CN111303294A - Method for rapidly screening antibody expression cells in cell surface display mode - Google Patents

Abstract

The invention belongs to the technical field of biology, and discloses a method for rapidly screening antibody expression cells in a cell surface display mode. The method mainly comprises the step of introducing and expressing a cDNA sequence related to protein A/G with antibody binding capacity into an antibody expression cell, wherein an expression product of the sequence is a protein containing a signal peptide, an IgG binding region and a transmembrane region. The complex of the protein and the antibody molecule is finally present on the cell surface after vesicle transport to the plasma membrane. And screening corresponding secretory cells by utilizing the specific binding of the antigen and the antibody. The invention can avoid the complicated processes of multi-hole plate culture, detection and screening in the conventional monoclonal antibody screening, does not need resistance conditions, greatly saves time, manpower and material resources and shortens the antibody production period.

Description

Method for rapidly screening antibody expression cells in cell surface display mode

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for rapidly screening antibody expression cells in a cell surface display mode.

Background

An antibody is an immunoglobulin produced by B lymphocytes or plasma cells that specifically binds to a corresponding antigen following stimulation of the body by the antigen. Among them, an antibody that is highly homogeneous and recognizes only a specific epitope, produced by a single B cell clone, is called a monoclonal antibody, abbreviated as mab. It has the advantages of strong specificity, high purity, good uniformity, etc. The first generation of monoclonal antibodies was prepared by Kohler and Milstein in 1975, and was monoclonal antibodies against sheep red blood cells derived from mouse B cell hybridomas. In recent years, with the continuous and deep research, more and more monoclonal antibody medicines are developed and applied to the treatment of tumors, viral infections, cardiovascular diseases and other diseases, and especially show good prospects in tumor immunotherapy.

The major difference between monoclonal antibodies and antisera (also known as polyclonal antibodies, polyclonal antibodies) is that monoclonal antibodies are a homogeneous immunoglobulin molecule produced by a single B cell clone. The monoclonal antibody most commonly used is a mouse monoclonal antibody, and the technique for preparing monoclonal antibodies is also called hybridoma technique. The basic principle of hybridoma technology is to hybridize B cells which secrete antibody but cannot be cultured for a long time with tumor cells which can be cultured in vitro for a long time and can be stored at low temperature, and to obtain hybridoma cells which can secrete antibody and have the characteristics of tumor cells through screening. Monoclonal antibody production is possible using monoclonal hybridoma cells, and is now more common with murine mAb, rabbit mAb and others that have been gradually produced but not yet scaled up.

Although the monoclonal antibody technology of the mouse is mature, the screening processes such as multi-well plate culture and detection are more complicated, and the period is longer. Excessive steps may also result in a reduction in the quality of antibody screening, ultimately affecting the quality of the screening results. The invention is characterized in that a new technology is introduced, the screening process of the monoclonal antibody is optimized and simplified, the screening time is shortened, the screening quality is improved, a brand new mode is provided for screening the monoclonal antibody, a simplification and optimization means is provided for the existing monoclonal antibody screening method, and a powerful technical support is provided for the preparation of other animal and human monoclonal antibodies which are difficult to carry out.

Disclosure of Invention

Aiming at the defects and actual requirements of the prior art, the invention provides a method for rapidly screening antibody expression cells in a cell surface display mode.

The technical problem to be solved by the invention is realized by the following technical scheme:

a method for cell surface display-based rapid screening of antibody-expressing cells, comprising the steps of: constructing a plasmid or viral expression system which expresses a protein comprising a signal peptide, an IgG binding domain and a C-terminal transmembrane domain structure after transfection or infection of a cell; the antibody binds to the protein and is displayed on the cell surface.

Further, the air conditioner is provided with a fan,

the method further comprises:

screening antibody expressing cells, and screening antibody secreting cells by combining fluorescent labeling or magnetic bead crosslinked antigen with antibody.

Preferably, the first and second electrodes are formed of a metal,

the expression system is pLVX-Puro-TET ON vector.

Preferably, the first and second electrodes are formed of a metal,

the pLVX-Puro-TET ON vector is obtained by inserting a TET operon sequence between XhoI and EcoRI sites of the PLVX-Puro vector.

Preferably, the first and second electrodes are formed of a metal,

the antibody is a monoclonal antibody.

Preferably, the first and second electrodes are formed of a metal,

the antibody is a polyclonal antibody.

Further, the air conditioner is provided with a fan,

the method comprises the following steps:

1) constructing a viral expression system carrying a cDNA sequence encoding a protein A/G comprising a signal peptide, an IgG binding domain and a C-terminal transmembrane domain;

2) preparing a recombinant virus suspension;

3) antibody-expressing cells were screened.

Further, the screening of the antibody-expressing cells comprises the following steps:

(1) establishment of myeloma cell line stably expressing cell surface protein A/G: infecting myeloma cells with the recombinant virus suspension, and screening by utilizing puromycin resistance to obtain a myeloma cell strain stably expressing protein A/G;

(2) fusion of a myeloma cell line expressing protein A/G with an antibody-expressing cell: fusing a myeloma cell line expressed by protein A/G with mouse spleen B cells immunized by a specific antigen and culturing for 12 hours, removing a culture solution, washing twice by PBS, adding cells containing tetracycline or doxycycline to culture for 4-8 hours, and collecting the cells in a centrifuge tube;

(3) binding of antigen magnetic beads to antibody-expressing cells: adding the magnetic beads crosslinked with the antigens into the centrifugal tube collected with the cells in the step (2), shaking gently for half an hour, and washing out the cells not combined with the magnetic beads under the condition of a magnetic field;

(4) cells were eluted with antigen and cultured either mixed or monoclonally: culturing the collected cells in a culture solution without tetracycline and doxycycline, and then carrying out polyclonal antibody detection and screening of monoclonal optimized cell strains;

(5) cell lines were identified and stored.

Preferably, the cDNA sequence may be provided with an expression switch.

Preferably, the switch is a tetracycline control switch.

Compared with the prior art, the invention has the advantages that the following aspects are mainly included but not limited:

the method can lead the normal secretory antibody cell to show the antibody in a cell surface binding form, thereby being beneficial to the specificity screening;

the method can avoid the complicated processes of multi-hole plate culture, detection and screening in the conventional monoclonal antibody screening;

the method does not need resistance conditions for screening and culturing, greatly saves time, manpower and material resources, and shortens the antibody production period;

the method of the invention can also preserve and prepare specific polyclonal antibody, and extends to the preparation of different monoclonal antibodies of other animals and human beings.

Drawings

FIG. 1: a flow chart of traditional mouse monoclonal antibody preparation;

FIG. 2: the invention relates to a preparation flow chart of a mouse monoclonal antibody;

FIG. 3: a cDNA expression cassette comprising a signal peptide, an IgG binding region, and a C-terminal transmembrane region;

FIG. 4: a map of intracellular synthetic transport and secretion of antibodies expressed by normal cells and specialized cells;

FIG. 5: comparing the screening method with the traditional method;

FIG. 6: a magnetic bead screening flow chart;

FIG. 7: schematic diagram of magnetic bead screening.

Detailed Description

In order to make the technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples, but the present invention is not limited to the scope of the examples. The experimental procedures, in which the specific conditions are not specified in the examples, are generally carried out according to the conventional conditions or according to the conditions recommended by the manufacturers.

Example 1

Brief description of the invention

The present invention constructs a plasmid or virus expression system to transfect or infect cells and then express a protein containing a signal peptide, an IgG binding region and a C-terminal transmembrane domain structure, and the protein is synthesized in the endoplasmic reticulum like an antibody molecule due to the signal peptide sequence, so that the protein is combined with the antibody molecule after synthesis. Thus, antibody molecules originally secreted outside the cell appear on the cell surface due to binding to the membrane protein molecules. Through means such as combining the antigen which is fluorescently labeled or crosslinked by magnetic beads with the specific antibody, the specific antibody secreting cells can be simply and efficiently screened;

the present invention constructs a plasmid or viral system for transient or stable expression comprising a specific cDNA capable of expressing a protein comprising a signal peptide, an IgG binding domain and a C-terminal transmembrane domain. The expression control region of the cDNA can be additionally provided with an expression switch (tetracycline control switch or similar devices) so as to facilitate the screening of antibody expression cells and the preparation of antibodies. When a particular cDNA is introduced into an antibody-expressing cell, the expressed protein product may present the antibody produced by the cell in a cell membrane-bound form on the cell surface. Cells expressing surface-bound forms of antibodies can be obtained in a variety of ways including: 1. marking specific antibody expression cells (including B cells or antibody expression cells fused with tumor cells) by using fluorescence-marked antigens and sorting the cells by a flow sorting system; 2. the antigen is cross-linked to the magnetic beads, and the specific antibody expressing cells are adsorbed by the magnetic field and separated from other cells. As shown in FIG. 3, a cDNA expression cassette comprising a signal peptide, an IgG binding region, and a C-terminal transmembrane region, and a DNA sequence encoding the signal peptide, IgG binding region, transmembrane region, and a small fragment of the C-terminal intracellular region, was constructed.

As shown in fig. 6, the expression control device for a specialized myeloma cell is set to an "off" state prior to fusion with a B cell to avoid binding of free IgG to specific surface products and false positives. After fusion with B cells, the specialized myeloma cell expression control device is set to an "on" state, thereby allowing the specific protein to be expressed, bound to IgG, and present together on the cell surface to facilitate specific screening. When the screening task is complete, the device is turned off to facilitate normal antibody secretion from the cells. The switch control is completed by adding and not adding tetracycline.

As shown in FIG. 7, the antibody-expressing cells (B cells and their fusion cells or other antibody-expressing systems) with specific apparatus can be specifically bound by the antigen crosslinked by magnetic beads, and then suspended on the tube wall by magnetic field, after non-specific antibody-expressing cells are flowed and washed off completely, the specifically expressed antibody cells are eluted by competitive eluent, and then cultured with polyclonal or monoclonal antibody.

Fig. 1 and fig. 2 compare the difference between the conventional process for preparing the murine monoclonal antibody and the process for preparing the murine monoclonal antibody of the present invention, and it can be seen that the method of the present invention can avoid the tedious process of multi-well plate culture, detection and screening in the conventional monoclonal antibody screening, greatly save time, manpower and material resources, and shorten the antibody production cycle; as can be seen in the combination of FIGS. 4-5, the method of the present invention enables normal antibody-secreting cells to exhibit a cell surface-bound form of antibody, thereby facilitating specific screening without the need for multi-stage resistance culture condition screening.

Detailed Description

The following is a specific embodiment, by way of example only, to facilitate a better understanding of the invention.

The vector modification, the establishment of antibody display cell strains and the screening process of antibody expression cells:

1. the PLVX-Puro plasmid is transformed into a PLVX-Puro-TET ON vector, a TET operator sequence is inserted between the cloning sites XhoI and EcoRI of the PLVX-Puro plasmid, and the TET operator sequence is specifically as follows:

ctcgagtccctatcagtgatagagatctccctatcagtgatagagatcgtcgacgagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccggactctagcgaattc are provided. The correct sequence was verified by sequencing.

2. A cell surface antibody-expressing (cell surface protein A/G) plasmid was constructed. The cell surface antibody display sequence was inserted between the cloning sites EcoRI and BamHI of the PLVX-Puro-TETON plasmid as follows:

gaattcatgctgagtcttctgctccttctcctgggactaggctctgtgttcagtgctgtcatctctaacaaagatcaacaaagcgccttctatgaaatcttgaacatgcctaacttaaacgaagagcaacgcaatggtttcattcaaagtcttaaagacgatccaagccaaagcactaacgttttaggtgaagctaaaaaattaaacgaatctcaagcaccgaaagctgacaacaatttcaacaaagaacaacaaaatgctttctatgaaatcttgaacatgcctaacttgaacgaagaacaacgcaatggtttcatccaaagtttaaaagatgacccaagccaaagcgctaaccttttagcagaagctaaaaagctaaatgatgcacaagcaccaaaagctgacaacaaattcaacaaagaacaacaaaatgctttctatgaaattttacatttacctaacttaactgaagaacaacgtaacggcttcatccaaagccttaaagacgatccttcagtgagcaaagaaattttagcagaagctaaaaagctaaacgatgctcaagcaccaaaagaggaagacaacaacaagcctggtaaagaagacactgacacttacaaattaatccttaatggtaaaacattgaaaggcgaaacaactactgaagctgttgatgctgctactgcagaaaaagtcttcaaacaatacgctaacgacaacggtgttgacggtgaatggacttacgacgatgcgactaagacctttacagttactgaaaaaccagaagtgatcgatgcgtctgaattaacaccagccgtgacaacttacaaacttgttattaatggtaaaacattgaaaggcgaaacaactactgaagctgttgatgctgctactgcagaaaaagtcttcaaacaatacgctaacgacaacggtgttgacggtgaatggacttacgacgatgcgactaagacctttacagttactgaaaaaccagaagtgatcgatgcgtctgaattaacaccagccgtgacaacttacaaacttgttattaatggtaaaacattgaaaggcgaaacaactactaaagcagtagacgcagaaactgcagaaaaagccttcaaacaatacgctaacgacaacggtgttgatggtgtttggacttatgatgatgcgactaagacctttacggtaactgaaatggttacagaggttcctggtgatgcaccaactgaaccagaaaaaccagaagcaagtatccctcttgtttcagtgattgggttccgaatcctcctcctgaaagtggccgggtttaatctgctcatgacgctgcggctgtggtccagctgaggatcc are provided. The correct sequence was verified by sequencing.

3. A recombinant virus suspension was prepared. The constructed plasmid and packaging plasmid (psPAX2, pMD2.G) were co-transfected into HEK293T cells, and a lentiviral suspension was prepared after 48 hours. And infecting HEK293T cells by using virus suspension, adding tetracycline or doxycycline into culture solution, and identifying the expression of the corresponding fragment of protein A/G by Western blot and immunofluorescence. The recombinant lentivirus suspension is prepared, and stored for later use after titer determination. The suspension can be used for specific screening by using specific antigens after infecting antibody expression cells or establishing a tumor cell strain (such as myeloma cells) with stable and regulated expression for screening fusion cell antibodies.

4. Antibody expression cell screening:

1) establishment of myeloma cell line stably expressing cell surface protein A/G: and infecting myeloma cells with the virus particles for storage and preparing a myeloma cell line stably expressing protein A/G by utilizing puromycin resistance screening.

2) Fusion of a myeloma cell line expressing protein A/G with an antibody-expressing cell: fusing and culturing spleen B cells of mice immunized by a protein A/G-expressed myeloma cell line and a specific antigen (such as human insulin recombinant protein) for 12 hours, removing a culture solution, washing twice by PBS (phosphate buffer solution), adding cells containing tetracycline or doxycycline to culture for 4-8 hours, and collecting the cells in a 15ml centrifuge tube.

3) Binding of antigen magnetic beads to antibody-expressing cells: adding the magnetic beads crosslinked with the antigen (such as recombinant insulin protein) into the centrifugal tube collected with the cells in the step 2), gently shaking for half an hour, and washing the cells which are not combined with the magnetic beads under the condition of a magnetic field.

4) Cells were eluted with antigen and cultured either mixed or monoclonally: culturing the collected cells in a culture solution without tetracycline and doxycycline, and carrying out polyclonal antibody detection and monoclonal optimization cell strain screening.

5) Final identification and preservation of the cell lines was performed.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

Claims (10)

1. A method for cell surface display-based rapid screening of antibody-expressing cells, comprising the steps of: constructing a plasmid or viral expression system which expresses a protein comprising a signal peptide, an IgG binding domain and a C-terminal transmembrane domain structure after transfection or infection of a cell; the antibody binds to the protein and is displayed on the cell surface.

2. The method of claim 1, further comprising: antibody-expressing cells were screened.

3. The method of claim 2, wherein the expression system is a pLVX-Puro-TET ON vector.

4. The method of claim 3, wherein the pLVX-Puro-TET ON vector is obtained by inserting a TET operon sequence between XhoI and EcoRI sites of a PLVX-Puro vector.

5. The method of claim 1 or 4, wherein the antibody is a monoclonal antibody.

6. The method of claim 1 or 4, wherein the antibody is a polyclonal antibody.

7. Method according to claim 1, characterized in that it comprises the following steps:

1) constructing a viral expression system carrying a cDNA sequence encoding a protein A/G comprising a signal peptide, an IgG binding domain and a C-terminal transmembrane domain;

2) preparing recombinant virus suspension, and collecting recombinant virus particles;

3) antibody-expressing cells were screened.

8. The method of claim 7, wherein 3) the antibody-expressing cells are screened, comprising the steps of:

(1) establishment of myeloma cell line stably expressing cell surface protein A/G: infecting the recombinant virus particles with myeloma cells, and screening by utilizing puromycin resistance to obtain a myeloma cell strain stably expressing protein A/G;

(2) fusion of a myeloma cell line expressing protein A/G with an antibody-expressing cell: fusing a myeloma cell line expressed by protein A/G with mouse spleen B cells immunized by a specific antigen and culturing for 12 hours, removing a culture solution, washing twice by PBS, adding cells containing tetracycline or doxycycline to culture for 4-8 hours, and collecting the cells in a centrifuge tube;

(3) binding of antigen magnetic beads to antibody-expressing cells: adding the magnetic beads crosslinked with the antigens into the centrifugal tube collected with the cells in the step (2), shaking gently for half an hour, and washing out the cells not combined with the magnetic beads under the condition of a magnetic field;

(4) cells were eluted with antigen and cultured either mixed or monoclonally: culturing the collected cells in a culture solution without tetracycline and doxycycline, and then carrying out polyclonal antibody detection and screening of monoclonal optimized cell strains;

(5) cell lines were identified and stored.

9. The method of claim 7, wherein the cDNA sequence is provided with an expression switch.

10. The method of claim 9, wherein the switch is a tetracycline control switch.

Images