CN107058235B - A B cell screening method and its application in the preparation of monoclonal antibodies - Google Patents

Abstract

The present application relates to a B cell screening method and its application in the preparation of monoclonal antibodies. The B cell screening method includes the following steps: S11, adding a secreted and expressed signal peptide sequence to the N-terminus of the Protein A protein gene, and adding a transmembrane protein gene sequence to the C-terminus to obtain a fusion exogenous gene; S12, adding the described The B cells that have been immunized by the fusion exogenous gene transfection are used as the cells to be screened; S13. Add a fluorescently labeled antigen to the cells to be screened, and use a flow cytometer to sort and collect the cells with fluorescence, and get a positive result B cells. The invention collects antibody molecules on the cell surface, uses the fast and precise sorting function of the flow cytometer to screen the fused cells in advance, greatly improves the success rate and accuracy of the traditional method, and also solves the problem of monoclonal antibody cells in the later stage. strain detection problems.

Description

A B cell screening method and its application in the preparation of monoclonal antibodies

technical field

The invention belongs to the field of cell biology, and in particular relates to a B cell screening method and its application in the preparation of monoclonal antibodies.

Background technique

Monoclonal antibodies are highly uniform antibodies that are produced by a single B cell clone and are only directed against a specific epitope. They are usually prepared by hybridoma technology. Hybridoma antibody technology is based on cell fusion technology. Sensitized B cells with the ability to secrete specific antibodies and myeloma cells with immortality are fused to form B cell hybridomas. Using a single hybridoma cell with this characteristic to cultivate a cell population, a specific antibody against an epitope, that is, a monoclonal antibody, can be prepared. The preparation of hybridoma cells is a commonly used technical means in the field of biology. The detection and identification of fused cell lines in conventional methods is time-consuming and labor-intensive, and the success rate is not high.

SUMMARY OF THE INVENTION

The technical problem to be solved by the present invention is that the detection of the fusion cell line in the preparation process of the hybridoma cell is time-consuming and labor-intensive, and the success rate is not high.

In order to solve the above-mentioned technical problems, the technical solution of the present invention is to provide a B cell screening method, comprising the following steps:

S11. Add a secreted and expressed signal peptide sequence to the N-terminus of the Protein A protein gene, and add a transmembrane protein gene sequence to the C-terminus to obtain a fusion foreign gene;

S12, transfecting the fusion foreign gene into B cells that have been immunized, as cells to be screened;

S13 , adding a fluorescently labeled antigen to the cells to be screened, and using a flow cytometer to sort and collect the fluorescent cells to obtain positive B cells.

In the B cell screening method provided by the present invention, in the step S11, upstream primers and downstream primers are designed, the signal peptide sequence for secretion and expression is added to the N-terminus, and the transmembrane protein gene sequence is added to the C-terminus, and these three The segment sequences are connected, and the DNA of Staphylococcus aureus is used as a template, and the upstream primer and the downstream primer are used for PCR amplification to obtain the fusion foreign gene.

In the B cell screening method provided by the present invention, the upstream primer and downstream primer are designed as follows:

PROTEIN-BAMH I-F:

5'-CCAGGATCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGCGGCCAATGCTGCGCAACACGATGAA-3';

PROTEIN-XHOI-R:

5'-CCGCTCGAGTCAGACACAGAAGAAGATGCCTAGCCCAATGAAAAGCAGGAGGCCGGCGACGCCCCCCAGCACAATCAGGGCGCCCCCCAGCACAATCAG-3'.

In the B cell screening method provided by the present invention, in the step S12, the fusion exogenous gene is connected with a lentiviral vector to obtain a lentiviral expression plasmid, and the immunized B cells are transfected.

In the B cell screening method provided by the present invention, the immunized B cells are co-transfected with the lentiviral expression plasmid and the lentiviral helper plasmid.

In the B cell screening method provided by the present invention, the spleen of the immunized animal is taken, and the isolated spleen cells are the B cells that have been immunized.

In the B cell screening method provided by the present invention, in the step S13, the secreted and expressed Protein A protein is hung on the cell membrane through a transmembrane protein, and the antibody molecules are simultaneously adsorbed by the Protein A protein and then aggregated on the surface of the cell membrane. The antigen is combined with the antibody to form a complex of Protein A protein + target antibody molecule + antigen. This complex is connected to B cells. Since the antigen molecule has a fluorescent signal, the positive B cells are collected by flow cytometry.

The present invention also provides an application of a B cell screening method in the preparation of monoclonal antibodies. The positive B cells screened in the above method are fused with myeloma cells to prepare monoclonal antibodies.

The present invention also provides a method for preparing a monoclonal antibody, comprising the following steps:

S21. Add a secreted and expressed signal peptide sequence to the N-terminus of the Protein A protein gene, and add a transmembrane protein gene sequence to the C-terminus to obtain a fusion foreign gene;

S22, transfecting the fusion foreign gene into B cells that have been immunized, as cells to be screened;

S23, adding a fluorescently labeled antigen to the cells to be screened, and using a flow cytometer to sort and collect the fluorescent cells to obtain positive B cells;

S24. The positive B cells are fused with myeloma cells, and the obtained hybridoma cells are used to prepare monoclonal antibodies.

In the preparation method of the monoclonal antibody provided by the present invention, in the step S24, after the positive B cells are fused with the myeloma cells, a monoclonal cell line is obtained by culturing by a dilution method, and the secreted antibody is obtained.

The implementation of the present invention has the following beneficial effects: the present invention is designed to secrete and express the Protein A protein, and add a transmembrane region protein to the N-terminus of the Protein A protein. Membrane proteins are connected to the cell membrane, and at the same time, the antibody molecules produced by immunization are aggregated on the cell surface, and the antibodies are more easily recognized and detected. At the same time, flow cytometry is a common instrument in cell biology, which can quickly and effectively analyze and sort cells. , using this feature to screen positive cells will greatly improve the experimental efficiency.

Description of drawings

Figure 1 shows the positive B cells screened by flow cytometry in Example 2.

Detailed ways

The content of the present invention will be specifically described below with reference to the embodiments.

The innovation of the present invention is that the antibody molecules are collected on the cell surface, and the fused cells are screened in advance by using the fast and precise sorting function of the flow cytometer, which greatly improves the success rate and accuracy of the traditional method, and also solves the problem of later Problems with the detection of monoclonal antibody cell lines.

In a preferred embodiment of the B cell screening method of the present invention, the following steps are included:

S11. Add a secreted and expressed signal peptide sequence to the N-terminus of the Protein A protein gene, and add a transmembrane protein gene sequence to the C-terminus to obtain a fusion foreign gene;

S12, transfecting the fusion foreign gene into B cells that have been immunized, as cells to be screened;

S13 , adding a fluorescently labeled antigen to the cells to be screened, and using a flow cytometer to sort and collect the fluorescent cells to obtain positive B cells.

Taking advantage of the fact that Protein A protein can bind to antibodies, Protein A protein is expressed on the surface of B cell membrane in the form of transmembrane expression. When the monoclonal antibody molecule is formed, it is secreted from B cells and just intercepted by Protein A protein. The antigen is combined with the antibody molecule to form a protein A protein + target monoclonal antibody molecule + antigen complex, which is connected to B cells. Due to the fluorescent signal of the antigen molecule, it can be analyzed by flow cytometry. Select function, screen in advance, and collect cells with fluorescence to obtain positive B cells. In the B cell screening method of the present invention, the preparation and screening process of the monoclonal antibody is carried out in advance, and the positive cells are directly screened by flow cytometry, and then fused, which simplifies the experimental operation and improves the experimental efficiency.

In another preferred embodiment of the B cell screening method of the present invention, on the basis of the above-mentioned embodiment, in the step S11, the upstream primer and the downstream primer are designed, the signal peptide sequence for secretion and expression is added to the N-terminus, The transmembrane protein gene sequence is added to the C-terminus, the three sequences are connected, and the DNA of Staphylococcus aureus is used as a template, and the upstream primer and the downstream primer are used for PCR amplification to obtain the fusion foreign gene. It should be noted that other methods that can connect these three sequences are completely applicable to the present invention, for example, the fusion exogenous gene is synthesized from the whole gene, so that the N-terminal of the Protein A protein gene is added with the signal peptide sequence for secretion and expression, Add the transmembrane protein gene sequence at the C-terminus. Preferably, the upstream primer and downstream primer are designed as follows:

PROTEIN-BAMH I-F:

5'-CCAGGATCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGCGGCCAATGCTGCGCAACACGATGAA-3';

PROTEIN-XHOI-R:

5'-CCGCTCGAGTCAGACACAGAAGAAGATGCCTAGCCCAATGAAAAGCAGGAGGCCGGCGACGCCCCCCAGCACAATCAGGGCGCCCCCCAGCACAATCAG-3'.

In another preferred embodiment of the B cell screening method of the present invention, on the basis of the above-mentioned embodiment, in step S12, the fusion foreign gene is connected with a lentiviral vector to obtain a lentiviral expression plasmid, which is then transformed into a lentiviral expression plasmid. immunized B cells. Preferably, the immunized B cells are co-transfected with the lentiviral expression plasmid and the lentiviral helper plasmid. The B cells that have been immunized are directly isolated from animal tissues, such as taking the spleen of the immunized animal, and the isolated spleen cells; of course, B cells isolated from other lymphoid tissues are also fully applicable to the present invention, for example, from the digestive tract mucosa. B cells isolated from the underlying lymph nodes.

The present invention also provides an application of the above-mentioned B cell screening method in the preparation of monoclonal antibodies, and the positive B cells screened in the above-mentioned method are fused with myeloma cells to prepare monoclonal antibodies. The specific application process is a preparation method of a monoclonal antibody, comprising the following steps:

S21. Add a secreted and expressed signal peptide sequence to the N-terminus of the Protein A protein gene, and add a transmembrane protein gene sequence to the C-terminus to obtain a fusion foreign gene;

S22, transfecting the fusion foreign gene into B cells that have been immunized, as cells to be screened;

S23, adding a fluorescently labeled antigen to the cells to be screened, and using a flow cytometer to sort and collect the fluorescent cells to obtain positive B cells;

S24. The positive B cells are fused with myeloma cells, and the obtained hybridoma cells are used to prepare monoclonal antibodies.

Preferably, after the positive B cells are fused with myeloma cells, a monoclonal cell line is obtained by culturing by a dilution method, and the secreted antibody is obtained.

Example 1

1. Design primers to amplify the Protein A gene sequence. Both ends of the primers contain a secretion signal peptide and a transmembrane protein DNA fragment, and an enzyme cleavage site is introduced at the same time. The primers are designed as follows:

PROTEIN-BAMH I-F:

5'-CCAGGATCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGCGGCCAATGCTGCGCAACACGATGAA-3';

PROTEIN-XHOI-R:

5'-CCGCTCGAGTCAGACACAGAAGAAGATGCCTAGCCCAATGAAAAGCAGGAGGCCGGCGACGCCCCCCAGCACAATCAGGGCGCCCCCCAGCACAATCAG-3'.

The BamH I restriction site was introduced into the upstream primer, and the Xho I was introduced into the downstream, and the Protein A gene was amplified directly with Staphylococcus aureus as a template.

2. Construction of lentiviral expression plasmid

It was constructed with pLVX-puro lentivirus system, and pLVX-puro and ProteinA were digested with BamH I and Xho I at the same time to construct pLVX-puro-Protein A lentivirus expression plasmid,

3. Preparation of Protein A lentiviral solution

The pLVX-puro-Protein A plasmid and the packaging plasmids pSPAX2 and pCMV-VSV-G were transfected into 293T cells together. After 24 hours, the supernatant was collected, which was the Protein A lentivirus solution.

Example 2

Taking the preparation of human glycoprotein Tamm-Horsfall (THP) monoclonal antibody as an example to illustrate the preparation method of the complete monoclonal antibody of the present invention.

1. Synthetic amino acid sequence

According to the THP protein sequence found in the (NCBI) database, after protein analysis, two protein sequences with strong THP antigenicity were selected to synthesize polypeptides. ), prepared in PBS to 2μg/μl for storage, another group of synthetic polypeptide C-terminal conjugated fluorescent label FITC (labeled as THP-FITC), prepared in PBS to 2μg/μl for storage in the dark, the polypeptide THP will be used as an immunogen Directly immunized mice produced antibodies, and the polypeptide THP-FITC was used as a marker for immunofluorescence detection.

The immunization of mice

The conventional immunization method of BALB/c mice was used. The first immunization used complete adjuvant emulsified polypeptide. Each mouse was immunized with 50 micrograms of polypeptide. A total of three mice were immunized. In the third injection, incomplete adjuvant was used to emulsify the polypeptide. The immunization interval for each injection was two weeks. After each injection, blood was collected by tail docking method for antibody detection.

3. Preparation of mouse splenocytes

The immunized mice were taken, and the blood was collected by enucleating the eyeballs. The mice were placed in a 4°C refrigerator overnight, and the second serum was used as an antibody positive control. At the same time, the mice were killed by cervical dislocation. Soak in 75% alcohol for 5 minutes for disinfection, cut the abdomen on the ultra-clean table, take out the spleen and place it in 1460 medium containing serum, peel off the surrounding connective tissue, and inject the medium into the spleen with a sterile syringe, The spleen was inflated, the spleen cells were placed on a 400-mesh sieve, the spleen was squeezed with the inner core of a syringe, and the spleen cells were filtered through the sieve before use.

4. Protein A lentiviral solution infects cells

Add Protein A lentiviral solution to the prepared mouse splenocytes to infect the cells, continue to culture for 24 hours, remove the medium, and replace with fresh medium.

5. Immunofluorescence reaction of mouse splenocytes

Polypeptide THP-FITC was added to the spleen cells of mice infected with Protein A lentivirus at a ratio of 1:500. At the same time, the spleen cells of non-immune mice were treated with the same treatment as a negative control. The cells were reacted in a carbon dioxide incubator for 2 hours, and the cells were collected. , centrifuged at 1000 r/min for 5 minutes, washed 3 times with PBS, resuspended cells in 1 ml of PBS, and prepared to be screened by flow cytometer.

6. Screening by flow cytometry

The prepared mouse splenocytes were screened by flow cytometer, and positive cells were collected and cultured in 1640 medium. Figure 1 shows the positive cells obtained by screening.

7. Cell fusion

The positive cells were fused with bone marrow hybridoma cells SP2/0, and the monoclonal cell line was obtained by dilution method after 2 weeks.

8. Detection of monoclonal antibody strains

The monoclonal cell line was cultured, and the secreted antibody was detected. The detection result showed the expression of THP monoclonal antibody.

The above embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. Modifications and substitutions made to the methods, steps or conditions of the present invention without departing from the spirit and essence of the present invention all belong to the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

Claims (7)

1. A method for B cell screening, comprising the steps of:

s11, designing an upstream primer and a downstream primer, adding a signal peptide sequence for secretory expression at the N end of a Protein A gene, adding a transmembrane Protein gene sequence at the C end, connecting the three sequences, and performing PCR amplification by using the upstream primer and the downstream primer by using DNA of staphylococcus aureus as a template to obtain a fused exogenous gene;

s12, connecting the fusion foreign gene with a lentiviral vector to obtain a lentiviral expression plasmid, and cotransfecting the B cell which is immunized with the lentiviral expression plasmid and a lentiviral helper plasmid to be used as a cell to be screened;

and S13, adding fluorescence labeled antigen into the cells to be screened, and sorting and collecting the cells with fluorescence by using a flow cytometer to obtain positive B cells.

2. The method for screening B cells according to claim 1, wherein the forward primer and the reverse primer are designed as follows:

PROTEIN-BAMH I-F:

5’-CCAGGATCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGCGGCCAATGCTGCGCAACACGATGAA-3’；

PROTEIN-XHOI-R:

5’-CCGCTCGAGTCAGACACAGAAGAAGATGCCTAGCCCAATGAAAAGCAGGAGGCCGGCGACGCCCCCCAGCACAATCAGGGCGCCCCCCAGCACAATCAG-3’。

3. the method of claim 1, wherein the spleen of the immunized animal is collected and the spleen cells isolated are the immunized B cells.

4. The method for screening B cells according to claim 1, wherein in step S13, the Protein A secreted and expressed is hung on the cell membrane via transmembrane Protein, the antibody molecules are adsorbed by the Protein A and then aggregated on the surface of the cell membrane, the fluorescence-labeled antigen is bound to the antibody to form a complex of Protein A + target antibody molecule + antigen, and this complex is linked to B cells, and positive B cells are collected by flow cytometry because the antigen molecules carry fluorescence signals.

5. Use of a method of screening B cells for the preparation of monoclonal antibodies, wherein positive B cells obtained by screening according to any one of claims 1 to 4 are fused with myeloma cells for the preparation of monoclonal antibodies.

6. A method for preparing a monoclonal antibody, comprising the steps of:

s21, designing an upstream primer and a downstream primer, adding a signal peptide sequence for secretory expression at the N end of a Protein A gene, adding a transmembrane Protein gene sequence at the C end, connecting the three sequences, and performing PCR amplification by using the upstream primer and the downstream primer by using DNA of staphylococcus aureus as a template to obtain a fused exogenous gene;

s22, connecting the fusion foreign gene with a lentiviral vector to obtain a lentiviral expression plasmid, and cotransfecting the B cell which is immunized with the lentiviral expression plasmid and a lentiviral helper plasmid to be used as a cell to be screened;

s23, adding fluorescence labeled antigen into the cells to be screened, and sorting and collecting the cells with fluorescence by using a flow cytometer to obtain positive B cells;

s24, fusing the positive B cells with myeloma cells, and using the obtained hybridoma cells for preparing monoclonal antibodies.

7. The method of producing a monoclonal antibody according to claim 6, wherein in step S24, the positive B cells are fused with myeloma cells, and then cultured by dilution to obtain a monoclonal cell line, and the antibody secreted therefrom is collected.

Images