CN111304218A

CN111304218A - Rice resistance gene OsRLR1 and application thereof in rice blast resistance

Info

Publication number: CN111304218A
Application number: CN202010199072.9A
Authority: CN
Inventors: 何光华; 杜丹; 桑贤春; 张长伟; 李云峰; 凌英华; 杨正林; 邢亚迪; 鲁欣; 蔡林军; 员菡; 张秋丽; 张莹莹; 陈新龙; 刘明明
Original assignee: Southwest University
Current assignee: Southwest University
Priority date: 2020-03-20
Filing date: 2020-03-20
Publication date: 2020-06-19
Anticipated expiration: 2040-03-20
Also published as: CN111304218B

Abstract

The invention discloses a rice resistance gene OsRLR1 and application to rice blast resistance, wherein the rice resistance gene OsRLR1 is obtained by replacing base A of LOC _ Os10g07978 gene at 953bp position with T, 318 th coded amino acid is changed from glutamic acid to valine, the nucleotide sequence is shown as SEQ ID No.1, and the amino acid sequence of coded protein is shown as SEQ ID No. 2. The expression of the gene obviously enhances the resistance of rice to rice blast germs, does not generate negative influence on yield traits, provides a new gene resource for the resistance breeding of rice blast, transfers the cloned rice blast resistance gene OsRLR1 into plants, and is beneficial to obtaining new disease-resistant plants.

Description

Rice resistance gene OsRLR1 and application thereof in rice blast resistance

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a rice resistance gene OsRLR1 and application thereof to rice blast resistance.

Background

Plants have evolved a complex, inducible set of immune defense mechanisms, whose receptors recognize and respond to pathogen molecules on the cell surface of the plant or invading the cell, in response to pathogen infestation. Plants recognize pathogenic bacteria (PAMPs) on the cell surface through their own Pattern Recognition Receptors (PRRs) and thus activate pathogen-associated molecule-mediated PTI immunity, which is the first line of defense in plant immune processes (Jones and Dangl, 2006; Tena et al, 2011). In order to suppress the defence response of plants, pathogenic microorganisms release effector agents which may trigger the susceptibility (ETS) caused by plant effector agents. However, if there is a corresponding host defense (R) protein that specifically recognizes the effector, a second line-defense Effect Triggers Immunity (ETI) that can be strongly activated (Dodds and Rathjen, 2010; Jones and Dangl, 2006). Activation of ETI in plants often leads to Reactive Oxygen Species (ROS) deposition and cell death at the site of infection, known as Hypersensitivity (HR), which often leads to activation of Systemic Acquired Resistance (SAR), thereby increasing the level of disease resistance throughout the plant (Jones and Dangl, 2006).

The classical "gene-gene" concept was proposed for the ETI response between plants and pathogens as early as over 70 years ago (hammond kosack and Jones, 1997). It functions in a highly complex receptor ligand model in which the plant R gene initiates a defence response by either directly recognising the corresponding AVR gene product, or indirectly monitoring and recognising the modification of host proteins by effector factors (Mackey et al, 2002; MeSTEE and BaulCoube, 2006). The R genes generally have a typical nucleotide binding site-leucine repeat (NB-LRR), and can be classified into two major groups according to their N-terminal domains: the first is TIR-NB-LRR (TLR), the N-terminal of which has homology (TIR) to Drosophila Toll protein and mammalian interleukin 1(interleukin 1) receptor (receptor); another class is that of the N-terminal conserved helical (CC) domains, called CLRs (Monosi et al, 2004).

To date, the R gene has been implicated in a variety of pathogen recognition/defense responses, including fungi, bacteria, viruses and insects. In rice, although many CLRs have been identified and studied, the mechanisms of resistance to rice blast are not deeply studied (Chen and Ronald, 2011; Li et al, 2019 a). Therefore, more disease-resistant genes need to be excavated to explore the disease-resistant mechanism of rice.

Disclosure of Invention

In view of the above, an object of the present invention is to provide a rice resistance gene OsRLR 1.

Still another object of the present invention is to provide a protein encoded by the rice resistance gene OsRLR 1.

Still another object of the present invention is to provide an expression vector containing the rice resistance gene OsRLR 1.

It is still another object of the present invention to provide a host containing the above expression vector.

Still another object of the present invention is to provide the rice resistance gene OsRLR1, the expression vector and the use of the host in rice molecular breeding.

The invention also aims to provide application of the protein coded by the rice resistance gene OsRLR1 in preparation of a drug for resisting rice blast.

In order to achieve the purpose, the technical scheme of the invention is as follows:

1. the invention provides a rice resistance gene OsRLR1, which is OsRLR1

The base A at 953bp of LOC _ Os10g07978 gene is replaced by T, and the amino acid encoded at position 318 is changed from glutamic acid to valine.

Furthermore, the nucleotide sequence of the rice resistance gene OsRLR1 is shown as SEQ ID No.1, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 2.

2. The invention also provides a protein coded by the rice resistance gene OsRLR1, and the amino acid sequence of the protein is shown in SEQ ID No. 2.

3. The invention also provides an expression vector containing the rice resistance gene OsRLR1 in the 1 or 2, wherein the expression vector can be obtained by cloning the rice resistance gene OsRLR1 into a PTCK303 vector. When the rice resistance gene OsRLR1 is constructed into a vector, the gene or the regulatory sequence thereof can be modified appropriately, and other promoters can be used for replacing the original promoter of the gene, so that the rice blast resistance spectrum is widened or the resistance is enhanced.

4. The invention also provides a host containing the expression vector 3.

5. The invention also provides the application of the rice blast resistance gene OsRLR1, the expression vector and the host in rice molecular breeding. The rice resistance gene OsRLR1, the expression vector and the host are introduced into rice or other plant cells by any transformation method, and a transgenic disease-resistant variety expressing the gene can be obtained.

6. The invention also provides application of the protein in preparation of a rice blast resistant medicament.

The inventor of the invention utilizes Ethyl Methane Sulfonate (EMS) to mutate red silk Hui No. 10 (published rice variety) to obtain a rice blast disease-resistant mutant with stable heredity (the mutant is named as rlr1, and the rice resistance gene is named as OsRLR1), and on the basis of genetic analysis and gene positioning, firstly, through gene prediction, homologous retrieval and gene sequence difference comparison, the OsRLR1 controlled by recessive gene for rice blast disease resistance is preliminarily determined, and a disease-resistant protein is coded. Subsequently, the rice blast disease-resistant mutant rlr1 is used as a material, a rice disease-resistant gene OsRLR1 is cloned, the rice disease-resistant gene OsRLR1 has a nucleotide sequence shown as SEQ ID No.1, an open reading frame is 2772bp, 923 amino acids are coded, and the amino acid sequence is shown as SEQ ID No. 2. Compared with the wild type red silk Hui 10, the rice resistance gene OsRLR1 has the base A at 953bp of LOC _ Os10g07978 gene replaced by T, and the amino acid coded at 318 th position is converted from glutamic acid (Glu) to valine (Val).

Then, the cDNA fragment of wild-type gene LOC _ Os10g07978 was transformed into a mutant for complementation verification. In transgenic plants, the phenotype is consistent with the wild type. Further confirms that the rice blast disease resistance trait is controlled by the OsRLR1 gene. Meanwhile, in No. red silk-Hei 10, the gene is overexpressed, so that the resistance to rice blast can be enhanced, and the agronomic traits are not affected, so that the gene has important application value in rice blast resistance breeding.

The invention has the beneficial effects that:

(1) the expression of the rice disease-resistant gene OsRLR1 disclosed by the invention obviously enhances the resistance of rice to rice blast germs and does not generate negative influence on yield traits, the discovery and cloning of the gene provide a new gene resource for the breeding of rice blast resistance, and the cloned rice blast resistance gene OsRLR1 is transferred into plants, thereby being beneficial to obtaining new disease-resistant plants.

(2) The rice blast disease resistance mechanism of the rice resistance gene OsRLR1 can be used for developing a new way for enhancing the rice blast disease resistance of rice and increasing the rice yield.

Drawings

FIG. 1 is a phenotypic characteristic diagram of Wild Type (WT) and rlr1 mutants, wherein A-C are wild type and rlr1 plants at seedling stage (A), tillering stage (B) and mature stage (C); d: leaves of wild type and rlr 1; e: trypan blue stained wild type and rlr1 leaf; F. g: inverted one leaf, inverted two leaves, inverted three leaves and inverted four leaves (1, 2, 3 and 4 in sequence) of the wild type (F) and the mutant rlr1 (G);

FIG. 2 shows the map-based cloning results of OsRLR1, wherein A is the linkage and initial mapping results of OsRLR1 gene, and B: and (3) accurate positioning results of the OsRLR1 gene.

FIG. 3 is a graph of the results of complementation verification of OsRLR1, wherein A is the result of expression analysis of OsRLR1 in wild type, rlr1 and complementary plants, B is the wild type, rlr1 and complementary plants in tiller stage, C is the leaf phenotype of the wild type, rlr1 and complementary plants, D is the disease spots of the wild type, rlr1 and complementary plants after inoculation of rice blast, and E is the statistical result of the disease spots;

FIG. 4 shows the result of subcellular localization analysis of OsRLR1 in rice protoplasts;

FIG. 5 is a cross-sectional view showing the results of expression analysis of OsRLR1, wherein A is a light-shielding treatment of leaves, B is the expression level of OsRLR1 in leaves with different degrees of rust, C is the expression level of OsRLR1 in different periods and at different sites, D is the staining of leaves with a GUS gene expressed from the promoter of OsRLR1, and E is the staining of leaves with a GUS gene expressed from the promoter of OsRLR 1;

FIG. 6 shows the plant and agronomic traits of OsRLR1 overexpression, wherein A is the expression level of OsRLR1 in an OsRLR1 overexpression strain, B-D are sequentially wild type, rlr1 and overexpression OsRLR1 at tillering stage, E-G are sequentially wild type, rlr1 and overexpression OsRLR1 leaves at tillering stage, and H is the plant height (cm), primary branch number, ear length (cm), thousand-grain weight (G) and setting percentage of wild type, rlr1 and overexpression OsRLR 1;

FIG. 7 shows disease resistance of OsRLR1 overexpression plants, wherein A is wild type, rlr1 and lesion spots of overexpression plants after inoculation of rice blast disease, B is statistical result of lesion spots, and C-D are expression analysis of disease course-related genes PR1a and PR10 after inoculation of rice blast disease.

Detailed Description

The present invention will now be described more fully hereinafter with reference to the accompanying specific embodiments, in which some, but not all embodiments of the invention are shown. All other embodiments that can be derived by one of ordinary skill in the art from the embodiments disclosed herein are intended to be within the scope of the present invention.

The experimental procedures, for which specific conditions are not indicated in the examples, are generally carried out according to conventional conditions, for example as described in the molecular cloning protocols (third edition, sambrook et al), or according to the conditions recommended by the manufacturers.

The materials used in the examples of the present invention, wild-type rice material red silk-No. 10 (published rice variety) and rice blast disease-resistant mutant rlr1, were cultivated in the laboratory, the various restriction endonucleases and T4 ligase (D2011A) used in the present study were purchased from TaKaRa Biotech, Inc., the various rapid restriction endonucleases, pEASY-Uniseamless Cloning and Assembly recombinases and DNA Marker were purchased from Beijing holothurian Biotech, Inc., other chemical reagents, such as sucrose, peptone, yeast extract, glucose, calcium chloride, CTAB, Tris-HCl, EDTA, sodium chloride, acrylamide, TEMED, agar powder, X-Glu were purchased from SIGMA, and Shanghai Biotech, Inc., the general DNA Purification and recovery Kit (Universasal DNA Purification and recovery Kit), the Plasmid extraction Kit (TIANKip primer sequencing Kit) and RNA sequencing Kit were purchased from cDNA polymerase chain reaction (cDNA) and RNA extraction Kit (cDNA polymerase chain reaction Kit) (PCR amplification) were purchased from TARG, PCR amplification technology, cDNA polymerase chain reaction Kit, (PCR) and RNA extraction Kit (cDNA polymerase chain reaction Kit) (PCR) were purchased from TARG 580, PCR technology Kit, (PCR technology Kit) (BioSciK 2, PCR technology Kit, Biotechnology Kit, PCR technology Kit, and Kit, Kit.

Example 1 obtaining and morphological Observation of Rice blast resistant mutant rlr1

Ethyl Methane Sulfonate (EMS) is utilized to mutate indica rice variety red silk Hui No. 10 (a published variety), a genetically stable rice blast disease-resistant (recessive) mutant is found in a progeny mutant population, and is subjected to multi-generation selfing and genetic stability, wherein the genetically stable rice blast disease-resistant (recessive) mutant is named as RPM1 like resistance gene1(RLR1), and a rice blast disease-resistant character control gene (namely a rice blast resistance gene) is named as OsRLR 1.

Comparative observations of the whole growth period were made for rlr1 and the wild type. In a well-conditioned field, the tips of the inverted leaves at seedling stage rlr1 began to appear brown lesion-like spots, and the degree of lesion-like spots gradually increased with increasing leaf age (FIGS. 1A-B). At the same time, further by trypan blue staining, rlr1 leaf was found to be stained in deep blue in most plaque-like areas, demonstrating that its cells had died (FIG. 1E). Notably, rlr1 also exhibited a premature yellowing phenotype, with four leaves having withered, leaving only 3 functional leaves, while the wild type remained green (FIG. 1F, G). At plant maturity, the leaves of rlr1 have almost completely withered, while three functional leaves of the wild type remain green (FIG. 1C).

Example 2 genetic analysis and mapping of mutant rlr1 Gene

The hybrid combination of Xinong 1A and rlr1 is used to obtain F1 generation plants, and F1 generation plants have normal phenotype and no difference from wild type. F2 generation plants are obtained after F1 generation plants are selfed, F2 generation groups have obvious character separation, normal 2823 plants and 907 like lesion mutant plants are subjected to chi-square detection (chi 2 is 0.878 and chi 20.05 is 3.84), the separation ratio is consistent with 3:1, and the result shows that the rlr1 mutant is controlled by a pair of single recessive nuclear genes.

The F2 generation group hybridized with the Xinong 1A and the rlr1 is selected as a positioning group, and 907 mutant individuals for gene positioning are obtained in total. 420 pairs of SSR markers uniformly distributed on 12 rice chromosomes are selected to carry out polymorphism analysis on parents, 10 normal strains and 10 rusty spot mutant strains are respectively selected from F2 generation populations to construct a normal gene pool and a mutant gene pool, and differential primers are used for carrying out linkage analysis. RM6271 was found to be linked to our gene of interest. Then 20 pairs of insertion and deletion primers were designed on chromosome 10 for initial mapping, and the gene of interest was mapped between XYD1-6 and XYD16 at a physical distance of 1.85Mb (FIG. 2A). 907 strain F2 population was used for fine localization, and OsRLR1 gene was further localized between XYD3-2 and XYD11, with only 1 and 6 crossover strains, respectively, and no inclusion relationship, and the physical distance was 66kb (FIG. 2B). According to the gene annotation information provided on the Gramene website, there were 15 predicted genes in this interval, of which there were 4 expressed proteins, 4 retrotransposons, 1 transposon, 1 putative protein, 1 non-apical meristematic protein, 1 calbindin, 1 chalcone synthase, 1 HVA22 abscisic acid-inducing protein, and 1 LTPL132 protease inhibitor. Sequencing candidate genes within the localization interval revealed only one gene: the coding sequence (CDS) of LOC _ Os10g07978 was mutated, base A at 953bp of LOC _ Os10g07978 was replaced by T, and the amino acid at position 318 was changed from GLU to VAL ((FIG. 2B).

Tables 1 and 5 for SSR marker sequences having polymorphisms

	Forward sequence (5 '→ 3')	Reverse sequence (5 '→ 3')
			RM6271	CAATCAGCACCACCTATGGG	CGGACAAGGTTCTCTAGGCC
XYD11	AAATCAGGAAGGCAATAAAGATC	CAAACAAGACCATAGAATCTCGTAC
			XYD16	AGACGAGCGTGGAGATGG	GAGCTTAGCAGTCCCACTGC
XYD1-6	GCCTCGATAACGCTACTTGAC	GCGTCTTCACTACATGGCTAAG
			XYD3-2	AACTCATTCCATGCATATGAGAA	AATCTATTTCGAGAGGCATCTC
XYD3-4	GTTGCAGAAGGGAGCAATACT	GGACCAAATTAAAGCAATGTAGAC

Sequencing analysis showed that the MSU annotated gene LOC _ Os10g07978(http:// rice. plant biology. MSU. edu/cgi-bin/gbrowse/rice /) was mutated in the rlr1 mutant, with a base change from A to T at 953, resulting in the conversion of the amino acid encoded at position 318 from glutamate to valine (FIG. 2B).

To demonstrate whether a mutation of LOC _ Os10g07978 results in a mutant phenotype, we performed complementation verification by transforming a cDNA fragment containing the wild-type gene LOC _ Os10g07978 into the mutant. The specific method comprises the following steps: with OsRLR 1C-F: 5' -GCCggatccATGGCTGAGGGCGTCATTGGCTCG-3 and OsRLR 1C-R: 5'-GCCactagtTTATTGTATCCTTTCTGCAGCCAGCTC-3' is a primer, the 2772bp cDNA sequence of mutant gene LOC _ Os10g07978 is amplified, the amplification product is connected into PTCK303 vector (purchased from Biovector plasmid vector strain cell gene collection center), complementary recombinant expression vector is obtained, the obtained complementary recombinant expression vector PTCK303-LOC _ Os10g07978 is transformed into wild type, transgenic plant is obtained, then the leaf blade character of the transgenic plant is observed, and the result is shown in figure 2. The results showed that the phenotype of the transgenic plants was consistent with that of the wild type (FIG. 2B, C). Further rice blast resistance studies on the complementary plants showed that the resistance to rice blast was also restored to wild type levels (FIG. 2D). That is, LOC _ Os10g07978 gene is the target gene OsRLR 1.

Example 3 subcellular localization and expression Pattern analysis of OsRLR1 protein

To determine the localization of the OsRLR1 protein, transient expression was performed in rice protoplasts. The localization of the OsRLR1 protein was first studied by the rice protoplast transient expression system. The specific method comprises the following steps: and the content of the active component is expressed by OsRLR1 sl-F: 5'-GCCtctagaATGGCTGAGGGCGTCATTGGCTCG-3' and OsRLR1 sl-R: 5'-GCCggatccTTGTATCCTTTCTGCAGCCAGCTC-3' as primers, amplifying CDS fragment of wild type gene LOC _ Os10g07978, the amplification product being ligated to 35S: OsRLR1-GFP fusion expression protein was constructed in a GFP-NOS (pAN580) expression vector (purchased from Biovector plasmid vector, cell culture Collection). Then, GFP and OsRLR1-GFP, plasmid of nuclear marker with RFP were transferred into rice protoplast, incubated overnight at 28 ℃ in the dark, and fluorescence of GFP and RFP was observed with Zeiss laser scanning confocal microscope.

After the OsRLR1-GFP, the nuclear marker-RFP protein and the single GFP protein are transiently expressed in the rice protoplast, green fluorescence detected by the cells expressing the OsRLR1-GFP fusion protein can be well matched with the nuclear marker-RFP signal, and the cells expressing the GFP protein all detect the green fluorescence in the whole cells. This result indicates that OsRLR1 is localized to the nucleus (FIG. 4).

To determine the expression pattern of OsRLR1, real-time fluorescence quantification was performed using the primers of table 2. The reaction system with ACTIN as the internal reference is as follows: adding 3 muL of cDNA template, 1 muL of primer, 10 muL of SYBR Green fluorescent dye and 6 muL of RNase-free H2O into a 20 muL reaction system, and carrying out fluorescent quantitative amplification on a Bio-rad fluorescent quantitative PCR instrument; the amplification conditions were: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 30 seconds, renaturation at 56 ℃ for 30 seconds, extension at 72 ℃ for 1 minute, and 45 cycles; finally, extension is carried out for 10 minutes at 72 ℃, and then data collection and processing are carried out by using CFX-Manager software, and the result is shown in FIG. 3. As can be seen from FIG. 3, the expression of OsRLR1 was correlated with the severity of the phenotype, and the phenotype of leaf-like lesions was induced by light (FIG. 5A, B). Further analysis showed that: OsRLR1 was expressed in leaves at various stages (FIG. 5C). We used OsRLR1 p-F: 5'-GCCgaattcGGCACACAACTTCCTCTCTCTCTCTCTTC-3' and OsRLR1 p-R: 5'-GCCggatccGGTTGTCTAGCCAGAGCTATAAGAT-3' the promoter of OsRLR1 was amplified and cloned into vector pCA1301 (purchased from Biovector plasmid vector, cell Gene Collection) to express the GUS gene. The obtained transgenic plants were subjected to GUS staining. The results showed that OsRLR1 is mainly expressed in the vascular bundle of leaves (fig. 5D).

TABLE 2 primer sequences

Primer and method for producing the same	Forward sequence (5 '→ 3')	Reverse sequence (5 '→ 3')
			ACTIN	CAGGCCGTCCTCTCTCTGTA	AAGGATAGCATGGGGGAGAG
OsRLR1	CTCTCGTTGCGGGCACGG	GAAGCCAAAGACTACCCTCTGGCC

Example 4 phenotypic and agronomic traits of overexpression of OsRLR1 Gene

To explore the function of OsRLR1, we overexpressed by transforming a cDNA fragment containing genotype red silk recovery 10 LOC _ Os10g07978 into red silk recovery 10. The specific method comprises the following steps: with OsRLR 1C-F: 5'-GCCggatccATGGCTGAGGGCGTCATTGGCTCG-3' and OsRLR 1C-R: 5'-GCCactagtTTATTGTATCCTTTCTGCAGCCAGCTC-3' is a primer, a 2772bp CDS sequence of the mutant gene LOC _ Os10g07978 is amplified, an amplification product is connected into a PTCK303 vector (purchased from Biovector plasmid vector strain cell gene collection center), an over-expression recombinant vector is obtained, the obtained over-expression recombinant vector PTCK303-LOC _ Os10g07978 is transformed into a wild type, a transgenic plant is obtained, and then the leaf blade character of the transgenic plant is observed, and the result is shown in figure 6. First, we performed quantitative analysis, and the expression level of OsRLR1 was much higher in the transgenic lines than in the wild type, indicating success of the transgene (FIG. 6A). Transgenic plants overexpressing OsRLR1 showed no significant difference in growth and development from wild type (FIGS. 6B-C), and no lesion-like phenotype was observed in leaves (FIGS. 6D-G).

To further explore the effect of OsRLR1 on growth and development, we performed seed copy analysis on three transgenic lines overexpressing OsRLR 1. The results show that: transgenic plants overexpressing OsRLR1 have no significant influence on plant height, branch number per time, ear length, thousand kernel weight and seed setting rate. Thus, overexpression of OsRLR1 did not result in a severe impact on the growth and development of rice, nor did it significantly affect its yield (FIG. 6G).

Example 5 overexpression of OsRLR1 enhances disease resistance to Rice blast

To explore the mechanism of action of OsRLR1 on resistance to rice blast. We used various physiological races of rice blast (ZB7, ZB11, ZB31) to inoculate rice blast to wild type, mutant rlr1 and transgenic plants overexpressing OsRLR1 at seedling stage, and observed 10 days after inoculation.

The results show that the resistance of transgenic plants over-expressing OsRLR1 to rice blast is increased to different degrees. The lesion size produced on the leaf was smaller (fig. 7A), and statistical results showed that the lesion length of the overexpressed OsRLR1 was significantly or very significantly smaller than that of the wild type (fig. 7B). Meanwhile, real-time fluorescence quantitative analysis of expression analysis of pathogenesis-related genes PR1a and PR10 after inoculation of rice blast disease was carried out using the primers of Table 3 and ACTIN as an internal reference according to the method described above. The results showed that the expression levels of PR1a and PR10 were much higher in all three lines overexpressing OsRLR1 after inoculation of rice blast than in the wild type (FIG. 7C, D), indicating that the immune response was activated in plants overexpressing OsRLR 1. Thus, OsRLR1 plays a positive role in the regulation of resistance to rice blast.

TABLE 3 primer sequences

Primer and method for producing the same	Forward sequence (5 '→ 3')	Reverse sequence (5 '→ 3')
			PR1a	TTCATCACCTGCAACTACTCG	TGCATAAACACGTAGCATAGCAT
PR10	CACCATCTACACCATGAAGC	AGCACATCCGACTTTAGGAC

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, but rather as the intention of all modifications, equivalents and improvements falling within the spirit and scope of the invention.

Sequence listing

<110> university of southwest

<120> Rice resistance gene OsRLR1 and application to resistance to rice blast

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>3518

<212>DNA

<213> Rice mutant (Oryza sativa L.)

<400>1

gaaacgaaaa gacggggggc gacgaggcga gcgcgagaaa gagaaagaga gagcaacgcc 60

ccaaccacca ccccctctgc ccaggcccca gatccctcca ccccatcgca cgccacaaca 120

taacataaca ccgcaaacac gcaccctccc aacagacgcc tcctcccctc cctccctccc 180

acctacactc cgctgcgcag ccagcttcgc tcgcccgcta cctcactcac tctcgggtga 240

gcgcggccac cgctgccggc gacgaggtag ggaggaggag gagggcaaga tgttcgggcg 300

ggacccgtgg ggcgggccgc tggagatctc gaatgcggac tcggcgacgg acgacgaccg 360

gagccgggac ctggacaggg gggcgctgat gcggcagctg gacgagacgc agcagagctg 420

gctcctggcc gggccgggcg accaggccgg caagaagaag aagaagtacg tcgacctcgg 480

ctgcatggtc ctcgaccgca agatcttcat gtggaccgtc ggcaccatcc tcggcgtcgg 540

cctcttcatc ggcttcgtca tgatgatcgt caagctcgtc ccccacaagc gcccccctcc 600

tcctcccccc gaccagtaca cccaggccct ccacaaggcc ctcatgttct tcaacgcgca 660

acgatgtgag tttttttcac tcctttcctc cctccgtctc catctctgtc tgcatcagaa 720

gaagaggagg aagaagattt cagaattcag atccggtttt gcacggcaat gtcgtgcgaa 780

aaagacgggc acttgcagct gtctctcccc tgtctcggag tggcctctgc tgcctcactc 840

tgtttctaca tttagcatgt ctttgttgct aaaagatctg gtcatttgca ctaaattacc 900

cccacatata ttctctccac gcatgtttaa ccagatcacg gtccacgtgc aataaactac 960

tgtcaaaatg acattttttt cctcggtcct ggatcttgag agaggatgaa caaaagtcaa 1020

tgtgaattcg aattcatata agcaaattct gctcaccttc tgacgatgta tcgttctgaa 1080

tgtcagctgg tccgctgccg aagcataacg gcgtcagctg gagggggaat tcttgcatga 1140

aggatggcct ctccgacagc accgtccgga agagcttggt cggaggcttc tacgacgcag 1200

gagacgccat caagttcaac taccccatgg cctggtccat gaccatgctc agctggagtg 1260

tgatcgagta caaggccaag tatgaggcga tcggtgagct cgaccatgtc aaggagctga 1320

tcaagtgggg cacagattac ctcctcaaga ccttcaattc atcagccgat actatcgatc 1380

ggatcgtcgc acaggttggt agaagccgac catctgttaa tcctgagttt tcactttcct 1440

gtcccaagaa ataaggcgtc agatccactc aaatatgtag agtaaacttc acagcagatt 1500

ttctaaatca ttggtatcat atgaacttct tattgcaggt gggtgtaggt gacacctcaa 1560

aaggtggtgc ccaacctaat gaccactact gctggatgag gccagaggat atcgattacc 1620

ccagacctgt cactgagtgc cactcttgct cagatcttgc ttccgaaatg gctgctgccc 1680

ttgctgcagc ttccatagtg ttcaaggaca gcaagactta ctctgacaag ctcgtgcgtg 1740

gcgcaaaggc cctgtacaag ttcggtaggc tgcagcgtgg gagatacagc cccaatggct 1800

ctgatcaagc aattttctac aattccacca gttactggga tgagtttgtg tggggtggtg 1860

cgtggatgta ctttgccaca gggaacaata catacctatc ggttgcaaca gctccgggga 1920

tggcaaagca tgctggagca tactggctcg atagtccgaa ttatggagtt tttacctggg 1980

atgacaagct tccaggagct caggttagca tacttcacac ctctgtactc agtgcactgg 2040

ttagctagaa ccacattgca gttagtgtaa aatgacagaa gaaggataag gtaatctgaa 2100

tgagaaaata tacaagtgtt ttagaaggtg caggaattaa ccaaaaatga tttgcataga 2160

gaagggtggt taatggtata cttcaatact gcagcgatac tgtgatagtg atccacctct 2220

aacattgttt ctactttatt caggttcttc tgagcaggtt gcggcttttc ctaagtcctg 2280

gatatcctta cgaagaaata ctgagaacat ttcacaacca aacagacaat gttatgtgct 2340

cgtatctgcc gatgtacaat tcattcaact ttaccaaagg tcggtgctgt tccccctttg 2400

cctctctttt tttctctcta gccacaaatg gaagttaaac aatgggaggt ttacaggagg 2460

aatgatacag ctcaaccacg gaaggcctca gccacttcag tatgttgtca atgcggcttt 2520

ccttgcctct ctatacagcg attacctgga tgctgcagat acacctgggt ggtattgtgg 2580

acctactttc tacactacag aagtcctccg caaatttgca aggtcacagg taaggttttg 2640

ttgcccatgc tcttgaagta gtcaaagcta cattagcaca gttcggtgaa tttgacaccc 2700

aaaacccttc aatttgcagc tcgattatgt cctaggtaag aacccactga agatgagcta 2760

cgttgtgggt tttggaaaca agtaccccaa gcgcgctcat cacagaggtg catcaatccc 2820

tcataatggt gtcaaatatg gatgcaaagg aggctttaaa tggagggaga ctaagaagcc 2880

aaatcctaat atccttattg gagcactggt tgctggccct gataggcatg atggcttcaa 2940

aaatgtccgt acaaactaca attacacgga gcctactctt gcagcaaatg ctggcctggt 3000

ggcagccttg atttccctaa ctaacattca cgtcaaaagt ggaatcgata agaacaccat 3060

cttctctgca gttcctccga tgtttccaac tcccccacct ccaccgtcag cttggaaacc 3120

atgaagagtc agatcgctga atatttcttg agcatcaaac ggagggaacg acagatgttt 3180

gtttggtaca gcaaaggaca catacagaaa gcagacaaca taagcttaca gagcctctat 3240

tttctgtatc agtatgacag atcggtataa attcatctgt cgacaataga ccgggatgtt 3300

gtgtgcacct tgtgaaacta atttttgggg tccttgttgt tattcgttca gagctcatgt 3360

gtgaagttct ttttgtagaa atggaacctt tataaaccgt tttataggag tgactttatc 3420

atcatactaa aggatttgtg taacctttat acagctttct tgattccatt tttatctctt 3480

tgccttacat ttcagccaca cttcaggggc atgttcac 3518

<210>2

<211>619

<212>PRT

<213> Rice mutant (Oryza sativa L.)

<400>2

Met Phe Gly Arg Asp Pro Trp Gly Gly Pro Leu Glu Ile Ser Asn Ala

1 5 10 15

Asp Ser Ala Thr Asp Asp Asp Arg Ser Arg Asp Leu Asp Arg Gly Ala

20 25 30

Leu Met Arg Gln Leu Asp Glu Thr Gln Gln Ser Trp Leu Leu Ala Gly

35 40 45

Pro Gly Asp Gln Ala Gly Lys Lys Lys Lys Lys Tyr Val Asp Leu Gly

50 55 60

Cys Met Val Leu Asp Arg Lys Ile Phe Met Trp Thr Val Gly Thr Ile

65 70 75 80

Leu Gly Val Gly Leu Phe Ile Gly Phe Val Met Met Ile Val Lys Leu

85 90 95

Val Pro His Lys Arg Pro Pro Pro Pro Pro Pro Asp Gln Tyr Thr Gln

100 105 110

Ala Leu His Lys Ala Leu Met Phe Phe Asn Ala Gln Arg Ser Gly Pro

115 120 125

Leu Pro Lys His Asn Gly Val Ser Trp Arg Gly Asn Ser Cys Met Lys

130 135 140

Asp Gly Leu Ser Asp Ser Thr Val Arg Lys Ser Leu Val Gly Gly Phe

145 150 155 160

Tyr Asp Ala Gly Asp Ala Ile Lys Phe Asn Tyr Pro Met Ala Trp Ser

165 170 175

Met Thr Met Leu Ser Trp Ser Val Ile Glu Tyr Lys Ala Lys Tyr Glu

180 185 190

Ala Ile Gly Glu Leu Asp His Val Lys Glu Leu Ile Lys Trp Gly Thr

195 200 205

Asp Tyr Leu Leu Lys Thr Phe Asn Ser Ser Ala Asp Thr Ile Asp Arg

210 215 220

Ile Val Ala Gln Val Gly Val Gly Asp Thr Ser Lys Gly Gly Ala Gln

225 230 235 240

Pro Asn Asp His Tyr Cys Trp Met Arg Pro Glu Asp Ile Asp Tyr Pro

245 250 255

Arg Pro Val Thr Glu Cys His Ser Cys Ser Asp Leu Ala Ser Glu Met

260 265 270

Ala Ala Ala Leu Ala Ala Ala Ser Ile Val Phe Lys Asp Ser Lys Thr

275 280 285

Tyr Ser Asp Lys Leu Val Arg Gly Ala Lys Ala Leu Tyr Lys Phe Gly

290 295 300

Arg Leu Gln Arg Gly Arg Tyr Ser Pro Asn Gly Ser Asp Gln Ala Ile

305 310 315 320

Phe Tyr Asn Ser Thr Ser Tyr Trp Asp Glu Phe Val Trp Gly Gly Ala

325 330 335

Trp Met Tyr Phe Ala Thr Gly Asn Asn Thr Tyr Leu Ser Val Ala Thr

340 345 350

Ala Pro Gly Met Ala Lys His Ala Gly Ala Tyr Trp Leu Asp Ser Pro

355 360 365

Asn Tyr Gly Val Phe Thr Trp Asp Asp Lys Leu Pro Gly Ala Gln Val

370 375 380

Leu Leu Ser Arg Leu Arg Leu Phe Leu Ser Pro Gly Tyr Pro Tyr Glu

385 390 395 400

Glu Ile Leu Arg Thr Phe His Asn Gln Thr Asp Asn Val Met Cys Ser

405 410 415

Tyr Leu Pro Met Tyr Asn Ser Phe Asn Phe Thr Lys Gly Gly Met Ile

420 425 430

Gln Leu Asn His Gly Arg Pro Gln Pro Leu Gln Tyr Val Val Asn Ala

435 440 445

Ala Phe Leu Ala Ser Leu Tyr Ser Asp Tyr Leu Asp Ala Ala Asp Thr

450 455 460

Pro Gly Trp Tyr Cys Gly Pro Thr Phe Tyr Thr Thr Glu Val Leu Arg

465 470 475 480

Lys Phe Ala Arg Ser Gln Leu Asp Tyr Val Leu Gly Lys Asn Pro Leu

485 490 495

Lys Met Ser Tyr Val Val Gly Phe Gly Asn Lys Tyr Pro Lys Arg Ala

500 505 510

His His Arg Gly Ala Ser Ile Pro His Asn Gly Val Lys Tyr Gly Cys

515 520 525

Lys Gly Gly Phe Lys Trp Arg Glu Thr Lys Lys Pro Asn Pro Asn Ile

530 535 540

Leu Ile Gly Ala Leu Val Ala Gly Pro Asp Arg His Asp Gly Phe Lys

545 550 555 560

Asn Arg Thr Asn Tyr Asn Tyr Thr Glu Pro Thr Leu Ala Ala Asn Ala

565 570 575

Gly Leu Val Ala Ala Leu Ile Ser Leu Thr Asn Ile His Val Lys Ser

580 585 590

Gly Ile Asp Lys Asn Thr Ile Phe Ser Ala Val Pro Pro Met Phe Pro

595 600 605

Thr Pro Pro Pro Pro Pro Ser Ala Trp Lys Pro

610 615

Claims

1. A rice resistance gene OsRLR1 is characterized in that the rice resistance gene OsRLR1 is characterized in that base A of LOC _ Os10g07978 gene at 953bp is replaced by T, and the 318 th coded amino acid is changed from glutamic acid to valine.

2. The rice resistance gene OsRLR1 of claim 1, wherein the nucleotide sequence of the rice resistance gene OsRLR1 is shown as SEQ ID No.1, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 2.

3. A protein coded by a rice resistance gene OsRLR1 has an amino acid sequence shown in SEQ ID No. 2.

4. An expression vector comprising the rice resistance gene OsRLR1 according to any one of claims 1 to 2.

5. A host comprising the expression vector of claim 4.

6. Use of the rice resistance gene OsRLR1 of any one of claims 1 to 2, or the expression vector of claim 4, or the host of claim 5 in rice molecular breeding.

7. The use of the protein according to claim 2 for the preparation of a medicament against blast disease.