advantages of low toxicity, wide weed control spectrum and strong drug effect durability, has obvious effect on preventing and killing annual weeds, perennial weeds and autumn-ripe weeds, and can also effectively prevent and kill pseudorice, weeds and verruca which are difficult to remove and the like extending from the border to the field. However, BBC only acts on japonica rice, and the application of the herbicide in indica rice fields can cause whitening and even death of partial varieties of rice seedlings, so that the application in indica rice fields is not recommended.

The hybrid rice is gradually transited to the hybrid rice of the light-temperature sensitive male sterile line by the first generation 'three-line method' using a cytoplasmic male sterile line as a genetic tool, and has wide application in agricultural production, remarkable benefit and long-term use. The three-line method of hybrid rice has the planting area which accounts for about 50 percent of the area of the hybrid rice so far, the sterile line has stable fertility, but the quality of the hybrid rice is limited by a maintainer line and a restorer line, the restorer line is less, the maintainer line is less, the seed source is rare and precious, and simultaneously, as the rural labor force is reduced, the main labor force for producing the hybrid rice seeds is limited, so that the labor force investment is insufficient at the key moment of seed production, the impurity removal is not timely, the difficulty in identifying the hybrid plants is high, and the seed quality is influenced. The two-line hybrid rice seed production is not restricted by the conservation relation, the matching is free, and the combination probability of hybrid rice with strong superiority, good quality and multiple resistance can be selected and bred. The two-line hybrid rice is spread over 16 provinces in China, the planting area of part of the provinces exceeds that of the three-line hybrid rice, but the two-line sterile line has high starting point temperature and short low temperature tolerance time, and the self-fructification and seed production failure of the sterile line are caused by the weather lower than the starting point temperature of the sterility in the seed production process.

Disclosure of Invention

The invention aims to solve the technical problems, overcome the defects and defects in the background technology, provide a molecular marker for quickly and efficiently detecting whether the rice HIS1 gene has BBC herbicide resistance and a using method thereof, realize the application of the BBC herbicide in the hybrid seed production process of the rice in the indica rice field and the application of the molecular marker in the transfer resistant/sensitive BBC herbicide rice material.

The rice HIS1 gene (LOC _ Os02g17940) is a recently cloned endogenous rice gene with broad-spectrum resistance to BBC herbicides. Through systematic analysis, we find that the rice HIS1 gene variation is mainly in an intron region, and only five sites are varied in a coding region: single base variation existing at 9 th, 968 th, 1057 th and 1548 th, and 28bp fragment deletion variation existing at 831-858 th bases, wherein the 28bp fragment deletion variation exists in the fourth exon of the rice HIS1 gene.

Through further research, amino acid sequences coded by different haplotypes are analyzed, and the 28bp fragment deletion variation existing at the 831-858 th base position is found to be the main reason influencing the herbicide resistance function of the HIS1 gene, the BBC herbicide resistance phenotype of the rice HIS1 gene is dominant, the recessive type of the 28bp fragment deletion variation of the HIS1 gene is recessive, the rice containing the recessive homozygote HIS1 gene loses resistance to the BBC herbicide and only exists in part of indica rice varieties, and the rice containing the dominant homozygote or heterozygote HIS1 gene has resistance to the BBC herbicide. Therefore, the method explores the 28bp fragment deletion variation of varieties in common indica rice breeding materials in China, and has important significance for large-area popularization and utilization of BBC herbicides in indica rice fields. Furthermore, a specific molecular primer is designed by utilizing the characteristic that the 28bp fragment deletion variation of the HIS1 gene in the fourth exon causes the loss of the resistance of the BBC herbicide, is used for identifying whether the 28bp fragment deletion variation exists in the HIS1 gene in a certain indica rice variety, and simultaneously utilizes the characteristic that the BBC herbicide can only be applied in a japonica rice field, so that the purity of hybrid seed production of rice at the current stage can be improved to a certain extent, the problem of 'swinging' in the seed production process of a two-line sterile line is solved, and the specific molecular primer has significance for cultivating innovative germplasm resources and releasing labor force.

In order to solve the technical problems, the technical scheme provided by the invention is as follows:

a molecular marker for detecting whether rice HIS1 gene has BBC herbicide resistance, which comprises a forward primer F (named as CCJ-CF) and a reverse primer R (named as CCJ-CR) with the following sequences:

CCJ-CF: 5'-GTACAACTTGACGATGTATCAAG-3' (shown in SEQ. ID NO. 1);

CCJ-CR: 5'-GTTGAATCTTGCAAATGCAGGAGC-3' (shown in SEQ. ID NO. 2).

Based on a general inventive concept, the invention also provides an application of the molecular marker in detecting whether the rice HIS1 gene has BBC herbicide resistance or detecting the recessive type of the rice HIS1 gene.

The above application, preferably, specifically comprises the following steps:

s1, extracting a DNA sample of the rice leaf to be identified by adopting a CTAB method;

s2, using the DNA sample of the step S1 as a template, and carrying out PCR amplification by using the molecular marker;

s3, taking the amplification product obtained after the step S2 for electrophoresis, and reading the size of the fragment; if the amplified product fragment is a single 182bp strip (which indicates that 28bp fragment deletion variation exists), the rice HIS1 gene is a recessive homozygote, and the rice HIS1 gene is identified to have no BBC herbicide resistance; if the amplified product fragment is a single 210bp band (which indicates that 28bp fragment deletion variation does not exist), the rice HIS1 gene is a dominant homozygote, and the rice HIS1 gene is identified to have BBC herbicide resistance; and if the amplified product fragment contains a 182bp band and a 210bp band, which indicates that the rice HIS1 gene is heterozygote, identifying that the rice HIS1 gene has BBC herbicide resistance.

More preferably, the specific operation of PCR amplification using the molecular marker comprises the steps of diluting the molecular marker to 10mM, configuring a PCR reaction system, wherein the 20 mu LPCR reaction system comprises 50 ng/mu L of genomic DNA2 mu L, 1 mu L of primers before and after 5 mu M/mL respectively and 1.1 × PCR Mix 16 mu L, and the PCR reaction conditions are as follows, pre-denaturation is carried out at 95 ℃ for 4min, pre-denaturation is carried out at 95 ℃ for 20s, pre-denaturation is carried out at 58 ℃ for 20s, and pre-amplification is carried out at 72 ℃ for 20s in 35 cycles, and extension is carried out at 72 ℃ for 5 min.

Based on a general inventive concept, the invention also provides an application of the molecular marker in hybrid rice seed production, wherein in the application, a mixed sowing and mixed harvesting mode or a photo-thermo-sensitive male sterile line two-line method is adopted for hybrid rice seed production, and the method comprises the following steps: firstly, the molecular marker is adopted to detect whether the HIS1 genes of male parent and female parent of the rice have BBC herbicide resistance, the male parent and the female parent of which one part has BBC herbicide resistance and the other part does not have BBC herbicide resistance are selected to be hybridized, and then the BBC herbicide is uniformly sprayed to remove the male parent, the female parent or the pseudo hybrid which does not have resistance to the herbicide, thus obtaining the progeny of the true hybrid.

Generally, the parental HIS1 gene used for hybrid rice seed production is homozygote, and the female parent is sterile line. The method for detecting whether the rice male parent and female parent HIS1 genes have BBC herbicide resistance by using the molecular marker is the same as the method.

The application preferably adopts a mixed sowing and mixed harvesting mode to carry out hybrid rice seed production, and specifically comprises the following steps: firstly, the molecular marker is adopted to detect whether the HIS1 genes of the male parent and the female parent of the paddy rice have BBC herbicide resistance, rice varieties of which the HIS1 gene of the female parent has BBC herbicide resistance and the HIS1 gene of the male parent does not have BBC herbicide resistance are selected to be sown in a mixed mode, wherein the female parent is a sterile line, after the natural pollination of the paddy rice is completed, the BBC herbicide is uniformly sprayed on the rice plants of the male parent and the female parent to remove the male parent which does not have BBC herbicide resistance, and the surviving progeny of the rice plants of the female parent are true hybrid progeny.

More preferably, when hybrid rice seed production is carried out by a mixed sowing and mixed harvesting mode, the adopted female parents comprise one or more of 033S, 1892S, 33S, 66S, 99S, GD-1S, GD-7S, N111S, N5088S, Y58S, 5S, DesS, Phoenix S, Fulong S2, Guangxian 24S, Guangzhan 63-4S, Hua 68S, Jian S, Jing 4155S, Longke 638S, Lvmin S, Meng S, Petasin 64S, Shen 08S, Tannong S, Tianan S, Tianyuan 6S, Wan S, Xinhua S, starlight S, Xuan 69S and strain 1S;

three-line hybrid rice female parent: II-32A, D62A, F32A, K17A, Q1A, Q4A, Q6A, T98A, V20A, Anfeng A, Oufuan A, Gong 1A, Bo II A, Bo III A, Bo A, Changfeng A, Chuan 106A, Chuan Gu A, Chuan nong 1A, Chuan nong 2A, Chuan nong 3A, Chuan nong 4A, Chuan Xiang 29A, Chuan Jiang 12A, Chuan 1A, Fengyuan A, Fuyi A, Jiangxiang A, gang 46A, gang 48A, Gonggang 901A, Jinggang Xiangjing 1A, Guang 8A, Lu and A, Guangdong 13A, Hengfeng A, Hongguan 1A, Jiangu 645A, Jin23A, Jinjingujing 3A, Gugu 7A, Luzhou 1A, Luzhou A, Guangxiang 1A, Guangdong A, Guangxiang 1A, Guang 1A, Jinba, Jinluo 23A, Jinyujin 3A, Jingjing 3A, Luzhou 1A, Luzhou A, Luzho, Any one or more of inner incense 3A, inner incense 5A, inner incense 7A, inner incense 8A, Quan9311A, Rongfeng A, Rong18A, Shen 97A, Shen 9A, Shennong 2A, Shu 21A, Shu 8A, Tai 3A, Taifeng A, Tianfeng A, Wan 23A, Wan 73A, Wan 8A, Wan 9A, Wanjin A, Wufeng A, Xiang 8A, Xiangfeng 70A, Xiuqingzao A, Xinrong A, Xiniia, Yixiang 1A, Yufeng A, Yuetai 4A, Yuntai A, Yun 109A, Zhenshan 97A, Zhong2A, Zhong3A and 9A;

the adopted male parents comprise Sihui No. 18, Zhenzhen No.2, De Hui 381, Fu Hui 2098, Zhonggang No.3, IR64, Yanhui 559, Gui 582, Yi Hui 3551, Chenghui 727, Minghui 73, HR1128, Suhui 728, Zhenzui 2308, Zhenhui 2308, Quanhui 039, Jinboat silk sprout, Huahui 352, Huahui 118, Yeqinglun, Yi 1313, Jinghui 838, Jinzao 47, Zhenhui 084, Zhenhui 42, Luhui H103, Neihui 94-11, quan 131, Minghui 100, Mihui 725, Hangzui 959, Nanfeng glutinous, Neihui 2539, Fu Hui 5138, Mihui 2040, Mihui 9939, Nante No. 202, Shuhao No.1, Minghui 707, Guanghui 3550, Jianhui 146, Xiang 13, Shuhao 204, Shuhui 1577, Minghui 312, Mianna 2115, Mianlong-Hai-Miao, Chunhui-Hai-122, Xinhui-Hai-Miao-Hai-122, Yanhui-Hai, Ciligonmi, nan hui 445, Minghui 2155, Yuchi 231-8, Wenhui 689, Jun Jie No.1, R527, Shu hui 203, Minghui 82, Miyang 23, ao R15, Chengdu dwarf No. 8, Fuhui 9801, Chenghui 19, Minghui 78, Xiangzai No. 13, AoR 69, Gui Dynasty 13, Mihui 9937, Lehui 188, Minhui 1273, Shengyou No.2, Yuhui 310, Guang' second 104, De Hui 3485, Chuan Xinghui 1618, Nanhui 115, Chuan nong 422, Yunhui 68, Shengli indica, Yihui 3003, Luhui 615, Yahui 627, Guang Erwan stone, Changfeng B, Xiang late Hui No. 13, Qianhui 1385, Nanhui 716, Feihui 6, Hongnan, Digu, Qigui Zai early 25, Qian 489, Qian Hui 3301, Yuchui 3308, Yuhui 676, Shihui No. 7, Shi Min 7, Shi, Hai Min 7, Shi 7, Shi, Shi 7, Shi.

The traditional method is to mix and sow the male and female parents in the same growth period according to a certain proportion, then separate the hybrid seeds from the male parent seeds by physical or chemical methods, or directly remove the male parent in the field. However, as the rural labor is reduced, the main labor for producing hybrid rice seeds is limited, so that the labor investment is insufficient at the key moment of seed production, impurity removal is not timely, the difficulty in identifying the hybrid plants is high, and the seed quality is influenced. The invention firstly adopts the molecular marker to identify whether 28bp deletion variation exists in the HIS1 gene of the male parent and the female parent of the rice, and then judges whether the HIS1 gene of the rice has BBC herbicide resistance, when the HIS1 gene of the male parent has 28bp deletion variation and the HIS1 gene of the female parent is normal, the male parent and the female parent can be co-sown in the seed production process of the hybrid rice, after pollination, BBC herbicide is sprayed in the rice field, so that the male parent which does not resist the herbicide is removed, only female parent true hybrid is left, the seed production purity is greatly improved, and the labor force is greatly liberated.

The application preferably adopts a two-line method of photo-thermo-sensitive male sterile line to carry out hybrid rice seed production, and specifically comprises the following steps: firstly, the molecular marker is adopted to detect whether the rice male parent and female parent HIS1 genes have BBC herbicide resistance, rice varieties with the female parent HIS1 gene having no BBC herbicide resistance and the male parent HIS1 gene having BBC herbicide resistance are selected for hybridization, wherein the HIS1 genes of the male parent and the female parent are homozygotes, F1 generation seeds are normally harvested for planting, and BBC herbicide is used for uniformly spraying the F1 generation plants (the spraying effect is optimal in the 3-leaf stage of seedlings) so as to remove progeny of female parent selfing inoculation caused by temperature instability (low temperature), and then true hybrid progeny is obtained.

The two-line method seed production of the photo-thermo-sensitive male sterile line is easy to have the phenomenon of large-area seed production failure, and the temperature instability change is one of the main reasons for the phenomenon. According to the invention, whether 28bp deletion variation exists in the parent HIS1 gene of the rice is identified by adopting the molecular marker, whether BBC herbicide resistance exists in the HIS1 gene of the rice is further judged, the rice variety with the normal HIS1 gene of the male parent and the 28bp deletion variation existing in the HIS1 gene of the female parent is selected for planting, female parent selfing and fructification are caused even in low-temperature weather in the seed production process, BBC herbicide is sprayed in the seedling stage of F1 generation seeds, the seeds which are selfed and fructified of the female parent are removed, only true hybrids capable of resisting the herbicide are left, and the phenomenon of 'swinging seeds' easily occurring in the seed production process of the two-line sterile lines is relieved.

More preferably, when the photo-thermo-sensitive male sterile line is adopted for hybrid rice seed production by a two-line method, the adopted female parent comprises any one or more of Annong S-1, Biao 810S, KT27S, Hua1037S, Xiangling 628S, quasisS, LongS, Orlon 1S, Yannong S, Jinjin 4128S, 360S, Huayu 4127S, Z9S, H175S, 885S and Ming S, and the adopted male parent comprises any one or more of Yuxiangshuan, R402, P143, Yueyao silk seedling, Zhongzao 22, R534 and Huazhan.

More preferably, when the hybrid rice is produced by a photo-thermo-sensitive male sterile line 'two-line method', the adopted male and female parent combination comprises the following steps: the quanliangyou sesame oil account combination comprises a quanliangyou sesame oil account combination consisting of a quanliangyou female parent and a Jade oil account male parent, a quanliangyou 402 combination consisting of a quanliangyou female parent and an R402 male parent, a Miniangyou 143 combination consisting of a Miniangyou S female parent and a P143 male parent, a Longiangyou Yueyao Si Miao combination consisting of a Longiangyou S female parent and a Yueyao Si Miao male parent, a Jinliangyou 22 combination consisting of a jin 4128S female parent and a Zhongzao 22 male parent, a jin liangyou 534 combination consisting of a jin 4128S female parent and a Huazhan male parent, a Yuliangyou 22 combination consisting of a Huayu 4127S female parent and a Zhongzao 22 male parent, or a Yunliangyou 22 combination consisting of.

In the above application, preferably, the BBC herbicide is a bifenox herbicide, and the concentration of the bifenox herbicide is diluted to 0.4 μ M to4 μ M before spraying on a target plant.

The BBC herbicide is widely applied to japonica rice fields, but is not suitable for indica rice fields, the 28bp fragment deletion variation of the fourth exon of the HIS1 gene in part of indica rice varieties causes the loss of the resistance of rice to the BBC herbicide, and by utilizing the characteristic, the male parent and the female parent can be sowed and harvested in a mixed manner in the hybrid seed production process, the BBC is sprayed after pollination, the male parent which does not resist the herbicide is removed, the female parent true hybrid is left, and the labor force can be greatly liberated; meanwhile, the condition of 'swinging seed' in the seed production process of the two-line sterile line can be effectively relieved, and the purity and the quality of the seed production are improved.

Based on a general inventive concept, the present invention also provides an application of the above molecular marker in transferring rice materials resistant to/sensitive to BBC herbicides, the application comprising the steps of: selecting rice varieties with BBC herbicide resistance on one side and without BBC herbicide resistance on the other side as donors and acceptors for hybridization, planting obtained hybrid progeny, detecting the recessiveness type of HIS1 gene of the hybrid progeny population by using the molecular marker, selecting HIS1 gene as a single plant of a heterozygote for selfing, or selecting the heterozygote from backcross progeny obtained after backcrossing with acceptor materials for selfing, detecting the obtained backcross or selfing progeny population by using the molecular marker, and finally selfing and separating the homozygous rice materials with resistance or sensitivity to the BBC herbicide. The method for detecting the recessive type of the HIS1 gene of the rice plant by using the molecular marker is the same as the method.

In the above application, preferably, in the rice variety with BBC herbicide resistance, the two-line sterile line includes one or more of 033S, 1892S, 33S, 66S, 99S, GD-1S, GD-7S, N111S, N5088S, Y58S, Chuang 5S, De S, Feng S, Fulong S2, Guangxian 24S, Guangzhan 63-4S, Hua 68S, Jian S, Jing 4155S, Longke 638S, Lvmin S, Meng S, Pepan 64S, Shen 08S, Tannong S, Tian' an S, Tianyuan 6S, Wan S, Xinhua S, Xinguang S, Xuan 69S and Strain 1S;

restorer comprises 93-11, IR24, IR26, IR28, To463, test 235, test 253, test 258, Chunhui 121, Chunhui 851, Chunhui 871, Chunhui 891, Chenghui 177, Chenghui 425, Chenghui 448, Dachuxiang 15, Delghui 923, Enghui 58, Fuhui 0724, Fuhui 9303, Fuhui 9802, Fuhui 016, Fuhui 964, Guanhui 128, Guanhui 368, Guanhui 998, Guihui 985, Guihua 1025, Gui 44, Gui 649, Guihui 99, Hanhui No.3, Huazhan, Huanghuazhan, Jianghui 151, Luhui 1345, Luhui 17, Luhui 602, Luhui 8258, Miyan 46, Minghui 07, Minghui 1259, Minghui 70, Nan009, Shuhao 125, Huhui 134180, Huhui 819, Huhui Na hui nationality, Na Hua 360, Luhui Shi 360, Hui Shi, Any one or more of yanghui 336, yanghui 542, yue hui 9113, yue nong si miao, yue xiang zhan, zhe hui 0506, zhe hui 7954, zhen hui 129, zhong 413, zhong hui 8006, zhong hui 8012, zhong hui 8015, zhong lian hui 510 and zhong lian hui 950;

in the rice variety without BBC herbicide resistance, the two-line sterile line comprises any one or more of Annong S-1, Biaoling 810S, KT27S, Hua1037S, Xiangling 628S, quasisS, Longson S, Orlon 1S, Yannong S, Jinjin 4128S, 360S, Huayu 4127S, Z9S, H175S, 885S and Ming S;

the restorer line comprises IR30, Oro R15, Changhui T025, Kaihui 117, Chenghui 149, Chenghui 19, Chenui 727, Chuanhui 907, Deshui 3485, Dehui 381, multisystem No.1, Philippine No.6, Fuhui 9801, Radihui 838, Fuhui 2098, Fuhui 5138, Fuhui 673, Fuhui 676, Guanhui 122, Guanghui 312, Guanhui 3550, Gui 582, Nahui No.1, Huahui 118, Huahui 352, Lehui 188, Hui 615, Luhui H103, Lvdao 24, Mihui 146, Mihui 2040, Hui 3724, Mihui 501, Mihui Qianhui 725, Hui 9937, Hei 9939, Minhui 3301, Minhui 100, Minhui 1273, Minhui 2155, Minhui 67, Minhui 73, Minhui 77, Minhui 82, Minhui 16582, Minhui 82, Minhui 1389, Hai Kahui Shenhui 1389, Hai Kahui Kaihu spring 202, Hai Shenhui 51, Hai 200, Hai Kaihu 500, Hai Kaihu, Any one or more of recovered hollyhock 204, recovered hollyhock 498, recovered hollyhock 527, recovered hollyhock 707, recovered soul 728, recovered tai 187, recovered kali 88, recovered west 18, recovered ja 2115, recovered asian 627, recovered salted 559, recovered yihui 1313, recovered yihui 1577, recovered yihui 2084, recovered yihui 2292, recovered yihui 2308, recovered yihui 3003, recovered yihui 3551, recovered yihui 9, recovered yun 310, recovered narrowleaf indigo 8, recovered Zhenhui 084 and Zhenhui 42.

Compared with the prior art, the invention has the beneficial effects that:

1. the molecular marker disclosed by the invention and the application thereof in detecting whether the rice HIS1 gene has BBC herbicide resistance or detecting the rice HIS1 gene recessive type can quickly, efficiently, accurately and conveniently identify whether 28bp fragment deletion variation exists in the rice line HIS1 gene, further judge whether the rice HIS1 gene has BBC herbicide resistance, provide a certain theoretical basis for the use of the BBC herbicide in part of indica rice fields, and lay a good foundation for the subsequent hybrid rice seed production and the transfer of rice materials resistant to/sensitive to the BBC herbicide by adopting the BBC herbicide.

2. The application of the hybrid rice seed production can greatly improve the seed production purity in the hybrid seed production process, quickly, accurately and efficiently obtain true hybrid progeny, is simple to operate, greatly liberates labor force, can relieve the phenomenon of seed swinging in the seed production process of a two-line method, and has important significance in improving the purity of hybrid rice seeds and improving germplasm resource innovation.

3. The application of the transfer-bred rice material with the anti-sensitive BBC herbicide can quickly, accurately and efficiently select the rice material which is resistant to the BBC herbicide or sensitive to the BBC herbicide by self according to needs, has stable heredity and wide applicability, is suitable for popularization, is simple to operate, greatly liberates labor force, and has important significance in germplasm resource innovation.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to these drawings without creative efforts.

FIG. 1 is an electrophoretogram of HIS1 gene of 24 rice materials in example 1;

FIG. 2 is a structural diagram of the Nipponbare HIS1 gene in example 1;

FIG. 3 is a graph showing the identification of resistance of the bifenox herbicide to different rice plants in example 1;

FIG. 4 is a graph showing the effect of applying a bifenox herbicide on rice material in example 3;

FIG. 5 is a graph showing the effect of BBC herbicide spraying on the female parent, male parent and hybrid thereof of the two-line hybrid rice in example 3 (Ming S, P143, Ming Liangyou 143, in order from left to right);

FIG. 6 is an electrophoretogram of HIS1 gene of the progeny of Shuhui 527, 93-11 and backcross in example 4;

FIG. 7 is an electrophoretogram of HIS1 gene and a corresponding plant object of the selfed progeny in example 4;

figure 8 is a graph comparing the effect of pre-modified holly recovery 527 (left) and post-modified holly recovery 527 (right) after spraying with a bifenox herbicide as in example 4;

FIG. 9 is an electrophoretogram of the HIS1 gene of the progeny of Y58S, MingS and backcross in example 5;

FIG. 10 is an electrophoretogram of HIS1 gene and a corresponding plant object of the selfed progeny in example 5;

FIG. 11 is a graph comparing the effect of Y58S (left) before modification and Y58S (right) after modification in example 5 after spraying with a bifenox herbicide.

Detailed Description

In order to facilitate understanding of the invention, the invention will be described more fully and in detail with reference to the accompanying drawings and preferred embodiments, but the scope of the invention is not limited to the specific embodiments below.

Unless otherwise defined, all terms of art used hereinafter have the same meaning as commonly understood by one of ordinary skill in the art. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention.

Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or can be prepared by existing methods.

Example 1:

a molecular marker for detecting the presence or absence of BBC herbicide resistance in rice HIS1 gene comprises a forward primer F (named as CCJ-CF) and a reverse primer R (named as CCJ-CR) shown in Table 1 below.

Table 1: molecular marker for detecting existence of BBC herbicide resistance of rice HIS1 gene

Name (R)	Base sequence
		CCJ-CF	GTACAACTTGACGATGTATCAAG (shown in SEQ. ID NO. 1)
CCJ-CR	GTTGAATCTTGCAAATGCAGGAGC (shown in SEQ. ID NO. 2)

The nucleotide sequence of the normal rice HIS1 gene (site name: LOC _ Os02g17940) is shown in SEQ.ID NO.3, and the amino acid sequence obtained by the normal HIS1 gene coding is shown in SEQ.ID NO. 5. After 28bp fragment deletion mutation occurs in the fourth exon (831-858 base of coding region) of the HIS1 gene, the nucleotide sequence of the HIS1 mutant gene is shown as SEQ ID NO.4, and the amino acid sequence obtained by coding the HIS1 mutant gene is shown as SEQ ID NO. 6. Compared with the amino acid sequence obtained by the coding of the normal HIS1 gene, the amino acid sequence obtained by the coding of the HIS1 mutant gene is analyzed, and the 28bp fragment deletion mutation is found to shift the frame and cause early termination, so that the resistance of the rice to BBC herbicides is lost, and the 28bp fragment deletion mutation existing at the 831-858 th base is the main reason for influencing the herbicide resistance function of the HIS1 gene. If the deletion mutation of the 28bp fragment at the fourth exon of the rice HIS1 gene can be judged, the BBC herbicide resistance of the rice HIS1 gene can be judged, and the recessive type of the rice HIS1 gene is expected to be further detected.

Further, the application method of the molecular marker of the embodiment for detecting whether the rice HIS1 gene has BBC herbicide resistance or detecting the rice HIS1 gene recessive type comprises the following steps:

s1, extracting DNA samples from fresh young leaves of rice by a CTAB method, namely, putting a proper amount of fresh rice leaves into a 2mL centrifuge tube, adding steel balls, quickly freezing in liquid nitrogen, putting into a high-throughput tissue grinder (Ningbo Xinzhi Scientz-48) to break tissues, immediately adding 650 mu L of a2 × CTAB solution preheated at 65 ℃, putting into a 65 ℃ water bath kettle, keeping the temperature for 45min, uniformly reversing the upper part and the lower part every 10min, finishing 45min, putting the DNA samples into a ventilation cabinet after cooling to room temperature, adding 650 mu L of a chloroform-isopropanol (24: 1) solution, uniformly reversing the upper part and the lower part, centrifuging for 10min, 12000rmp, transferring 500 mu L of supernatant into a 1.5mL centrifuge tube, adding 500 mu L of isopropanol solution, uniformly mixing, precipitating for 2h at-20 ℃, centrifuging for 10min 12000rmp, discarding the supernatant, adding 1mL of 70% ethanol solution to remove impurities, centrifuging for 12000rmp for 5min, pouring out the supernatant, adding 200 mu L of ddH₂And dissolving the obtained product in a refrigerator at 4 ℃ overnight to obtain the extracted rice sample DNA template.

S2, diluting the synthesized primers CCJ-CF and CCJ-CR to 10mM, configuring a PCR reaction system, wherein the 20 muL PCR reaction system comprises 2 muL (50 ng/muL) of genome DNA, the front primer and the rear primer are respectively 1 muL (5 muM/mL), the 1.1 × PCR Mix (Strongylocentrol Biotechnology Co., Ltd.) is 16 muL, the PCR reaction conditions are that the pre-denaturation is carried out at 95 ℃ for 4min, the pre-denaturation is carried out at 95 ℃ for 20S, the pre-denaturation is carried out at 58 ℃ for 20S, the pre-denaturation is carried out at 72 ℃ for 20S, the cycles are 35, and the extension is carried out at 72.

S3, carrying out electrophoretic separation on the obtained amplification product on 3% agarose gel, and reading the size of the amplified product fragment; if the amplified product fragment is a single 182bp band, which indicates that the rice HIS1 gene is a recessive homozygote, identifying that the rice HIS1 gene does not have BBC herbicide resistance; if the amplified product fragment is a single 210bp band, which indicates that the rice HIS1 gene is a dominant homozygote, identifying that the rice HIS1 gene has BBC herbicide resistance; and if the amplified product fragment contains a 182bp band and a 210bp band, which indicates that the rice HIS1 gene is heterozygote, identifying that the rice HIS1 gene has BBC herbicide resistance.

In this example, 24 parts of rice material were collected and subjected to the above-mentioned detection test for molecular markers, and the HIS1 gene electrophoretogram of 24 parts of rice material is shown in FIG. 1. Wherein, M is DL2000DNAmarker, 1 is IR64, 2 is contrast material Nipponbare, 3-24 are: 1B of Japanese St.John's wort, Digu, Yuetai A, 9311, Zhenxian 97B, Fengyuan B, Mihui 725, II-32A, Tianfeng A, Fenghuazhan, Yuanhui 2, Yuetai B, IR36, Gui 99, Fengyuan A, Shuhui 498, Miyang 46, Xiang late long-shaped No.1, D62B, G46B, CDR22 and Wufeng A.

As can be seen from FIG. 1, the product fragment amplified by IR64, Di Gu, Mi Hui 725, IR36, Shu Hui 498, Xiang late indica No.1 and CDR22 is an 182bp band, 28bp fragment deletion variation exists, which indicates that the rice HIS1 gene is recessive homozygote, and the rice HIS1 gene is identified to have no BBC herbicide resistance. The product fragment amplified from the other rice material is a 210bp band, no 28bp fragment deletion variation exists, the rice HIS1 gene is a dominant homozygote, and the rice HIS1 gene is identified to have BBC herbicide resistance.

In a laboratory, japonica rice nipponica was used as a control (the structure of nipponica HIS1 gene is shown in fig. 2), and important indica rice breeding materials widely used, such as Minghui 82, Delhi 381, Chengdu dwarf No. 8, were used as experimental groups, and the concentration of active ingredients of the bissulfoketonic herbicide (BBC) was diluted to 0.75 μ M with water and then the rice seedlings growing to 3 leaf stage were uniformly sprayed, and the phenotype was observed after 15 days, and the results are shown in fig. 3.

The results show that after three indica rice breeding materials with 28bp fragment deletion variation of the HIS1 gene are treated by the diluent of the bifenox herbicide for 15 days, rice seedlings wither yellow and dry and die finally. While the control material, Japanese fine rice seedling green onion, was healthier. This shows that BBC herbicide can produce lethal pharmacological action on part of indica rice with 28bp fragment deletion variation of HIS1 gene in application process, and has little influence on japonica rice with HIS1 gene intact. In the production practice process, the characteristic can be fully utilized to relieve the situation of 'swinging seed' of the two-line sterile line and liberate labor force in mixed sowing and mixed harvesting.

The molecular marker and the detection application method of the molecular marker detect that the HIS1 gene has 28bp fragment deletion variation in part of indica rice breeding materials, and the existing indica rice breeding materials with the known HIS1 gene having 28bp fragment deletion variation are shown in table 2.

Table 2: HIS1 gene deletion 28bp material in common indica rice breeding material in China

Example 2:

the molecular marker and the application method thereof in the embodiment 1 of the invention are applied to hybrid rice seed production, and hybrid rice seed production is carried out by adopting a mixed sowing and mixed harvesting mode, and the method comprises the following steps:

SS1, adopting the molecular marker of the invention to detect whether the HIS1 genes of the male parent and the female parent of the rice have BBC herbicide resistance, and the specific operation method is shown in example 1;

SS2, selecting a rice variety Y58S with female parent HIS1 gene having BBC herbicide resistance (HIS1 gene has no 28bp fragment deletion variation) and a rice variety R527 with male parent HIS1 gene having no BBC herbicide resistance (HIS1 gene has 28bp fragment deletion variation) for mixed sowing;

SS3, after the female parent Y58S and the male parent R527 finish natural pollination, diluting the concentration of the effective components of the herbicide diclosulfodone to4 mu M (plants in the field maturation period, with the maximum concentration), and uniformly spraying the rice plants of the male parent and the female parent; the male parent R527 has no BBC resistance, so that the plant begins to whiten and gradually withers later, and finally only the seeds generated after pollination of the female parent Y58S are left.

In the embodiment, the female parent Y58S 100 stump and the male parent R52720 stump are sown in a blending mode, and finally, the male parent with 20 stumps is counted to be completely dead. The purity of the harvested seeds is identified, and 100% of the seeds are hybrid seeds. Compared with the traditional hybrid rice seed production process, the male parent and the female parent need to be separately planted, and the male parent material is cut off after pollination, so that the scheme realizes the mixed sowing and mixed harvesting of the male parent and the female parent and greatly reduces the production cost of hybrid rice seeds.

The invention utilizes the characteristic that the biciflavone herbicide causes male parent albino death of BBC herbicide resistance genes, greatly liberates labor force and promotes and optimizes rice germplasm resources.

Example 3:

the molecular marker and the application method thereof in the embodiment 1 of the invention are applied to hybrid rice seed production, a photo-thermo-sensitive male sterile line two-line method is adopted for hybrid rice seed production, and the method comprises the following steps:

SSS1, and the molecular marker is used for detecting whether BBC herbicide resistance exists in the rice material HIS1 gene, and the specific operation method is shown in example 1;

SSS2, 16 rice materials with HIS1 genes without BBC herbicide resistance (28 bp fragment deletion mutation) are screened from a two-line sterile line, and are sensitive to BBC herbicides, including Annong S-1, Biaoling 810S, KT27S, Hua1037S, Xiangling 628S, quasisS, Longs, Orlon 1S, Yannong S, Jinlun 4128S, 360S, Huayu 41 4127S, Z9S, H175S, 885S and Ming S; 344 parts of rice material without BBC herbicide resistance (28 bp fragment deletion variation) of the HIS1 gene is screened from normal rice material of the two-line restorer line, and the rice material shows resistance to BBC herbicide; of these two types of material, 9 lines of two line hybrid rice variety combinations have been formulated, as shown in table 3, female parent is not BBC resistant, male parent is BBC resistant, where both male and female parent HIS1 genes are homozygous; planting and hybridizing the 10 two-line hybrid rice varieties according to the combination scheme respectively, and normally harvesting seeds of F1 generations;

SSS3, planting F1 generation seeds, diluting the concentration of the active ingredient of the bifenox herbicide to 0.75 mu M when the seeds grow to 3-leaf stage seedlings, and uniformly spraying the F1 generation seedlings; the progeny of the female parent which is subjected to self-inoculation of the female parent has no resistance to the dicyclo-sulcotone herbicide due to unstable temperature (low temperature), is withered and yellow and withered after being sprayed by the dicyclo-sulcotone herbicide, and finally dies, and the progeny which is still healthily survived after being sprayed by the dicyclo-sulcotone herbicide is true hybrid progeny, the effect of the dicyclo-sulcotone herbicide on rice materials is shown in figure 4, the rice materials with the dicyclo-sulcotone herbicide having no resistance have withered and yellow leaves, even die, and the rice materials with resistance to the dicyclo-sulcotone herbicide grow healthily.

Table 3: two-line hybrid rice combination meeting screening conditions

Fig. 5 is a graph showing comparison of the effect of two-line hybrid rice female parent Ming S, male parent P143 and hybrid Ming Liangyou 143 after the bicyclic sulcotrione herbicide is sprayed on the two-line hybrid rice female parent Ming S and male parent P143 from left to right. As can be seen from FIG. 5, the female parent Ming S has no resistance to the bifenox herbicide, the leaves are withered and yellow, while the male parent P143 and the hybrid Ming Liangyou 143 thereof have resistance to the bifenox herbicide, and the plants grow healthily. The method proves that even if the female parent is selfed and fruited in the low-temperature weather in the seed production process, the bifenox herbicide is sprayed in the seedling stage of the F1 generation seeds, the female parent selfing and fruition seeds without resistance are removed, and only true hybrids capable of resisting the herbicide are left, so that the method can relieve the phenomenon of 'swinging' easily occurring in the seed production process of the two-line sterile line. The effect of the other 8 two-line hybrid rice varieties is consistent with that of fig. 5, and the two-line hybrid rice varieties are expressed as that the female parent has no resistance to the BBC herbicide and the leaves are withered and yellow, while the male parent and the true hybrid thereof have resistance to the BBC herbicide, the plants grow healthily, the screening efficiency can reach 100 percent, and the effect is obvious, so that the aim of improving the purity of the hybrid rice seeds can be achieved.

In general, the HIS1 molecular marker can quickly, efficiently, accurately and conveniently identify whether 28bp fragment deletion variation exists in the rice HIS1 gene, further judge whether BBC herbicide resistance exists in the rice HIS1 gene, and provide a certain theoretical basis for large-area popularization and application of BBC herbicides in indica rice fields. In addition, by utilizing the characteristic that the 28bp fragment deletion variation of the fourth exon of the HIS1 gene in part of indica rice varieties causes the loss of the resistance of rice to BBC herbicides, the BBC herbicides are adopted for impurity removal in the mixed sowing and mixed harvesting and two-line method seed production processes of hybrid rice seed production, the seed production purity can be greatly improved, the progeny of true hybrid seeds can be quickly, accurately and efficiently obtained, the operation is simple, the labor force is greatly liberated, the swinging phenomenon can be relieved in the two-line method seed production process, and the method has important significance for the improvement of the purity of hybrid rice seeds and the germplasm resource innovation.

Example 4:

the application of the molecular marker and the application method thereof in the embodiment 1 of the invention in transferring rice materials resistant to BBC herbicides comprises the following steps:

SSSS1, selecting a rice variety 93-11 with BBC herbicide resistance as a donor, selecting a rice variety Shuhui 527 without BBC herbicide resistance as an acceptor, hybridizing, and planting the obtained filial generation;

SSSS2, and the molecular marker is used for detecting the invisibility type of the HIS1 gene of the filial generation population, and the specific operation method is shown in example 1;

the SSSS3 is obtained by selecting a HIS1 gene as a heterozygous single plant for backcrossing with a receptor material, the backcrossed offspring is detected by using the molecular marker, the HIS1 gene electrophoresis chart is shown in figure 6 (a lane M is a marker, a lane 1 is Shuhui 527, a lane 2 is 93-11, lanes 3-17 are a Hui 527// Shuhui 527/93-11 backcrossed offspring group), the HIS1 gene is selected from the backcrossed offspring as the heterozygous single plant for selfing, the selfed offspring group is detected by using the molecular marker, the detection method is the same as that of the selfed offspring, the HIS1 gene electrophoresis chart of the selfed offspring is shown in figure 7 (a lane 1 is Shuhui 527, a lane 2 is 93-11, lanes 3-13 are a Shuhui 527/Shuhui 527/93-11 backcrossed offspring group), the self-bred offspring group is selected from the selfed offspring group, the HIS1 gene is screened as a homozygote (an amplified single product fragment is a single bp 210bp band) The plant is the homozygous rice material for resisting the BBC herbicide.

As shown in FIG. 6, the HIS1 gene in the backcross progeny population of lanes 4, 6, 7, 10, 12, 16 was heterozygous.

As shown in FIG. 7, the HIS1 gene in the selfed progeny population of lanes 5, 8, 9 and 12 is a dominant homozygote (the amplified product fragment is a single 210bp band), i.e., a homozygous rice material resistant to BBC herbicide.

Figure 8 is a comparison of the effect of pre-modified hollyhock 527 (left) and post-modified hollyhock 527 (right) after spraying with the mesotrione herbicide. As shown in fig. 8, the hui 527 before transformation has no resistance to the mesosulfuron herbicide and leaves are withered and yellow, while the hui 527 after transformation has resistance to the mesosulfuron herbicide and plants grow healthily, which indicates that the HIS1 gene in 93-11 is successfully introduced into the background of the hui 527 by the molecular marker-assisted selection of the embodiment, so that the hui 527 has resistance to BBC.

Example 5:

the application of the molecular marker and the application method thereof in transforming rice materials sensitive to BBC herbicides in the embodiment 1 comprises the following steps:

SSSS1, selecting rice variety MinG S without BBC herbicide resistance as a donor, selecting rice variety Y58S with BBC herbicide resistance as an acceptor, carrying out hybridization, and planting the obtained filial generation;

SSSS2, and the molecular marker is used for detecting the invisibility type of the HIS1 gene of the filial generation population, and the specific operation method is shown in example 1;

SSSS3, selecting a HIS1 gene as a heterozygous single plant to be backcrossed with a receptor material, detecting backcross progeny by using the molecular marker, wherein an HIS1 gene electrophoresis chart is shown in figure 9 (a lane M is a marker, a lane 1 is Y58S, a lane 2 is bright S, lanes 3-17 are Y58S// Y58S/bright S backcross progeny groups), selecting a HIS1 gene as the heterozygous single plant in the backcross progeny to be selfed, detecting the selfing progeny groups by using the molecular marker, and selecting a HIS1 gene electrophoresis chart of the selfing progeny and a corresponding plant as shown in figure 10 (a lane 1 is Y58S, a lane 2 is bright S, lanes 3-14 are Y58S// Y58S/bright S backcross progeny group), selecting a HIS1 gene as a recessive homozygote in the selfing progeny groups (an amplified product fragment is a single strain with a single bp) and selecting a single self-bred progeny fragment of the HIS1 gene in the selfing progeny group, namely homozygous rice material sensitive to BBC herbicides.

As shown in FIG. 9, the HIS1 gene in the backcross progeny population of lanes 3, 6, 8, 12, 13, 15, 17 was heterozygous.

As shown in FIG. 10, the HIS1 gene of the selfed progeny population of lanes 5, 7 and 13 is recessive homozygote (the amplified product fragment is a single 182bp band), i.e., homozygous rice material sensitive to BBC herbicides.

FIG. 11 is a comparison of the effect of pre-engineered Y58S (left) and post-engineered Y58S (right) after spraying the bifenox herbicide. As shown in FIG. 11, Y58S before modification has resistance to the bifenox herbicide, and the plant grows healthily, while Y58S after modification has no resistance to the bifenox herbicide, and the leaves are withered yellow, which shows that by the molecular marker-assisted selection of this example, the HIS1 gene in MinG S is successfully introduced into Y58S background, so that Y58S is sensitive to BBC.

Sequence listing

<110> research center for hybrid rice in Hunan province

<120> molecular marker for detecting existence of BBC herbicide resistance in rice HIS1 gene and application thereof

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

gtacaacttg acgatgtatc aag 23

<210>2

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

gttgaatctt gcaaatgcag gagc 24

<210>3

<211>4012

<212>DNA

<213> Rice (Oryza sativa L.)

<400>3

cggcagctca cgccgcctcc gctagctccc caagtcgaaa cgtcgtcgcc cctcatcatc 60

tcctcctcgt tgtcgcaccc ccaaccgcac gctgccgccg ctcgcttcct cctctcctcg 120

tctcactcca gaaagccaag ctgcaaagca ctatggcaca tcccatagca atggcagcat 180

ggacacacag ccatcggagc cgaccgtggt aaaagctttc atcgcggtgc ctgatatatc 240

gacgccgaca tcgagcacgc cccaactcca tgtgagttca ccccatcttt ccttctactt 300

gctaatccag tgtttggtct tggatgtcag tctgatagtt ctgctcctgc tatgagattg 360

atgaatttgt ttgttgcttc acctgtccgt tctcccaaaa catgttgaac tcggtgctgc 420

tcgaataaaa cttgtagtgt tgatttgatt ccttagttta gggatagcta taagggtcac 480

caccattgac atggtaaatt gtaggtccca aacgacatta cattttagtt gtgcagggag 540

ttatataaac ttcgaaataa ttcattctaa tattcagtga aaaggtttag ggtgagaaat 600

actgcaagtt ttattttaga ctaaaagagt ctaaaataac aatactctct gcatatctcc 660

ttgaaaaggg ggctactgca acgaagaagt attatggaac cataatggtt tgttttactc 720

agttgtttga gtaattgagt ttaatttcca taaacatcca ctattatgat gtaaaatatt 780

tgaagaccgg acaggtgaag atgatcttta ccagtagaag ccaatagaag acttattcag 840

tttggccttg gtaaaatctg aaacctgaaa acttaatgtt ctgttttcat atatgcagat 900

ccaacaaatg cttagttatt actccgtatg gtggaattcc atcgcttatc agcctggtaa 960

agaatactgt tattaatttt ctaaaactaa gagcaatgcc ataacttatt ctctatccac 1020

ttatgatagg aggttttatt cttatgaaat tgtttatttc attattgatt cctcaatttt 1080

ctgtagtttt ttctatgcgt gctaactcag caagctcttt tatgggccta attgctcaaa 1140

gacagattct tttttactct agattgaatt aaattatgta cataacaagt tgaaatcaga 1200

tgtgcatatt taatggctca gttctgccga ccaataataa cataatattt aaacatttag 1260

ttcggatcat aggttcgtct cgatatctaa ttctagctga ctgactatca atttatgtat 1320

ttttgaaaaa aaaatcaaat ttaaagtata atccaattat aatatattat ggcccatata 1380

tacacaaggc tcttatacgg gcatcacaaa gtcgcgcaac gcgcggctag gtggctagtt 1440

atactagttg aaatatctag gagataagag aaggcaagca atggaatttg tttttcccat 1500

tcaggcattc agccccgttt ggaactcaat tccacaatgt tactagctca cttccacaat 1560

gtcaaactgc ttgaaatacc agtccctttc ttctgcccaa ttccacaatg ttaaatagtt 1620

tgaatacctt tagtttaatt tcaaaaaagg aatttgaaga ttccctttct tgtgctcaat 1680

tccacgatgt caaacagttt gaatacctat ccctttcttc agctcaatct gaatcttttt 1740

atcttatcta taacgagtca ttttttttca ccatgtacat cgtacatcat ttcttctact 1800

gttgaatagt agctgagaag cagtgtccat tctcattatg cttgaatttt caatccattt 1860

tcatccaagt atccaattca agatgtattt gcaggctata gatgagctga aagatctcct 1920

ttcttttcaa gcaagaacaa agttaagcaa gggaagatcc aagaacaaga acaccaatgg 1980

ctgacgagtc atggagggcg ccggcgatag tgcaagagct ggcggcagcc ggcgtcgagg 2040

agccgccgag ccgatacctg ctacgggaga aagaccgttc tgacgtcaag ctggtcgccg 2100

ccgagctgcc ggagcccctc cccgtcgttg atctcagccg gctagatggt gccgaggagg 2160

ccaccaagct cagggtggct ctgcagaatt ggggcttctt cctggtcagc ttctaacaag 2220

tgattctact ttgcttcata aaaaagactt gctcatttgt attcatttct ccaatttgtg 2280

tggttgtgtg tgatccagct taccaaccat ggagtagaag cctctctgat ggacagcgtg 2340

atgaacttgt cgagagagtt tttcaaccaa ccaatcgaac ggaagcaaaa attcagcaac 2400

ttgatcgatg gcaagaactt ccagattcaa gggtatggaa ctgaccgggt ggttacccaa 2460

gatcagatcc tggactggtc tgatcggttg catctcagag ttgaacccaa ggaggagcaa 2520

gatcttgcct tctggcctga ccatcctgaa tctttcaggt cacctactca cctcacattg 2580

attgatgctt tactttccag tttccacacg tctgaatttc tttctctttt gttttttctt 2640

ttttttgcaa aagatagtgt ttcttactgt tcatatatta cttacaaagt aacaaggatt 2700

gttgtctgaa ttcagaaagt acaacttgac gatgtatcaa gaaatggttt tgctgagcta 2760

tttgagagcc ttttcttctg cagggatgtt ctgaacaagt atgcatcagg aaccaaaaga 2820

attagagacg atatcattca ggctatggcc aagcttcttg agcttgatga ggattacttc 2880

ttggaccgac tcaacgaagc tcctgcattt gcaagattca actactaccc tccctgtcca 2940

aggcctgacc ttgtgttcgg catcaggcct cactccgacg gcaccctctt gacgattctt 3000

ctcgtcgaca aagatgtcag tggcctgcaa gttcagaggg atggcaagtg gtccaacgtt 3060

gaggcaactc ctcacacatt gctgatcaac ttaggtgaca ccatggaggt aattgcctta 3120

ttggcatcca acatccaaaa tacttactct ctgaatctgc agacatccag tacttcctcc 3180

gtttcatatt ataagacttt ctagcattgc ccacattcat atatatgtta atgaatctag 3240

acacatatat gtctagattc attaatatat atataaatgt tgttaatgaa tctagacata 3300

tatgtgtcta gattcattaa catatatatg aatgtgggca atgctagaaa gtcttatgac 3360

ctgaaacgaa ggtagtatat ctgatgataa atccagggtt tctgaatgct gatgcatatt 3420

tggatgcaac atttctgtgc aggtaatgtg caatggcatc ttcaggagcc cggtgcacag 3480

ggtggtgaca aacgccgaga aggagaggat ctccctggcc atgttataca gcgtgaacga 3540

tgagaaagac attgagccgg cggctggttt gctggatgag aatcggcctg caagatacag 3600

gaaagtgagc gtcgaagagt tcagggccgg gatctttgga aaattctctc gaggagagag 3660

gtacatcgac tccctgagga tctgatctcg aagagagcat gattgttgca agctcagcag 3720

ctttcagtag caagtatttc cttgggaaaa caaacatttt tcccccctta agggaattgc 3780

tgaaaacatg tcgcaagttc tcgtaaagaa aaacttttaa atttaactat ggtataattg 3840

taatataatt acatatgtaa taacccctcc gtttcatatt ataagacttt ctagcattgt 3900

ccacatttat atagatgtgg gcaatgccat aaagtcttac aatatgaaaa cggaggaagt 3960

cttgtaacta cggtactgca ttcttttcaa attacaaatt acttgtcatc ct 4012

<210>4

<211>3984

<212>DNA

<213> Rice (Oryza sativa L.)

<400>4

cggcagctca cgccgcctcc gctagctccc caagtcgaaa cgtcgtcgcc cctcatcatc 60

tcctcctcgt tgtcgcaccc ccaaccgcac gctgccgccg ctcgcttcct cctctcctcg 120

tctcactcca gaaagccaag ctgcaaagca ctatggcaca tcccatagca atggcagcat 180

ggacacacag ccatcggagc cgaccgtggt aaaagctttc atcgcggtgc ctgatatatc 240

gacgccgaca tcgagcacgc cccaactcca tgtgagttca ccccatcttt ccttctactt 300

gctaatccag tgtttggtct tggatgtcag tctgatagtt ctgctcctgc tatgagattg 360

atgaatttgt ttgttgcttc acctgtccgt tctcccaaaa catgttgaac tcggtgctgc 420

tcgaataaaa cttgtagtgt tgatttgatt ccttagttta gggatagcta taagggtcac 480

caccattgac atggtaaatt gtaggtccca aacgacatta cattttagtt gtgcagggag 540

ttatataaac ttcgaaataa ttcattctaa tattcagtga aaaggtttag ggtgagaaat 600

actgcaagtt ttattttaga ctaaaagagt ctaaaataac aatactctct gcatatctcc 660

ttgaaaaggg ggctactgca acgaagaagt attatggaac cataatggtt tgttttactc 720

agttgtttga gtaattgagt ttaatttcca taaacatcca ctattatgat gtaaaatatt 780

tgaagaccgg acaggtgaag atgatcttta ccagtagaag ccaatagaag acttattcag 840

tttggccttg gtaaaatctg aaacctgaaa acttaatgtt ctgttttcat atatgcagat 900

ccaacaaatg cttagttatt actccgtatg gtggaattcc atcgcttatc agcctggtaa 960

agaatactgt tattaatttt ctaaaactaa gagcaatgcc ataacttatt ctctatccac 1020

ttatgatagg aggttttatt cttatgaaat tgtttatttc attattgatt cctcaatttt 1080

ctgtagtttt ttctatgcgt gctaactcag caagctcttt tatgggccta attgctcaaa 1140

gacagattct tttttactct agattgaatt aaattatgta cataacaagt tgaaatcaga 1200

tgtgcatatt taatggctca gttctgccga ccaataataa cataatattt aaacatttag 1260

ttcggatcat aggttcgtct cgatatctaa ttctagctga ctgactatca atttatgtat 1320

ttttgaaaaa aaaatcaaat ttaaagtata atccaattat aatatattat ggcccatata 1380

tacacaaggc tcttatacgg gcatcacaaa gtcgcgcaac gcgcggctag gtggctagtt 1440

atactagttg aaatatctag gagataagag aaggcaagca atggaatttg tttttcccat 1500

tcaggcattc agccccgttt ggaactcaat tccacaatgt tactagctca cttccacaat 1560

gtcaaactgc ttgaaatacc agtccctttc ttctgcccaa ttccacaatg ttaaatagtt 1620

tgaatacctt tagtttaatt tcaaaaaagg aatttgaaga ttccctttct tgtgctcaat 1680

tccacgatgt caaacagttt gaatacctat ccctttcttc agctcaatct gaatcttttt 1740

atcttatcta taacgagtca ttttttttca ccatgtacat cgtacatcat ttcttctact 1800

gttgaatagt agctgagaag cagtgtccat tctcattatg cttgaatttt caatccattt 1860

tcatccaagt atccaattca agatgtattt gcaggctata gatgagctga aagatctcct 1920

ttcttttcaa gcaagaacaa agttaagcaa gggaagatcc aagaacaaga acaccaatgg 1980

ctgacgagtc atggagggcg ccggcgatag tgcaagagct ggcggcagcc ggcgtcgagg 2040

agccgccgag ccgatacctg ctacgggaga aagaccgttc tgacgtcaag ctggtcgccg 2100

ccgagctgcc ggagcccctc cccgtcgttg atctcagccg gctagatggt gccgaggagg 2160

ccaccaagct cagggtggct ctgcagaatt ggggcttctt cctggtcagc ttctaacaag 2220

tgattctact ttgcttcata aaaaagactt gctcatttgt attcatttct ccaatttgtg 2280

tggttgtgtg tgatccagct taccaaccat ggagtagaag cctctctgat ggacagcgtg 2340

atgaacttgt cgagagagtt tttcaaccaa ccaatcgaac ggaagcaaaa attcagcaac 2400

ttgatcgatg gcaagaactt ccagattcaa gggtatggaa ctgaccgggt ggttacccaa 2460

gatcagatcc tggactggtc tgatcggttg catctcagag ttgaacccaa ggaggagcaa 2520

gatcttgcct tctggcctga ccatcctgaa tctttcaggt cacctactca cctcacattg 2580

attgatgctt tactttccag tttccacacg tctgaatttc tttctctttt gttttttctt 2640

ttttttgcaa aagatagtgt ttcttactgt tcatatatta cttacaaagt aacaaggatt 2700

gttgtctgaa ttcagaaagt acaacttgac gatgtatcaa gaaatggttt tgctgagcta 2760

tttgagagcc ttttcttctg cagggatgtt ctgaacaagt atgcatcatt caggctatgg 2820

ccaagcttct tgagcttgat gaggattact tcttggaccg actcaacgaa gctcctgcat 2880

ttgcaagatt caactactac cctccctgtc caaggcctga ccttgtgttc ggcatcaggc 2940

ctcactccga cggcaccctc ttgacgattc ttctcgtcga caaagatgtc agtggcctgc 3000

aagttcagag ggatggcaag tggtccaacg ttgaggcaac tcctcacaca ttgctgatca 3060

acttaggtga caccatggag gtaattgcct tattggcatc caacatccaa aatacttact 3120

ctctgaatct gcagacatcc agtacttcct ccgtttcata ttataagact ttctagcatt 3180

gcccacattc atatatatgt taatgaatct agacacatat atgtctagat tcattaatat 3240

atatataaat gttgttaatg aatctagaca tatatgtgtc tagattcatt aacatatata 3300

tgaatgtggg caatgctaga aagtcttatg acctgaaacg aaggtagtat atctgatgat 3360

aaatccaggg tttctgaatg ctgatgcata tttggatgca acatttctgt gcaggtaatg 3420

tgcaatggca tcttcaggag cccggtgcac agggtggtga caaacgccga gaaggagagg 3480

atctccctgg ccatgttata cagcgtgaac gatgagaaag acattgagcc ggcggctggt 3540

ttgctggatg agaatcggcc tgcaagatac aggaaagtga gcgtcgaaga gttcagggcc 3600

gggatctttg gaaaattctc tcgaggagag aggtacatcg actccctgag gatctgatct 3660

cgaagagagc atgattgttg caagctcagc agctttcagt agcaagtatt tccttgggaa 3720

aacaaacatt tttcccccct taagggaatt gctgaaaaca tgtcgcaagt tctcgtaaag 3780

aaaaactttt aaatttaact atggtataat tgtaatataa ttacatatgt aataacccct 3840

ccgtttcata ttataagact ttctagcatt gtccacattt atatagatgt gggcaatgcc 3900

ataaagtctt acaatatgaa aacggaggaa gtcttgtaac tacggtactg cattcttttc 3960

aaattacaaa ttacttgtca tcct 3984

<210>5

<211>351

<212>PRT

<213> Rice (Oryza sativa L.)

<400>5

Met Ala Asp Glu Ser Trp Arg Ala Pro Ala Ile Val Gln Glu Leu Ala

1 5 10 15

Ala Ala Gly Val Glu Glu Pro Pro Ser Arg Tyr Leu Leu Arg Glu Lys

20 25 30

Asp Arg Ser Asp Val Lys Leu Val Ala Ala Glu Leu Pro Glu Pro Leu

35 40 45

Pro Val Val Asp Leu Ser Arg Leu Asp Gly Ala Glu Glu Ala Thr Lys

50 55 60

Leu Arg Val Ala Leu Gln Asn Trp Gly Phe Phe Leu Leu Thr Asn His

65 70 75 80

Gly Val Glu Ala Ser Leu Met Asp Ser Val Met Asn Leu Ser Arg Glu

85 90 95

Phe Phe Asn Gln Pro Ile Glu Arg Lys Gln Lys Phe Ser Asn Leu Ile

100 105 110

Asp Gly Lys Asn Phe Gln Ile Gln Gly Tyr Gly Thr Asp Arg Val Val

115 120 125

Thr Gln Asp Gln Ile Leu Asp Trp Ser Asp Arg Leu His Leu Arg Val

130 135 140

Glu Pro Lys Glu Glu Gln Asp Leu Ala Phe Trp Pro Asp His Pro Glu

145 150 155 160

Ser Phe Arg Asp Val Leu Asn Lys Tyr Ala Ser Gly Thr Lys Arg Ile

165 170 175

Arg Asp Asp Ile Ile Gln Ala Met Ala Lys Leu Leu Glu Leu Asp Glu

180 185 190

Asp Tyr Phe Leu Asp Arg Leu Asn Glu Ala Pro Ala Phe Ala Arg Phe

195 200 205

Asn Tyr Tyr Pro Pro Cys Pro Arg Pro Asp Leu Val Phe Gly Ile Arg

210 215 220

Pro His Ser Asp Gly Thr Leu Leu Thr Ile Leu Leu Val Asp Lys Asp

225 230 235 240

Val Ser Gly Leu Gln Val Gln Arg Asp Gly Lys Trp Ser Asn Val Glu

245 250 255

Ala Thr Pro His Thr Leu Leu Ile Asn Leu Gly Asp Thr Met Glu Val

260 265 270

Met Cys Asn Gly Ile Phe Arg Ser Pro Val His Arg Val Val Thr Asn

275 280 285

Ala Glu Lys Glu Arg Ile Ser Leu Ala Met Leu Tyr Ser Val Asn Asp

290 295 300

Glu Lys Asp Ile Glu Pro Ala Ala Gly Leu Leu Asp Glu Asn Arg Pro

305 310 315 320

Ala Arg Tyr Arg Lys Val Ser Val Glu Glu Phe Arg Ala Gly Ile Phe

325 330 335

Gly Lys Phe Ser Arg Gly Glu Arg Tyr Ile Asp Ser Leu Arg Ile

340 345 350

<210>6

<211>222

<212>PRT

<213> Rice (Oryza sativa L.)

<400>6

Met Ala Asp Glu Ser Trp Arg Ala Pro Ala Ile Val Gln Glu Leu Ala

1 5 10 15

Ala Ala Gly Val Glu Glu Pro Pro Ser Arg Tyr Leu Leu Arg Glu Lys

20 25 30

Asp Arg Ser Asp Val Lys Leu Val Ala Ala Glu Leu Pro Glu Pro Leu

35 40 45

Pro Val Val Asp Leu Ser Arg Leu Asp Gly Ala Glu Glu Ala Thr Lys

50 55 60

Leu Arg Val Ala Leu Gln Asn Trp Gly Phe Phe Leu Leu Thr Asn His

65 70 75 80

Gly Val Glu Ala Ser Leu Met Asp Ser Val Met Asn Leu Ser Arg Glu

85 90 95

Phe Phe Asn Gln Pro Ile Glu Arg Lys Gln Lys Phe Ser Asn Leu Ile

100 105 110

Asp Gly Lys Asn Phe Gln Ile Gln Gly Tyr Gly Thr Asp Arg Val Val

115 120 125

Thr Gln Asp Gln Ile Leu Asp Trp Ser Asp Arg Leu His Leu Arg Val

130 135 140

Glu Pro Lys Glu Glu Gln Asp Leu Ala Phe Trp Pro Asp His Pro Glu

145 150 155 160

Ser Phe Arg Asp Val Leu Asn Lys Tyr Ala Ser Phe Arg Leu Trp Pro

165 170 175

Ser Phe Leu Ser Leu Met Arg Ile Thr Ser Trp Thr Asp Ser Thr Lys

180 185 190

Leu Leu His Leu Gln Asp Ser Thr Thr Thr Leu Pro Val Gln Gly Leu

195 200 205

Thr Leu Cys Ser Ala Ser Gly Leu Thr Pro Thr Ala Pro Ser

210 215 220

Claims (15)

1. A molecular marker for detecting whether rice HIS1 gene has BBC herbicide resistance, which is characterized by comprising a forward primer F and a reverse primer R with the following sequences:

a forward primer F: 5'-GTACAACTTGACGATGTATCAAG-3', respectively;

reverse primer R: 5'-GTTGAATCTTGCAAATGCAGGAGC-3' are provided.

2. Use of the molecular marker of claim 1 for detecting the presence of BBC herbicide resistance in the rice HIS1 gene or detecting the recessive type of the rice HIS1 gene.

3. The use according to claim 2, characterized in that it comprises in particular the following steps:

s1, extracting a DNA sample of the rice leaf to be identified by adopting a CTAB method;

s2, using the DNA sample of the step S1 as a template, and carrying out PCR amplification by using the molecular marker;

s3, taking the amplification product obtained after the step S2 for electrophoresis, and reading the size of the fragment; if the amplified product fragment is a single 182bp band, which indicates that the rice HIS1 gene is a recessive homozygote, identifying that the rice HIS1 gene does not have BBC herbicide resistance; if the amplified product fragment is a single 210bp band, which indicates that the rice HIS1 gene is a dominant homozygote, identifying that the rice HIS1 gene has BBC herbicide resistance; and if the amplified product fragment contains a 182bp band and a 210bp band, which indicates that the rice HIS1 gene is heterozygote, identifying that the rice HIS1 gene has BBC herbicide resistance.

4. The use of claim 3, wherein the specific operation of PCR amplification using the molecular marker comprises diluting the molecular marker to 10mM, configuring a PCR reaction system, wherein the 20 μ LPCR reaction system comprises 2 μ L of 50ng/μ L of genomic DNA, 1 μ L of each primer before and after 5 μ M/mL, and 1.1 × PCR Mix 16 μ L, and the PCR reaction conditions are pre-denaturation at 95 ℃ for 4min, pre-denaturation at 95 ℃ for 20s, pre-denaturation at 58 ℃ for 20s, and pre-denaturation at 72 ℃ for 20s for 35 cycles, and extension at 72 ℃ for 5 min.

5. The application of the molecular marker of claim 1 in hybrid rice seed production, wherein in the application, hybrid rice seed production is carried out by adopting a mixed sowing and mixed harvesting mode or a photo-thermo-sensitive male sterile line two-line method, and the method comprises the following steps: firstly, the molecular marker is adopted to detect whether the HIS1 genes of male parent and female parent of the rice have BBC herbicide resistance, the male parent and the female parent of which one part has BBC herbicide resistance and the other part does not have BBC herbicide resistance are selected to be hybridized, and then the BBC herbicide is uniformly sprayed to remove the male parent, the female parent or the pseudo hybrid which does not have resistance to the herbicide, thus obtaining the progeny of the true hybrid.

6. The application of claim 5, wherein the hybrid rice seed production by mixed seeding and mixed harvesting comprises the following steps: firstly, the molecular marker is adopted to detect whether the HIS1 genes of the male parent and the female parent of the paddy rice have BBC herbicide resistance, rice varieties of which the HIS1 gene of the female parent has BBC herbicide resistance and the HIS1 gene of the male parent does not have BBC herbicide resistance are selected to be sown in a mixed mode, wherein the female parent is a sterile line, after the natural pollination of the paddy rice is completed, the BBC herbicide is uniformly sprayed on the rice plants of the male parent and the female parent to remove the male parent which does not have BBC herbicide resistance, and the surviving progeny of the rice plants of the female parent are true hybrid progeny.

7. The use of claim 6, wherein when hybrid rice is produced by mixed sowing and harvesting, the female parents used in the production comprise one or more of 033S, 1892S, 33S, 66S, 99S, GD-1S, GD-7S, N111S, N5088S, Y58S, 5S, De S, Phoenix S, Fulong S2, Guanxiang 24S, Guanzhan 63-4S, Hua 68S, Jian S, Crystal 4155S, Longke 638S, Lvmin S, Meng S, Chun Shi 64S, Shen S08, Tannong S, Tianan S, Tianyuan 6S, Wan S, Xinhua S, Xuan 69S and Xuan 1S;

three-line hybrid rice female parent: II-32A, D62A, F32A, K17A, Q1A, Q4A, Q6A, T98A, V20A, Anfeng A, Oufuan A, Gong 1A, Bo II A, Bo III A, Bo A, Changfeng A, Chuan 106A, Chuan Gu A, Chuan nong 1A, Chuan nong 2A, Chuan nong 3A, Chuan nong 4A, Chuan Xiang 29A, Chuan Jiang 12A, Chuan 1A, Fengyuan A, Fuyi A, Jiangxiang A, gang 46A, gang 48A, Gonggang 901A, Jinggang Xiangjing 1A, Guang 8A, Lu and A, Guangdong 13A, Hengfeng A, Hongguan 1A, Jiangu 645A, Jin23A, Jinjingujing 3A, Gugu 7A, Luzhou 1A, Luzhou A, Guangxiang 1A, Guangdong A, Guangxiang 1A, Guang 1A, Jinba, Jinluo 23A, Jinyujin 3A, Jingjing 3A, Luzhou 1A, Luzhou A, Luzho, Any one or more of inner incense 3A, inner incense 5A, inner incense 7A, inner incense 8A, Quan9311A, Rongfeng A, Rong18A, Shen 97A, Shen 9A, Shennong 2A, Shu 21A, Shu 8A, Tai 3A, Taifeng A, Tianfeng A, Wan 23A, Wan 73A, Wan 8A, Wan 9A, Wanjin A, Wufeng A, Xiang 8A, Xiangfeng 70A, Xiuqingzao A, Xinrong A, Xiniia, Yixiang 1A, Yufeng A, Yuetai 4A, Yuntai A, Yun 109A, Zhenshan 97A, Zhong2A, Zhong3A and 9A;

the adopted male parents comprise Sihui No. 18, Zhenzhen No.2, De Hui 381, Fu Hui 2098, Zhonggang No.3, IR64, Yanhui 559, Gui 582, Yi Hui 3551, Chenghui 727, Minghui 73, HR1128, Suhui 728, Zhenzui 2308, Zhenhui 2308, Quanhui 039, Jinboat silk sprout, Huahui 352, Huahui 118, Yeqinglun, Yi 1313, Jinghui 838, Jinzao 47, Zhenhui 084, Zhenhui 42, Luhui H103, Neihui 94-11, quan 131, Minghui 100, Mihui 725, Hangzui 959, Nanfeng glutinous, Neihui 2539, Fu Hui 5138, Mihui 2040, Mihui 9939, Nante No. 202, Shuhao No.1, Minghui 707, Guanghui 3550, Jianhui 146, Xiang 13, Shuhao 204, Shuhui 1577, Minghui 312, Mianna 2115, Mianlong-Hai-Miao, Chunhui-Hai-122, Xinhui-Hai-Miao-Hai-122, Yanhui-Hai, Ciligonmi, nan hui 445, Minghui 2155, Yuchi 231-8, Wenhui 689, Jun Jie No.1, R527, Shu hui 203, Minghui 82, Miyang 23, ao R15, Chengdu dwarf No. 8, Fuhui 9801, Chenghui 19, Minghui 78, Xiangzai No. 13, AoR 69, Gui Dynasty 13, Mihui 9937, Lehui 188, Minhui 1273, Shengyou No.2, Yuhui 310, Guang' second 104, De Hui 3485, Chuan Xinghui 1618, Nanhui 115, Chuan nong 422, Yunhui 68, Shengli indica, Yihui 3003, Luhui 615, Yahui 627, Guang Erwan stone, Changfeng B, Xiang late Hui No. 13, Qianhui 1385, Nanhui 716, Feihui 6, Hongnan, Digu, Qigui Zai early 25, Qian 489, Qian Hui 3301, Yuchui 3308, Yuhui 676, Shihui No. 7, Shi Min 7, Shi, Hai Min 7, Shi 7, Shi, Shi 7, Shi.

8. The application of claim 5, wherein when the photo-thermo-sensitive male sterile line is used for hybrid rice seed production by a two-line method, the method specifically comprises the following steps: firstly, the molecular marker is adopted to detect whether the rice male parent and female parent HIS1 genes have BBC herbicide resistance, rice varieties with the female parent HIS1 gene having no BBC herbicide resistance and the male parent HIS1 gene having BBC herbicide resistance are selected for hybridization, wherein the HIS1 genes of the male parent and the female parent are homozygotes, F1 generation seeds are normally harvested for planting, and BBC herbicide is uniformly sprayed on F1 generation plants to remove progeny of female parent selfing inoculation caused by temperature instability, so that true hybrid progeny is obtained.

9. The use of claim 8, wherein when the photo-thermo-sensitive male sterile line is used for hybrid rice seed production by a two-line method, the female parent used comprises any one or more of Annong S-1, Biaonong 810S, KT27S, Hua 1037S, Xiang Ling 628S, quasisS, LongS, Orlon 1S, Yannong S, jin 4128S, 360S, Huayu 4127S, Z9S, H175S, 885S and Ming S, and the male parent used comprises any one or more of Yuxiangshuan, R402, P143, Yueyao silk sprout, Zhongzao 22, R534 and Huazhan.

10. The use according to claim 8, wherein when the photo-thermo-sensitive male sterile line is used for hybrid rice seed production by the two-line method, the combination of parents comprises: the quanliangyou sesame oil account combination comprises a quanliangyou sesame oil account combination consisting of a quanliangyou female parent and a Jade oil account male parent, a quanliangyou 402 combination consisting of a quanliangyou female parent and an R402 male parent, a Miniangyou 143 combination consisting of a Miniangyou S female parent and a P143 male parent, a Longiangyou Yueyao Si Miao combination consisting of a Longiangyou S female parent and a Yueyao Si Miao male parent, a Jinliangyou 22 combination consisting of a jin 4128S female parent and a Zhongzao 22 male parent, a jin liangyou 534 combination consisting of a jin 4128S female parent and a Huazhan male parent, a Yuliangyou 22 combination consisting of a Huayu 4127S female parent and a Zhongzao 22 male parent, or a Yunliangyou 22 combination consisting of.

11. The use according to any one of claims 7 to 10, wherein the molecular marker is used for detecting whether the rice male parent and female parent HIS1 gene has BBC herbicide resistance, and comprises the following steps: extracting a DNA sample of the rice leaf to be identified by adopting a CTAB method, carrying out PCR amplification by using the DNA sample as a template and the molecular marker, carrying out electrophoresis on the obtained amplification product, and reading the size of the fragment; if the amplified product fragment is a single 182bp band, which indicates that the rice HIS1 gene is a recessive homozygote, identifying that the rice HIS1 gene does not have BBC herbicide resistance; if the amplified product fragment is a single 210bp band, which indicates that the rice HIS1 gene is a dominant homozygote, identifying that the rice HIS1 gene has BBC herbicide resistance; and if the amplified product fragment contains a 182bp band and a 210bp band, which indicates that the rice HIS1 gene is heterozygote, identifying that the rice HIS1 gene has BBC herbicide resistance.

12. The use according to any one of claims 7 to 10, wherein the BBC herbicide is a bifenon herbicide, and is applied by diluting the bifenon herbicide to a concentration of 0.4 μ M to4 μ M and spraying the target plant.

13. Use of the molecular marker of claim 1 or 2 for the transformation of rice material resistant to/susceptible to a BBC herbicide, comprising the steps of: selecting rice varieties with BBC herbicide resistance on one side and without BBC herbicide resistance on the other side as donors and acceptors for hybridization, planting obtained hybrid progeny, detecting the recessiveness type of HIS1 gene of the hybrid progeny population by using the molecular marker, selecting HIS1 gene as a single plant of a heterozygote for selfing, or selecting the heterozygote from backcross progeny obtained after backcrossing with acceptor materials for selfing, detecting the obtained backcross or selfing progeny population by using the molecular marker, and finally selfing and separating the homozygous rice materials with resistance or sensitivity to the BBC herbicide.

14. The use as claimed in claim 13 wherein in said rice cultivar exhibiting resistance To BBC herbicides, the two-line sterile line comprises any one or more of 033S, 1892S, 33S, 66S, 99S, GD-1S, GD-7S, N111S, N5088S, Y58S, wounding 5S, des S, phoenix S, folong S2, guangxian 24S, guangzhan 63-4S, hua 68S, mazai S, crystal 4155S, carica 638S, chlortrimeton S, meng S, mazeng S, pekuai 64S, crine 08S, shannong S, tianan S, tianyuan 6S, hope S, xinan S, xinhua S, starlight S, xuan69S and strain 1S, 871 comprises 93-11, IR24, IR26, restorer line 26, To463, test 235, test for 258, chang 253, chang 1S, chang 93, chang 15, Enghui 58, Fuhui 0724, Fuhui 9303, Fuhui 9802, Fuhui 016, Fuhui 964, Guanghui 128, Guanghui 368, Guanhui 998, Guihui 985, Gui 1025, Gui 44, Gui 649, Gui 99, Hanhui No.3, Huazhan, Huanghuazhan, Jianghui 151, Luhui 1345, Luhui 17, Luhui 602, Luhui 8258, Miyang 46, Minghui 07, Minghui 1259, Minghui 70, Nanhui 009, Nanhui 125, Nanhui 180, Nanhui 511, any one or more of nanhui raddle 819, duckweed recovery 141, qian recovery 1388, rong recovery 906, shu recovery 137, shu recovery 257, shu recovery 361, shu recovery 362, shu recovery 538, shu recovery 600, tai recovery 808, tai recovery 900, wushan si miao, xian recovery 207, xiang recovery 227, xiang recovery 299, xinxiang account, yanghu 332, yanghu 336, yanghu 542, yue 9113, yuenong miao, yue xiang account, zhe recovery 0506, zhe recovery 7954, zhen recovery 129, zhong 413, zhong recovery 8006, zhong recovery 8012, zhong hui 8015, zhong lian recovery 510 and zhong lian recovery 950;

in the rice variety without BBC herbicide resistance, the two-line sterile line comprises one or more of Annong S-1, Biaoling 810S, KT27S, Hua 1037S, Xiang Ling 628S, quasi S, Long S, Orlon 1S, Yannong S, jin 4128S, 360S, Huayu 4127S, Z9S, H175S, 885S and Ming S, and the restoring line comprises IR30, Aohui 15, Changhui T025, Changhui 117, Chenghui 149, Chenghui 19, Chenghui 582, Chuanhui 907, De Hui 3485, De Hui 381, multiscale 1, Philippine 6, Philippine Hui 9801, Luhui 838, Fuhui 2098, Fuhui 5138, Fuhui 673, Fuhui 676, Guanghui 122, Guangkui 312, Guangkui 3550, Guihui 991, Huahui 118, Huahui 188, Luhui 190, Fuhui Luhui 662, Fuhui 2048, Fuhui 2043, Fuhui 51, Fuhui Kahui 2043, Fuhui 10, Fuhui Fu, 100, 1273, 2155, 63, 67, 73, 77, 78, 82, 86, 115, 1659, 183, 445, 716, 2539, 94-11, 1385, 785, 039, 131, 202, 203, 204, 498, 527, 707, 728, 187, 88, 18, 211, 627, 559, 1313, 2084, 2292, 2084, 2292, 3003, 3551, 9, 310, 8, 084, and 42.

15. The use according to claim 13 or 14, wherein the method for detecting the recessive type of the HIS1 gene of a rice plant by using the molecular marker specifically comprises the following steps: extracting a DNA sample of the rice leaf to be identified by adopting a CTAB method, carrying out PCR amplification by using the DNA sample as a template and the molecular marker, carrying out electrophoresis on the obtained amplification product, and reading the size of the fragment; if the amplified product fragment is a single 182bp band, which indicates that the rice HIS1 gene is a recessive homozygote, identifying that the rice HIS1 gene does not have BBC herbicide resistance; if the amplified product fragment is a single 210bp band, which indicates that the rice HIS1 gene is a dominant homozygote, identifying that the rice HIS1 gene has BBC herbicide resistance; and if the amplified product fragment contains a 182bp band and a 210bp band, which indicates that the rice HIS1 gene is heterozygote, identifying that the rice HIS1 gene has BBC herbicide resistance.

Images