CN115825415B - Blocker and in vitro immunodiagnostic product and use - Google Patents

Abstract

The application relates to the technical field of immunodiagnosis reagents, in particular to a blocking agent, an immunodiagnosis product and application. The blocking agent of the present application includes at least one of a first antibody, a second antibody, a third antibody, a fourth antibody, a fifth antibody, and a sixth antibody. The antibodies have specific complementarity determining region sequences, can reduce or eliminate the influence of endogenous interfering substances on immunodetection by using a blocking agent, and have low effective concentration and good stability, so that the antibodies have good application prospects in the field of in-vitro immunodiagnosis.

Description

Blocker and in vitro immunodiagnostic product and use

Technical Field

The application belongs to the technical field of immunodiagnosis reagents, and particularly relates to a blocking agent, an immunodiagnosis product and application.

Background

In vitro diagnosis (In Vitro Diagnosis, IVD) refers to the detection of human samples (blood, body fluid, tissue, etc.) outside the human body to obtain clinical diagnostic information and to determine disease or body function. The in vitro diagnosis mode can rapidly and accurately diagnose the disease at early stage and plays an important role in the fields of clinical medical treatment and related medical research. In healthy humans, serum may contain endogenous interfering substances, such as Heterotrophic Antibodies (HA), rheumatoid Factors (RF), etc., which can bind directly to the detection antibodies during the immunological detection, thus causing false positive or false negative results during diagnosis, especially immunological detection based on the double antibody sandwich method, and are susceptible to endogenous interfering substances in serum.

The blocking agent is a reagent capable of eliminating the interference of the immunodetection, and can reduce and eliminate the influence of endogenous interference substances on the immunodetection, thereby guaranteeing the sensitivity and accuracy of the immunodetection result. The blocking agent can be used in double antibody sandwich method and competition inhibition method, such as multiple platforms for immune turbidimetry, chemiluminescence, colloidal gold chromatography, fluorescence chromatography, etc.

For example, the heterotrophic antibody blocking agent may bind to the heterotrophic antibodies in the serum or plasma sample, thereby blocking interference of the detection results by the heterotrophic antibodies. Normal animal serum or normal animal immunoglobulin G (IgG) is typically used as a blocking agent, and by high concentration addition, the heterotrophic antibodies preferentially bind to such blocking agents and not to the detection or capture antibodies, thereby reducing interference. The blocker effect depends on its affinity for the heterotrophic antibody. Conventional animal serum or animal immunoglobulin G blockers are often used in concentrations up to several milligrams per milliliter (mg/mL) for detection, and the use of the blockers is relatively costly and therefore the cost of detection is relatively high.

Rheumatoid Factors (RF) are a class of autoantibodies in humans that react with the Fc-segment epitope of self IgG, wherein part of them recognizes the common epitope of human and animal IgG, thus causing cross-reactions, and in a double antibody sandwich method, bind directly to the capture antibody and the enzyme-labeled secondary antibody, interfering with the immune detection, often causing false positive results. Likewise, the interference of the rheumatoid factor on the detection result can be blocked by using the rheumatoid factor blocking agent.

At present, commercial immune blocking agents aiming at the amphotropic antibodies and the rheumatoid factors are high in use concentration, poor in product purity and insufficient in stability, precipitate is easy to generate, reagent performance is influenced, and therefore, the effect of eliminating false positive is poor, and a large improvement space is provided.

Disclosure of Invention

The purpose of the application is to provide a blocking agent, an in-vitro immunodiagnosis product and application, and aims to solve the technical problems of high use concentration and poor blocking effect of the existing blocking agent.

In order to achieve the purposes of the application, the technical scheme adopted by the application is as follows:

in a first aspect, the present application provides a blocking agent comprising at least one of the following antibodies:

a first antibody, wherein the three complementarity determining region sequences of the heavy chain variable region of the first antibody are shown as SEQ ID NO.1-3, and the three complementarity determining region sequences of the light chain variable region of the first antibody are shown as SEQ ID NO. 4-6;

a second antibody, the three complementarity determining region sequences of the heavy chain variable region of the second antibody are shown in SEQ ID NO.7-9, and the three complementarity determining region sequences of the light chain variable region of the second antibody are shown in SEQ ID NO. 10-12;

a third antibody, the three complementarity determining region sequences of the heavy chain variable region of the third antibody are shown in SEQ ID NO.13-15, and the three complementarity determining region sequences of the light chain variable region of the third antibody are shown in SEQ ID NO. 16-18;

A fourth antibody, the three complementarity determining region sequences of the heavy chain variable region of the fourth antibody are shown in SEQ ID NO.19-21, and the three complementarity determining region sequences of the light chain variable region of the fourth antibody are shown in SEQ ID NO. 22-24;

a fifth antibody, the three complementarity determining region sequences of the heavy chain variable region of the fifth antibody are shown in SEQ ID NO.25-27, and the three complementarity determining region sequences of the light chain variable region of the fifth antibody are shown in SEQ ID NO. 28-30;

and the three complementarity determining regions of the heavy chain variable region of the sixth antibody are shown in SEQ ID NO.31-33, and the three complementarity determining regions of the light chain variable region of the sixth antibody are shown in SEQ ID NO. 34-36.

In an embodiment, the blocking agent comprises at least two of a first antibody, a second antibody, a third antibody, a fourth antibody, a fifth antibody, a sixth antibody, preferably comprises the first antibody and the second antibody; or alternatively, the process may be performed,

the blocking agent preferably comprises the first antibody and the fourth antibody; or alternatively, the process may be performed,

the blocking agent preferably comprises said second antibody and said fourth antibody.

In one embodiment, the blocking agent is used at a concentration of 0.1 to 0.4mg/mL, preferably 0.1 to 0.2mg/mL, and more preferably 0.2mg/mL of each antibody.

In one embodiment, the antibody in the blocking agent is a monoclonal antibody or a recombinant antibody.

In a second aspect, the present application provides a monoclonal cell line with a preservation number of CGMCC No.45250, which secretes the first antibody in the blocking agent provided herein.

And another monoclonal cell strain with the preservation number of CGMCC NO.45301, which secretes the fourth antibody in the blocking agent provided by the application.

In a third aspect, the present application provides an in vitro immunodiagnostic product comprising a blocker of the present application.

In one embodiment, the in vitro immunodiagnostic product comprises an in vitro immunodiagnostic kit comprising said blocking agent.

In one embodiment, the in vitro immunodiagnostic product comprises at least one of an N-terminal B-type natriuretic peptide immunodiagnostic product and a cardiac troponin I immunodiagnostic product.

In a fourth aspect, the present application provides the use of a blocking agent in the preparation of an in vitro immunodiagnostic product.

The blocker provided in the first aspect of the application comprises at least one antibody from a first antibody to a sixth antibody, wherein the antibody has a specific complementarity determining region sequence, and the blocker can reduce or eliminate the influence of endogenous interfering substances on immunodetection, has low effective concentration and good stability, and therefore has good application prospect in the field of in-vitro immunodiagnosis.

The second aspect of the present application provides a monoclonal cell line with a preservation number of CGMCC No.45250, or a monoclonal cell line with a preservation number of CGMCC No.45301, which secrete the first antibody and the fourth antibody, respectively, and such antibodies can effectively reduce or eliminate the influence of endogenous interfering substances on immunodetection, so that the monoclonal cell line of the present application can be used for preparing a blocker in the field of external immunodiagnosis.

The in-vitro immunodiagnosis product provided by the third aspect of the application comprises a blocking agent special for the application, and at least one antibody from a first antibody to a sixth antibody is based on the blocking agent, so that the effect of endogenous interference substances on immunodetection is reduced or eliminated, the effective concentration is low, the stability is good, and the in-vitro immunodiagnosis product using the blocking agent can perform in-vitro detection more accurately at low cost.

The application provided in the fourth aspect of the application is based on the characteristics of low effective concentration and good stability of the blocking agent, and can be used for preparing in-vitro immunodiagnosis products.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings that are needed in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present application, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a graph showing the effect of six monoclonal antibodies provided in the examples of the present application on false positive samples;

FIG. 2 is a graph showing the comparison effect of blocking efficiency of a recombinant antibody and a monoclonal antibody on a false positive sample;

FIG. 3 is a graph showing the effect of stability of the recombinant antibody blocking agent provided in the examples of the present application.

Detailed Description

In order to make the technical problems, technical schemes and beneficial effects to be solved by the present application more clear, the present application is further described in detail below with reference to the embodiments. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the present application.

In the present application, "at least one" means one or more, and "a plurality" means two or more. "at least one of" or the like means any combination of these items, including any combination of single item(s) or plural items(s).

It should be understood that, in various embodiments of the present application, the sequence number of each process does not mean that the sequence of execution is sequential, and some or all of the steps may be executed in parallel or sequentially, where the execution sequence of each process should be determined by its functions and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

The terminology used in the embodiments of the application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. As used in this application and the appended claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

The terms "first," "second," and the like are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or an implicit indication of the number of technical features indicated. For example, a first XX may also be referred to as a second XX, and similarly, a second XX may also be referred to as a first XX, without departing from the scope of embodiments of the present application. Thus, a feature defining "a first" or "a second" may explicitly or implicitly include one or more such feature.

Where a range of values is provided, such as a range of concentrations, a range of percentages, or a range of ratios, it is to be understood that each intervening value, to the tenth of the unit of the lower limit, between the upper and lower limit of the range, and any other stated or intervening value in that stated range, is encompassed within the subject matter unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and such embodiments are also included in the subject matter, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the subject matter.

In the context of the present invention, many embodiments use the expression "comprising", "including" or "consisting essentially/mainly of … …". The expression "comprising," "including," or "consisting essentially of … …" is generally understood to mean an open-ended expression that includes not only the individual elements, components, assemblies, method steps, etc., specifically listed thereafter, but also other elements, components, assemblies, method steps. In addition, the expression "comprising," "including," or "consisting essentially of … …" is also to be understood in some instances as a closed-form expression, meaning that only the elements, components, assemblies, and method steps specifically listed thereafter are included, and no other elements, components, assemblies, and method steps are included. At this time, the expression is equivalent to the expression "consisting of … …".

For a better understanding of the present teachings and without limiting the scope of the present teachings, all numbers expressing quantities, percentages or proportions used in the specification and claims, and other numerical values, are to be understood as being modified in all instances by the term "about" unless otherwise indicated. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

As used herein, the term "antibody" refers to an immunoglobulin molecule that is typically composed of two pairs of polypeptide chains, each pair having one "light" (L) chain and one "heavy" (H) chain. Antibody light chains can be classified as kappa and lambda light chains. Heavy chains can be classified as μ, δ, γ, α or ε, and the isotypes of antibodies can be defined accordingly as IgM, igD, igG, igA and IgE, respectively. Within the light and heavy chains, the variable and constant regions are linked by a "J" region (hinge region) of about 12 or more amino acids, and the heavy chain also comprises a "D" region of about 3 or more amino acids. Each heavy chain consists of a heavy chain variable region (VH) and a heavy chain constant region (CH). The heavy chain constant region consists of 3 domains (CH 1, CH2 and CH 3). Each light chain consists of a light chain variable region (VL) and a light chain constant region (CL). The light chain constant region consists of one domain CL. The constant region of an antibody may mediate the binding of an immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component of the classical complement system (C1 q). VH and VL regions can also be subdivided into regions of high variability, termed Complementarity Determining Regions (CDRs), interspersed with regions that are more conserved, termed Framework Regions (FR). For each heavy or light chain, its variable region comprises three CDRs, CDR1, CDR2 and CDR3, respectively. Thus, each VH and VL is formed from the following sequence: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 consist of 3 CDRs and 4 FRs arranged from amino-terminus to carboxy-terminus. The variable regions (VH and VL) of each heavy/light chain pair form antigen binding sites, respectively.

The rules of allocation of amino acids to regions or domains give the relevant definitions in several documents: kabat Sequences of Proteins of Immunological Interest (National Institutes of Health, bethesda m.d. (1987 and 1991)); chothia & Lesk j.mol.biol.1987;196:901-917; chothia et al, nature 1989;342:878-883; ehrenmann, francois, quentin Kaas, and Marie-Paule Lefranc. "IMGT/3Dstructure-DB and IMGT/DomainGapAlign: a database and a tool for immunoglobulins or antibodies, T cell acceptors, MHC, igSF and MhcSF." Nucleic acids research 2009;38 (suppl_1): D301-D307.

The exact boundaries of CDRs have been defined differently from system to system, and the Kabat system provides not only a clear residue numbering system applicable to any variable region of an antibody, but also precise residue boundaries defining 3 CDRs, referred to as Kabat CDRs; chothia found that some subfractions within the CDRs of the Kabat system, which are termed Chothia CDRs with boundaries overlapping the Kabat CDRs, have almost identical peptide backbone conformations, despite great diversity at the amino acid sequence level. The overlapping boundaries, in turn, are described by Padlan and MacCallum, and CDR boundary definitions may not strictly adhere to the above system, such as the AbM definition. In this context, the CDRs may be defined according to any of these systems, although the preferred embodiment uses the antibody numbering system of Chothia et al. According to the Chothia numbering system, the VH CDR1, VH CDR2, VH CDR3, and VL CDR1 are located at positions 26 to 32, 52 to 57, 99 to 108, 24 to 39, 55 to 61, 94 to 102, respectively, of the antibody.

As used herein, the term "mab" or "monoclonal antibody" refers to an antibody or a fragment of an antibody from a population of highly homologous antibody molecules, i.e., a population of identical antibody molecules except for natural mutations that may occur spontaneously. The antibody molecule is an immunoglobulin, whether it be a natural immunoglobulin or an immunoglobulin obtained partially or wholly by synthetic means. The antibody molecules also include all polypeptides or proteins having antibody domains, antibody fragments having antibody domains are molecules such as Fab, scFv, fv, dAb, fd, and bifunctional antibodies. Monoclonal antibodies have a high specificity for a single epitope on an antigen. Polyclonal antibodies are relative to monoclonal antibodies, which typically comprise at least 2 or more different antibodies, which typically recognize different epitopes on an antigen. Monoclonal antibodies are generally obtainable by the hybridoma technique first reported by Kohler et al

G,Milstein C.Continuous cultures of fused cells secreting antibody of predefined specificity[J]Natural, 1975;256 495) but may also be obtained using recombinant DNA techniques (see, e.g., U.S. patent 4,816,567). As used herein, the terms "monoclonal antibody" and "mab" have the same meaning and are used interchangeably; the terms "polyclonal antibody" and "polyclonal antibody" have the same meaning and are used interchangeably; the terms "polypeptide" and "protein" have the same meaning and are used interchangeably. And in the present invention, amino acids are generally indicated by single-letter and three-letter abbreviations well known in the art. For example, alanine can be represented by A or Ala.

In a first aspect, embodiments of the present application provide a blocking agent comprising at least one of the following antibodies: in particular, the method comprises the steps of,

the sequences of three complementarity determining regions of the heavy chain variable region and the light chain variable region of the first antibody are respectively:

VH CDR1：SEQ ID NO.1，VH CDR2：SEQ ID NO.2，VH CDR3：SEQ ID NO.3；VL CDR1：SEQ ID NO.4，VL CDR2：SEQ ID NO.5，VL CDR1：SEQ ID NO.6；

the sequences of the three complementarity determining regions of the heavy chain variable region and the light chain variable region of the second antibody are respectively:

VH CDR1：SEQ ID NO.7，VH CDR2：SEQ ID NO.8，VH CDR3：SEQ ID NO.9；VL CDR1：SEQ ID NO.10，VL CDR2：SEQ ID NO.11，VL CDR1：SEQ ID NO.12；

the third antibody has three complementarity determining region sequences of heavy chain variable region and light chain variable region:

VH CDR1：SEQ ID NO.13，VH CDR2：SEQ ID NO.14，VH CDR3：SEQ ID NO.15；VL CDR1：SEQ ID NO.16，VL CDR2：SEQ ID NO.17，VL CDR1：SEQ ID NO.18；

a fourth antibody having three complementarity determining region sequences of a heavy chain variable region and a light chain variable region, respectively:

VH CDR1：SEQ ID NO.19，VH CDR2：SEQ ID NO.20，VH CDR3：SEQ ID NO.21；VL CDR1：SEQ ID NO.22，VL CDR2：SEQ ID NO.23，VL CDR1：SEQ ID NO.24；

a fifth antibody having three complementarity determining region sequences of a heavy chain variable region and a light chain variable region, respectively:

VH CDR1：SEQ ID NO.25，VH CDR2：SEQ ID NO.26，VH CDR3：SEQ ID NO.27；VL CDR1：SEQ ID NO.28，VL CDR2：SEQ ID NO.29，VL CDR1：SEQ ID NO.30；

a sixth antibody having three complementarity determining region sequences of the heavy chain variable region and the light chain variable region:

VH CDR1：SEQ ID NO.31，VH CDR2：SEQ ID NO.32，VH CDR3：SEQ ID NO.33；VL CDR1：SEQ ID NO.34，VL CDR2：SEQ ID NO.35，VL CDR1：SEQ ID NO.36。

the blocking agent of the present application includes at least one of the first to sixth antibodies. Specifically, 1) the blocking agent comprises one of the first to sixth antibodies, such as the blocking agent comprises the first antibody, or the blocking agent comprises the second antibody, or the blocking agent comprises the third antibody, or the blocking agent comprises the fourth antibody, or the blocking agent comprises the fifth antibody, or the blocking agent comprises the sixth antibody. 2) The blocking agent includes two or more (e.g., three, four, etc.) of the first antibody to the sixth antibody, and may be specifically combined according to the actual detection needs. For example, the blocking agent includes a first antibody and a second antibody, or the blocking agent includes a first antibody and a fourth antibody, or the blocking agent includes a second antibody and a fourth antibody, or the like. Wherein, the first antibody and the fourth antibody have better blocking effect. Preferably, the blocking agent comprises a first antibody and a fourth antibody, and other antibodies can be further added or not added according to actual needs.

Further, the application also provides a method for producing the monoclonal antibody blocking agent. In one embodiment, the present application coats nitrocellulose membrane (NC membrane) and labeled fluorescent microspheres with murine IgG antibodies, respectively, and prepares a fluorescent immunochromatographic product to screen clinical random samples, and selects clinical samples (false positive samples) containing components capable of binding to murine IgG antibodies. And separating the interference component existing in the false positive sample, and immunizing a mouse by taking the purified interference component as an immunogen to prepare a hybridoma cell strain. In particular, the present application comprises hybridoma cell lines, specifically comprising: the monoclonal cell strain with the preservation number of CGMCC No.45250 is preserved in the China general microbiological culture Collection center (GDMCC) of China general microbiological culture Collection center (CGMCC) at the date of 22, 08 of 2022, and the preservation address is: no. 1 and No. 3 of the north cinquefoil of the morning sun area of beijing city. Or the monoclonal cell strain with the preservation number of CGMCC No.45301 is also preserved in China general microbiological culture Collection center (GDMCC) in the year 08 and 22 of 2022. The two hybridoma cell strains secrete the first antibody and the fourth antibody respectively, and the antibodies can effectively reduce or eliminate the influence of endogenous interfering substances on immunodetection, so that the monoclonal cell strain can be used for preparing a blocker in the field of external immunodiagnosis. Monoclonal cell lines secreting other antibodies can be screened in the same manner.

The clinical random sample adopted in the production method of the monoclonal antibody blocking agent is a clinical random healthy human serum sample collected from a hospital. Some antibodies against unknown antigens are present in human peripheral blood, typically multispecific, weaker-affinity antibodies, some are present in peripheral blood, for example in humans with a long-term history of exposure to animals, and these antibodies can bind to animal antibodies used in immunoassays where false positive results are likely to occur, and such serum samples are referred to herein as false positive samples. In the clinical random healthy human serum sample, an unknown false positive sample exists, and the method adopts a fluorescence immunization method to screen the clinical random healthy human serum sample and select the false positive sample, so that the monoclonal antibody blocking agent can be obtained.

In immunoassays, murine monoclonal antibodies are most commonly used, and thus in one embodiment, the screening of false positive samples is performed with murine IgG antibodies, it being understood that in some other embodiments, the screening of false positive samples may be performed with rabbit IgG or other animal IgG antibodies in accordance with the methods of this embodiment.

In one embodiment, the test line (T line) in the assembled fluorescent immunochromatographic rapid test card is a murine IgG antibody, the control line (C line) is a goat anti-murine IgG, the fluorometer measures that the T line reading (T value) is low when no false positive component is contained in the sample, as a background value, most of the murine IgG antibody labeled with fluorescent microspheres is bound to the C line, and the ratio T/C of the T line reading (T value) to the C line reading (C value) is approximately equal to 0. If the sample contains false positive components, the labeled fluorescent microsphere murine IgG-false positive components bind to the T line and the remaining labeled fluorescent microsphere murine IgG binds to the C line, the T/C value is proportional to the concentration of the murine IgG antibody binding components in the clinically randomized sample. In most clinical random samples, the components capable of being combined with the mouse IgG antibody are very low, and through a large number of clinical sample tests, the embodiment artificially sets the T/C value of 0.1 as a critical value, and takes the samples with the T/C value of more than 0.1 as false positive samples.

In one embodiment, 319 clinical random samples are screened, and 12 samples with T/C values greater than 0.1 are selected as false positive samples, with Sample numbers being identified as samples (samples) 1-12.

In one embodiment, three false positive serum samples with the maximum T/C value in the samples are selected, interference components in the samples are separated, and the samples are used as immunogens to immunize mice to prepare monoclonal cell strains.

In one example, the blocking efficiency of the monoclonal antibodies prepared was tested using false positive sample 1 and test samples, including 4 RF samples (RF greater than 300 IU/ml) and 5 HAMA (Human anti mouse antibodies) samples (HAMA greater than 300 ng/ml), numbered samples 13-21.

Other antibodies or chimeric molecules may be produced that retain the specificity of the original antibody using monoclonal and other antibody and recombinant DNA techniques, which may include introducing DNA encoding the immunoglobulin variable or Complementarity Determining Regions (CDRs) of the antibody into the constant regions or constant region plus framework regions of different immunoglobulins. On the basis, the inventor further constructs a recombinant antibody eukaryotic expression vector, introduces the vector into CHO host cells, and screens out a recombinant antibody cell strain with stable expression. Thus, the first to sixth antibodies in the blocking agent of the present application may be monoclonal antibodies or recombinant antibodies.

Specifically, the six monoclonal antibodies were respectively: D1F3, F6C4, a503, a504, a505, a506, corresponding hybridoma cell line numbers are: d1f3, F6C4, a503, a504, a505, a506; antibody information was as follows:

antibody 1 (corresponding to hybridoma cell strain number D1F3, preservation number is CGMCC NO. 45250)

VH CDR1：GFTFSSF；CDR2：SSGSSI；CDR3：WDGNSFAY

VL CDR1：SASQGISNFLN；CDR2：YTSSLHS；CDR3：QQYSKLPYT。

Antibody 2 (corresponding hybridoma cell line number A504)

VH CDR1：GFTFSNY；CDR2：TSGGLY；CDR3：HYTTATFDF

VL CDR1：RTSQDISNFLN；CDR2：YTSRLHS；CDR3：QQGNALPPT。

Antibody 3 (corresponding hybridoma cell line number A503)

VH CDR1：GFIFSDY；CDR2：SNGGGN；CDR3：LYYDDDEKRAVYWYFDV

VL CDR1：KASQDINKYLA；CDR2：YTSTLQP；CDR3：LQYDRVTWT。

Fourth antibody (corresponding hybridoma cell strain number F6C4, preservation number is CGMCC NO. 45301)

VH CDR1：GYTFTNY；CDR2：NTYSGE；CDR3：EGNFDY

VL CDR1：KASQDVSTAVA；CDR2：SASYRFS；CDR3：QQHYTTPFT。

Antibody 5 (corresponding hybridoma cell line number A505)

VH CDR1：GYTFTGS；CDR2：NPGSDY；CDR3：ERGLPNYYGMDS

VL CDR1：KASQNVGTYVA；CDR2：SASYRHS；CDR3：QQYDSYPYT。

Antibody 6 (corresponding hybridoma cell line number A506)

VH CDR1：GFIFSDY；CDR2：SNGGGN；CDR3：LYYDDDEKRAVYWYFDY

VL CDR1：KASQDINNYIA；CDR2：YTSTLQP；CDR3：LQYDSVTWT。

In one embodiment, the antibodies in the blocking agents provided herein can be recombinant antibodies, and methods of producing recombinant antibodies are provided that include culturing chinese hamster ovary cell lines that secrete the antibodies of the present invention. Expression using host cells is a preferred method of producing antibodies of the invention by transfecting host cells with eukaryotic expression vectors encoding one or more of the heavy and light chains by standard techniques. Such transfection includes a wide variety of techniques for introducing exogenous DNA into eukaryotic host cells, e.g., electroporation, calcium phosphate precipitation, DEAE dextran transfection, and the like.

Vectors carrying antibody genes can be transiently transfected, such as 293 cells, or stably transfected into host cells to produce antibodies. The host cells are preferably mammalian host cell lines, and preferred mammalian host cell lines for expressing the recombinant antibodies of the invention include Chinese Hamster Ovary (CHO) cells, NSO myeloma cells, COS cells, and SP2 cells. After the recombinant expression vector encoding the antibody gene is introduced into a mammalian host cell, the host cell needs to be cultured for a sufficient period of time to produce the antibody, or more preferably, the antibody is secreted into the medium in which the host cell is grown, so that the antibody can be recovered from the medium using standard protein purification methods.

Host cells may also be used to produce functional antibody fragments, such as Fab fragments or scFv molecules. Such variations are also included within the scope of the present invention. Recombinant antibodies can be constructed using part or all of the DNA encoding either or both of the light and/or heavy chains of the antibodies of the invention, or using CDRs and universal Framework Regions (FRs) and/or more stable light and/or heavy chain constant regions of the invention.

In certain embodiments, the antibody comprises a heavy chain constant region, such as an IgG1, igG2, igG3, igG4, igA, igE, igM, or IgD constant region, preferably the heavy chain constant region is an IgG1 heavy chain constant region. Further, an antibody may include a light chain constant region, a kappa light chain constant region, or a lambda light chain constant region. Alternatively, the antibody moiety may be, for example, a Fab fragment or a single chain Fv fragment.

In a preferred embodiment, construction of the recombinant antibody is performed using the pcdna3.1 vector, the antibody light chain variable region and heavy chain variable region are introduced into the vector through a polyclonal site, expressed under the control of the CMV promoter, and in a preferred embodiment, the host cell is a CHO cell, preferably by electroporation.

The light chain variable region and the heavy chain variable region are formed by the CDR and FR in the manner of 'FR 1-CDR1-FR2-CDR2-FR3-CDR3-FR 4', the FR region is a non-CDR part in the variable region, the amino acid composition and arrangement change are relatively less, the sequences of the FR regions of the 6 antibodies of the invention are consistent, and the light chain and heavy chain FR1-FR4 are consistent with the framework regions of the monoclonal antibody secreted by the deposited strain D1F3, namely the light chain and heavy chain FR1-FR 4.

In a preferred embodiment, the recombinant antibody has CDR sequences that are fully identical to the corresponding monoclonal antibody.

In a preferred embodiment, recombinant antibody 1 has CDR sequences identical to those of monoclonal antibody D1F 3; in a preferred embodiment, the recombinant antibody 1 further has a heavy chain variable region sequence and a light chain variable region sequence identical to those of the monoclonal antibody D1F3, and in a preferred embodiment, the recombinant antibody 1 further has a heavy chain constant region sequence and a light chain constant region sequence identical to those of the monoclonal antibody D1F 3.

In a preferred embodiment, recombinant antibody 2 has the same CDR sequences as monoclonal antibody a 504; in a preferred embodiment, recombinant antibody 2 may have, in addition to the CDR sequences, FR sequences that are identical to those of the heavy and light chain variable region sequences of monoclonal antibody D1F3, and in a preferred embodiment, recombinant antibody 2 also has heavy and light chain constant region sequences that are identical to monoclonal antibody D1F 3.

In a preferred embodiment, recombinant antibody 3 has the same CDR sequences as monoclonal antibody a 503; in a preferred embodiment, recombinant antibody 3 may have, in addition to the CDR sequences, FR sequences that are identical to those of the heavy and light chain variable region sequences of monoclonal antibody D1F3, and in a preferred embodiment, recombinant antibody 3 also has heavy and light chain constant region sequences that are identical to monoclonal antibody D1F 3.

In a preferred embodiment, recombinant antibody 4 has the same CDR sequences as monoclonal antibody F6C 4; in a preferred embodiment, recombinant antibody 4 may have, in addition to the CDR sequences, FR sequences that are identical to those of the heavy and light chain variable region sequences of monoclonal antibody D1F3, and in a preferred embodiment, recombinant antibody 4 also has heavy and light chain constant region sequences that are identical to monoclonal antibody D1F 3.

In a preferred embodiment, recombinant antibody 5 has the same CDR sequences as monoclonal antibody a 505; in a preferred embodiment, recombinant antibody 5 may have, in addition to the CDR sequences, FR sequences that are identical to those of the heavy and light chain variable region sequences of monoclonal antibody D1F3, and in a preferred embodiment, recombinant antibody 5 also has heavy and light chain constant region sequences that are identical to monoclonal antibody D1F 3.

In a preferred embodiment, recombinant antibody 6 has the same CDR sequences as monoclonal antibody a 506; in a preferred embodiment, recombinant antibody 6 may have an FR sequence that is identical to the heavy and light chain variable region sequences of monoclonal antibody D1F3, in addition to CDR sequences, and in a preferred embodiment, recombinant antibody 6 also has a heavy and light chain constant region sequence that is identical to monoclonal antibody D1F 3.

In a preferred embodiment, the cell supernatant is treated with a protein A affinity chromatography column and purified to obtain recombinant antibodies. The recombinant antibodies have high consistency among batches, are easy to produce and stable, and have better blocking effect and stability compared with monoclonal antibodies. In one embodiment, the blocking efficiency of a recombinant antibody with the same CDR on the same false positive sample is compared to that of a monoclonal antibody at the same use concentration. The blocking efficiency refers to the percentage of decrease in T/C value for the same sample in the test group with the addition of blocking agent compared to the control without blocking agent, calculated as (control T/C value-test group T/C value) ×100%/control T/C value. The monoclonal antibodies are secreted by six hybridoma cell strains D1F3, F6C4, A503, A504, A505 and A506 prepared by the application; the recombinant antibody is a monoclonal antibody which has the same CDR as the monoclonal antibody, is constructed into a CHO host cell in a recombinant mode and is secreted by the CHO cell.

In one embodiment, stability of recombinant antibodies was evaluated. The high temperature and repeated freeze thawing affect the activity of the antibody, and the stability of the antibody activity determines the stability of the immunoassay. The antibody blocking agent is subjected to thermal stability and repeated freeze thawing treatment, and the blocking performance of the antibody blocking agent is verified through experiments, so that the stability of the antibody blocking agent serving as a blocking agent effect is verified, and the performance requirement of the raw material of the detection reagent is met.

In one embodiment, the thermal stability check condition is to test the change in blocking efficiency of the false positive samples after the recombinant antibodies are placed at 37 degrees celsius for 7 days, or 45 degrees celsius for 3 days.

In one embodiment, the repeated freeze-thaw check condition is to test for changes in blocking efficiency of 4 false positive samples after repeated freeze-thawing of the recombinant antibody 5 times, or 10 times.

In some embodiments, the chromatographic test strip sample pad is treated with 0.1mg/mL of recombinant antibody blocking agent and tested for blocking efficiency against false positive samples. In some embodiments, the chromatographic test strip sample pad is treated with 0.2mg/mL of recombinant antibody blocking agent.

In one example, the blocking efficiency of six recombinant antibodies against ten false positive samples was tested. In some samples, the blocking efficiency of a single antibody blocker can reach 94.25%, but in some samples with particularly strong interference, the blocking efficiency is relatively low, even in individual samples, the blocker does not show a blocking effect. The incidence rate of the different interference in the clinical sample is very high, because of the complexity of sample sources, the interference degree of different samples is larger, even if the interference degree of the same patient sample is different along with the sampling time, in order to obtain the blocking agent which can be more universal, in some embodiments, the combination of the blocking agents is optimized, and some blocking agents are selected for combined use, so that the blocking efficiency and universality of the blocking agent are further improved.

In some embodiments, two recombinant antibody blockers are combined and tested for blocking efficiency. In some embodiments, one or both of the recombinant antibodies are used at a concentration of 0.1-0.4mg/mL, in some embodiments, one or both of the recombinant antibodies are used at a concentration of 0.1mg/mL, in some embodiments, one or both of the recombinant antibodies are used at a concentration of 0.2mg/mL, in some embodiments, one or both of the recombinant antibodies are used at a concentration of 0.3mg/mL, in some embodiments, one or both of the recombinant antibodies are used at a concentration of 0.4mg/mL.

In a preferred embodiment, recombinant antibody 1 (corresponding to the first antibody) and recombinant antibody 4 (corresponding to the fourth antibody) are combined, and further, recombinant antibodies 1 and 4 are used at a concentration of 0.1-0.2mg/mL. In a preferred embodiment, the recombinant antibody 1 and the recombinant antibody 4 are used at a concentration of 0.1mg/mL, and in one embodiment, the recombinant antibody 1 and the recombinant antibody 4 are used at a concentration of 0.2mg/mL.

In a preferred embodiment, recombinant antibody 1 (corresponding to the first antibody) and recombinant antibody 2 (corresponding to the second antibody) are combined, and further, recombinant antibodies 1 and 2 are used at a concentration of 0.1-0.2mg/mL. In a preferred embodiment, the recombinant antibody 1 and the recombinant antibody 2 are used at a concentration of 0.1mg/mL, and in one embodiment, the recombinant antibody 1 and the recombinant antibody 2 are used at a concentration of 0.2mg/mL.

In a preferred embodiment, recombinant antibody 2 (corresponding to the second antibody) and recombinant antibody 4 (corresponding to the fourth antibody) are combined, and further, recombinant antibodies 2 and 4 are used at a concentration of 0.1-0.2mg/mL. In a preferred embodiment, the recombinant antibody 2 and the recombinant antibody 4 are used at a concentration of 0.1mg/mL, and in one embodiment, the recombinant antibody 2 and the recombinant antibody 4 are used at a concentration of 0.2mg/mL.

In some embodiments, higher concentrations of recombinant antibody blocking agents are used. It will be appreciated that those embodiments where the blocking efficiency is high and where the concentration is low are preferred, but that increasing the concentration of the particular recombinant antibody blocking agent used in these embodiments also achieves high blocking efficiency.

In a preferred embodiment, recombinant antibody 1 and recombinant antibody 4 are diluted with 10mM, pH 7.4 PBS buffer to a final concentration of 0.2mg/mL each, respectively, and the two recombinant antibody blockers are treated together with the sample pad, i.e., the final treated sample pad has an antibody blocker concentration of 0.4mg/mL. The test strip is assembled by the sample pad, and 21 false positive samples are detected.

In a further preferred embodiment, recombinant antibody 1 and recombinant antibody 2 are diluted with 10mM, pH 7.4 PBS buffer to a final concentration of 0.2mg/mL, respectively, and the two recombinant antibody blockers are treated together on the sample pad, i.e. the final treated sample pad has an antibody blocker concentration of 0.4mg/mL. The test strip is assembled by the sample pad, and 21 false positive samples are detected.

In a further preferred embodiment, recombinant antibody 2 and recombinant antibody 4 are each diluted with PBS buffer to a final concentration of 0.2mg/mL, and the two recombinant antibodies are treated together with the sample pad, i.e. the final treated sample pad has an antibody blocker concentration of 0.4mg/mL. The test strip is assembled by the sample pad, and 21 false positive samples are detected.

The embodiment of the application also provides an in-vitro immunodiagnosis product, which comprises the blocker, wherein the blocker comprises at least one of a first antibody to a sixth antibody, has the effect of reducing or eliminating the influence of endogenous interference substances on immunodetection, and has low use concentration and good stability, so that the in-vitro immunodiagnosis product using the blocker can carry out in-vitro detection more accurately at low cost.

In one embodiment, the antibody blocking agent is added to the sample diluent, and in another embodiment, the antibody blocking agent is added to the sample pad and dried for use.

In one embodiment, the in vitro immunodiagnostic product may be an N-terminal B-natriuretic peptide (NT-proBNP) immunodiagnostic product, wherein the antibody blocking agent is used for NT-proBNP immunofluorescence detection.

In another embodiment, the in vitro immunodiagnostic product may be a cardiac troponin I (cTnI) immunodiagnostic product, wherein the antibody blocking agent is used for cTnI immunofluorescence detection.

In immunodiagnostic assays, the solid phase used may be porous and non-porous materials, latex particulates, magnetic particulates, and the like.

The assays and kits of the present application may be used in point of care testing (POCT), or in electrochemical immunoassay systems. Any of the exemplary forms of the present application and assays or kits according to the present application can be used in and optimized for automated and semi-automated systems.

Finally, the embodiment of the application also provides an application, namely an application of the blocking agent in the embodiment of the application in preparing an in-vitro immunodiagnosis product. According to the blocking agent provided by the embodiment of the application, the first antibody to the sixth antibody have good blocking effect on endogenous interference, can effectively reduce false positive or false negative results of immune detection caused by endogenous interfering substances of a human body, and are low in use concentration and good in stability, so that the blocking agent can be used for preparing in-vitro immune diagnosis products, such as in-vitro immune diagnosis kits, and detection can be realized more accurately at low cost.

The following examples, which are given for illustrative purposes only and should not be construed as limiting the scope of the present application, will aid a clearer understanding of the present invention.

EXAMPLE 1 preparation of monoclonal antibodies

1. Screening of false positive samples

The nitrocellulose membrane (NC membrane) and the labeled fluorescent microsphere are respectively coated by the mouse IgG antibody, a double antibody sandwich method terminal reagent is simulated, a fluorescent immunochromatography product is prepared to screen clinical random samples, and clinical samples containing components capable of binding with the mouse IgG antibody are selected.

1.1 labeling fluorescent microspheres: according to the process of marking fluorescent microspheres (Bangs laboratories, FCEU 002), using 0.1M, pH 6.0.0 of 4-morpholinoethanesulfonic acid (MES) buffer, after activation, coupling the fluorescent microspheres with a mouse IgG antibody (original Gu Shengwu BLOCK-3), coupling 100ug of mouse IgG antibody per mg of fluorescent microspheres, blocking with bovine serum albumin, storing in MES buffer, and freeze-drying for later use;

1.2 coating NC film: the murine IgG antibody was diluted to a final concentration of 1.0mg/ml with 10mM, pH 7.4 PBS buffer, 2% sucrose, then coated onto the NC membrane of Sidoris 140 as a detection line (T line), and the goat anti-murine antibody was diluted to a final concentration of 1.0mg/ml as a quality control line (C line), and sealed for use after overnight at 37 ℃.

1.3 sample pad preparation: treating the sample pad with 10mM PBS buffer solution with pH of 7.4, and freeze-drying for later use;

1.4 assembly test: the labeled fluorescent microspheres (using concentration of 0.35 mg/ml), coated NC membrane, sample pad, and double antibody sandwich fluorescent immunochromatographic rapid test card were assembled, 80ul of clinical random sample was added to each test card, and after 15 minutes at room temperature, the ratio of T-line signal to C-line signal (T/C value) was measured using a fluorometer.

When the sample does not contain false positive components, the T value is very low, and is the background value, most of the mouse IgG antibodies of the labeled fluorescent microspheres are combined to the C line, and the T/C value is approximately equal to 0. If the sample contains false positive components, the mouse IgG-false positive component complex of the labeled fluorescent microsphere is bound to the T line, and the remaining labeled fluorescent microsphere mouse IgG is bound to the C line, and the T/C value is proportional to the concentration of the mouse IgG antibody binding component in the clinical random sample. In the clinical random samples, the components capable of being combined with the mouse IgG antibody are very low, and in the embodiment, the T/C value is more than 0.1 as a false positive standard, and the false positive samples are screened.

319 clinical random samples were screened to select 12 samples with T/C values greater than 0.1 as false positive samples, the sample numbers were noted as samples 1-12, and the false positive samples are shown in Table 1 below.

TABLE 1

2. Purification of the principal component of a false positive sample

The preparation of a mouse IgG antibody column, the preparation of a matrix filler which is hydrogen bromide activated agarose gel (CNBr-4 FF), mixing 3 false positive serum samples (sample number 1/2/5) obtained by screening to obtain 10ml of false positive serum samples, dialyzing the sample by using 10mM PBS buffer solution with pH of 7.4, separating and eluting the sample by the mouse IgG antibody column, and finally obtaining a component which can be combined with the mouse IgG antibody in the false positive sample, wherein the component is a main component causing false positive in the immunodetection. After the total concentration of the purified protein was measured by BCA method, the protein was concentrated to 500ug/ml by ultrafiltration.

3. Preparation of immunized mice

The purified false positive sample is used as an immunogen to immunize mice. The mice were selected from 7-10 week old female BALB/c mice. The total immunization was 4 times, each time was 2 weeks apart, and the immunization dose was 20. Mu.g/mouse. The primary immunization mixes the main component of the false positive sample with the equal volume of Freund's complete adjuvant (Sigma-Aldrich company), the back subcutaneous multipoint injection, and the secondary immunization mixes the main component of the false positive sample with the equal volume of Freund's incomplete adjuvant (Sigma-Aldrich company), and the abdominal injection. Tail breaking blood collection is carried out 7 days after the fourth immunization of the mice, serum is separated, the antibody titer level of the antiserum of the immunized mice is detected by adopting an indirect ELISA method, so that the immune response effect is observed, and the antibody titer of the serum is selected to be higher than 1:10000 mice were subjected to cell fusion experiments and were boosted by intraperitoneal injection (20. Mu.g/mouse) with the main component of the false positive sample without adjuvant 3 days before the cell fusion experiments.

4. Establishment and screening of hybridoma cells

4.1 establishment of hybridoma cells

On the day of cell fusion with immunized mice, the spleen of the immunized mice was removed under sterile conditions and the organs were made into single cell suspensions. Mouse myeloma cells (SP 2/0) were taken with the above immunized BALB/c mouse spleen cells at a ratio of 1:5, and washing the cells twice before fusing with polyethylene glycol PEG. The cells were washed with pre-warmed PEG1500, gently shaken, and pre-warmed serum-free RPMI-1640 medium, and resuspended in HAT selective medium. The cell suspension was plated at 200ul per well into 96 well plates and at 37℃with 5% CO ₂ The cells are cultured under conditions. Culturing for 4-7 d, culturing with HT culture medium, and growing the fused cells to 96-well plateAt 1/10-1/5 of the bottom area, the supernatant was taken for antibody detection.

4.2 screening of Positive hybridoma cells

Diluting the main components of the false positive sample with a coating buffer (PBS buffer of 0.05mol/L, pH 9.6.6), adding the main components into a 96-well plate with the final concentration of 1 mug/ml in an amount of 100 mug/well, coating overnight at 4 ℃, discarding the coating solution, washing 3 times with a phosphate buffer solution PBST, and drying by beating; blocking with PBST containing 3% skimmed milk, incubating at 37deg.C for 2h at 150 μl/well, washing with PBST 3 times, and drying; adding the supernatant of the fusion cells, the immune mouse positive serum diluted by 1:1000 and the mouse negative serum diluted by 1:1000 into corresponding holes, incubating for 1h at 37 ℃, washing by PBST for 3 times, and drying by beating; horseradish peroxidase (HRP) -labeled goat anti-mouse IgG (from Sigma Co.) at 1:4000 dilution was added, 100. Mu.L/well, incubated for 1h at 37℃and PBST washed 3 times, and patted dry; adding 3,3', 5' -tetramethyl benzidine (TMB) substrate, 100 μl/well, and developing at room temperature in dark place for 10min; the reaction was terminated by adding 50. Mu.L of 2mol/L sulfuric acid per well.

450 in an enzyme labeling instrument _nm Detecting OD of all holes of the ELISA plate under wavelength _450nm A value; OD when negative serum _450nm A value of 0.1 or less to determine the OD of the well _450nm Values greater than the OD of the negative wells _450nm Positive hybridoma cells were obtained with a positive value of 2.1 times or more as a criterion for further cloning.

4.3 cloning of Positive hybridoma cells

Sampling and counting positive hybridoma cell holes secreting antibody, diluting into 100 cells/10 mL culture medium, adding diluted cell suspension into 96-well cell culture plate, placing 100 μl of each well at 37deg.C, and 5% CO ₂ Culturing in a cell culture incubator. After 6-7 days, the formation of cloned cells was observed under a microscope, a single gram of Long Sheng long holes were marked, the cell supernatant was taken out, ELISA detection (same as the above cell fusion detection) was performed, and positive monoclonal cells were selected.

Limiting dilution is carried out on positive hole cells, ELISA values are measured 5-6 days after each limiting dilution, and ELISA detection OD is selected _450nm Limiting dilution is carried out on the monoclonal hole with higher positive value untilThe ELISA assay was positive for 96-well plate whole plate results. And selecting a monoclonal fixed strain with high positive value to obtain about 50 cell strains which stably secrete the main components of the anti-false positive sample.

5. Preparation and purification of antibodies

Preparation and purification of cell-on-list antibody: culturing the obtained 50 hybridoma cell lines in a serum-free RPMI-1640 medium in a T175 flask for 1-2 weeks, and obtaining a cell death rate of 80-90% (at this time, the cell density is approximately 1-2×10) ⁶ At a rate of 6000rpm for 20min, collecting cell suspension, and purifying the supernatant by Protein A immunochromatography. The concentration of the monoclonal antibody obtained by final purification is about 3-5mg/mL. The purified monoclonal antibody is split-packed (100 uL/tube, concentration is 1 mg/ml) and stored at 4-8 ℃.

Example 2 blocking performance evaluation of monoclonal antibodies:

the resulting monoclonal antibody blocking agent was tested for its ability to effectively block false positive samples. The blocking efficiency test was performed using sample 1 and test samples, which were numbered 13-21.

In order to test the effect of the monoclonal antibody blocking agent, 4 RF samples and 5 HAMA samples are screened from collected clinical Rheumatoid Factor (RF) samples (the RF value is more than 300 IU/ml) and the heterotrophic HAMA samples according to the method for screening false positive samples, and the samples are marked as samples 13-21 as test samples, so that the blocking performance of the monoclonal antibody is evaluated. In order to facilitate the evaluation of blocking effect, samples with T/C values greater than 0.5 are selected as test samples. Samples 15, 16, 17 and 21 are RF samples, and samples 13, 14, 18, 19 and 20 are HAMA samples.

A rapid fluorescence immunochromatographic assay product was prepared in the same manner as in "screening of false positive samples" in example 1, in which sample pads were treated with different monoclonal antibodies, specifically, the sample pads were treated with a blocking agent by diluting the different monoclonal antibodies to 0.1mg/ml using 10mM, pH7.4 PBS buffer, and lyophilized for later use, and at this concentration, the amount of the blocking agent per test card sample pad was 4.67ug.

And (3) assembling and testing: the labeled fluorescent microspheres, the coated NC film and the treated sample pad are assembled into an immunofluorescence chromatography rapid test card, samples 1-21 are tested, 80ul of samples are added to each test card, the sample is placed at room temperature for 15 minutes, the result is measured and judged by using a fluorometer, the ratio (T/C) of T line signals to C line signals is read, the sample pad treated by 10mM PBS buffer solution with pH of 7.4 is used as a control, and the monoclonal antibody is tested for false positive elimination effect on the samples.

FIG. 1 shows the blocking effect of 6 monoclonal antibodies on four of the false positive samples (Sample 13, sample14, sample15, sample16 in the figures represent Sample13, sample14, sample15, sample16, respectively), plotted on the T/C values as vertical axis, and comparing the results of the test of monoclonal antibody treated Sample pad and PBS treated Sample pad (control). All 6 monoclonal antibodies significantly reduced the T/C value of the false positive samples compared to the control, indicating that these 6 monoclonal antibodies have a blocking effect on the false positive samples.

The 6 monoclonal antibodies have obvious blocking effect on other false positive samples, and the blocking efficiency is between 30 and 90 percent.

The 6 monoclonal antibodies are respectively: D1F3, F6C4, a503, a504, a505, a506, corresponding hybridoma cell line numbers are: d1f3, F6C4, a503, a504, a505, a506.

EXAMPLE 3 cloning and sequencing of monoclonal antibody variable region sequences

Total RNA was isolated from the six hybridoma cell lines, cDNA was prepared by reverse transcription to clone immunoglobulin sequences from the hybridoma cell lines, and the hybridoma cell line antibody variable region sequences were determined.

Extraction of RNA: the total RNA extraction of the hybridoma cell line was performed by referring to the instructions of the total RNA M5 extraction kit (purchased from Beijing polymeric Biotech Co., ltd.);

reverse transcription of RNA into cDNA: reverse transcription of total RNA extracted in the previous step is performed with reference to M5 First Strand cDNA Synthesis Kit polymeric America (purchased from Beijing polymeric Biotechnology Co., ltd.) to obtain cDNA, and frozen at-20deg.C for use;

3. PCR amplification and recovery of variable region sequences: the cDNA obtained in the above step is used as a template, and immunoglobulin heavy chain (IgH) cDNA is amplified by PCR using universal heavy chain primers such as MulgVH5'-A and MulgGVH3' -2; similarly, PCR products are recovered by PCR amplification of immunoglobulin light chain (IgK) cdnas using universal light chain primers, such as muigκvl5'-a and muigκvl3' -1; the PCR reaction used a thermostable pfu dna polymerase throughout.

MulgVH5’-A(GGGAATTCATGRASTTSKGGYTMARCTKGRTTT；SEQ ID NO.37)

MulgGVH3’-2(CCCAAGCTTCCAGGGRCCARKGGATARACNGRTGG；SEQ ID NO.38)

MuIgκVL5'-A(GGGAATTCATGRAGWCACAKWCYCAGGTCTTT；SEQ ID NO.39)

MuIgκVL3'-1(CCCAAGCTTACTGGATGGTGGGAAGATGGA；SEQ ID NO.40)

4. Cloning and sequencing of variable region sequences: according to the specification of cloning vector pTOPO-Blunt Cloning kit (purchased from Beijing polymeric Biotechnology Co., ltd.), the heavy chain and light chain variable region genes were respectively linked to pTOPO vector, E.coli DH 5. Alpha. Was transformed, positive clones were picked up, and submitted to Beijing Rui Biotechnology Co., ltd for sequencing. The heavy chain variable region gene sequence and the light chain variable region gene sequence of the antibody of the hybridoma cell strain obtained by sequencing are analyzed, and the complementarity determining region sequences of the heavy chain and the complementarity determining region sequences of the light chain are analyzed as follows.

Antibody 1 (corresponding hybridoma cell line number: D1F 3)

VH CDR1：GFTFSSF；CDR2：SSGSSI；CDR3：WDGNSFAY

VL CDR1：SASQGISNFLN；CDR2：YTSSLHS；CDR3：QQYSKLPYT。

Antibody 2 (corresponding hybridoma cell line number: A504)

VH CDR1：GFTFSNY；CDR2：TSGGLY；CDR3：HYTTATFDF

VL CDR1：RTSQDISNFLN；CDR2：YTSRLHS；CDR3：QQGNALPPT。

Antibody 3 (corresponding hybridoma cell line number: A503)

VH CDR1：GFIFSDY；CDR2：SNGGGN；CDR3：LYYDDDEKRAVYWYFDV

VL CDR1：KASQDINKYLA；CDR2：YTSTLQP；CDR3：LQYDRVTWT。

Antibody 4 (corresponding hybridoma cell line number: F6C 4)

VH CDR1：GYTFTNY；CDR2：NTYSGE；CDR3：EGNFDY

VL CDR1：KASQDVSTAVA；CDR2：SASYRFS；CDR3：QQHYTTPFT。

Antibody 5 (corresponding hybridoma cell line number: A505)

VH CDR1：GYTFTGS；CDR2：NPGSDY；CDR3：ERGLPNYYGMDS

VL CDR1：KASQNVGTYVA；CDR2：SASYRHS；CDR3：QQYDSYPYT。

Antibody 6 (corresponding hybridoma cell line number: A506)

VH CDR1：GFIFSDY；CDR2：SNGGGN；CDR3：LYYDDDEKRAVYWYFDY

VL CDR1：KASQDINNYIA；CDR2：YTSTLQP；CDR3：LQYDSVTWT。

Example 4 preparation of blocking agent for recombinant antibodies

Constructing recombinant antibody, preparing cell strain for stably expressing the antibody through eukaryotic expression, and culturing and purifying in large scale:

the variable region genes (VH and VL) of the heavy chain and the light chain of the monoclonal antibody D1F3 are amplified by adopting an RT-PCR method, and the sequences are determined by sequencing. The VL and VH genes of the antibodies were constructed on pcdna3.1 vectors. The heavy chain and light chain gene expression plasmids of the antibodies are electrically transduced into CHO host cells, the cells are added into a pressure screening culture medium (50 uM MSX) for culturing for 20 days after the electrotransduction, and the supernatant is taken for ELISA detection (the goat anti-mouse IgG marked by horseradish peroxidase (HRP) is used as a secondary antibody for screening, and a recombinant antibody cell strain with stable expression is screened out).

And (3) carrying out large-scale cell culture on the screened stable-rotation recombinant antibody cell strain by adopting a cell roller bottle culture technology, and preparing the recombinant antibody. Cells were grown in (0.2-0.3) x10 with medium (Vega CHO) ⁶ The cells/ml were inoculated into roller bottles, 1L roller bottles contained 300ml of medium (Vega CHO), the number of inoculated bottles was determined according to the production requirements, and the roller bottles inoculated with cells were placed into a cell-transfer bottle machine and cultured in a cell incubator. Culture barThe temperature was 37℃and the carbon dioxide was 5% at 900 revolutions per hour. After 7-9 days of culture, observing under a sampling microscope, and centrifuging to collect samples when the cell activity rate is less than 50%. And carrying out affinity purification on the sample by using a protein A affinity chromatographic column to obtain an antibody, namely a recombinant antibody.

EXAMPLE 5 test of blocking Effect of recombinant antibodies on false Positive samples

Testing the blocking effect of different recombinant antibodies on false-positive serum

Nitrocellulose membrane (NC membrane) and labeled fluorescent microspheres were coated with murine IgG antibodies, respectively. The murine IgG antibody was diluted to a final concentration of 1.0mg/ml with 10mM, pH 7.4 PBS buffer, 2% sucrose, then coated onto the NC membrane of Sidoris 140 as the detection line (T line), and the goat anti-mouse antibody as the quality control line (C line), and sealed for use after overnight at 37 ℃. Sample pad preparation: each recombinant antibody was diluted to 0.1mg/mL with 10mM, pH 7.4 PBS buffer as blocking agent, treated with sample pad, and lyophilized for use with 10mM, pH 7.4 PBS buffer as control; and (3) assembling and testing: the labeled fluorescent microspheres, the coated NC film and the sample pad are assembled into double-antibody sandwich fluorescent immunochromatography rapid test cards, 80ul of samples are added into each test card, and after the test card is placed for 15 minutes at room temperature, the ratio (T/C value) of T line signals to C line signals is measured by using a fluorometer.

Recombinant antibody 1 has the same CDRs as antibody 1 (D1F 3), recombinant antibody 2 has the same CDRs as antibody 2 (a 504), recombinant antibody 3 has the same CDRs as antibody 3 (a 503), recombinant antibody 4 has the same CDRs as antibody 4 (F6C 4), recombinant antibody 5 has the same CDRs as antibody 5 (a 505), and recombinant antibody 6 has the same CDRs as antibody 6 (a 506).

And assembling an immunofluorescence chromatography rapid test card, testing samples 1-21, and testing the false positive elimination effect of each recombinant antibody on the samples. The recombinant antibody blockers were 0.1mg/mL, 80ul of false anode samples were added to each test, and after 15 minutes of standing at room temperature, the results were measured and judged using a fluorometer, and a 10mM, pH 7.4 PBS buffer-treated sample pad was used as a control.

Recombinant antibodies with the same CDRs have similar or slightly better blocking effects at the same concentration compared to monoclonal antibodies. FIG. 2 shows blocking effects of monoclonal antibody D1F3 (i.e., antibody 1 in example 3) and recombinant antibody D1F3 (i.e., recombinant antibody 1 in this example 5) in four of the false positive samples. In sample 1, the blocking efficiency of the recombinant antibody is greatly improved compared with that of the monoclonal antibody. In the other three samples, the blocking efficiency of the recombinant antibody D1F3 was slightly higher than that of the monoclonal antibody D1F3.

In addition, recombinant antibody D1F3 also showed similar blocking effects in other false positive samples, whether HAMA samples or RF samples, compared to monoclonal antibody D1F3, and the blocking efficiency data are shown in table 2.

TABLE 2

False positive samples	Monoclonal antibody D1F3	Recombinant antibody D1F3
			13	94.25％	96.27％
14	74.45％	85.58％
			15	43.89％	54.27％
16	78.94％	80.13％
			17	43.45％	48.92％
18	51.14％	53.71％
			19	63.67％	65.33％
20	78.74％	81.41％
			21	71.64％	75.95％
1	39.21％	67.49％

The other five recombinant antibodies, which also compared to the monoclonal antibodies having the same CDRs, all showed similar or better blocking effects. Among them, the blocking efficiency of recombinant antibody 1 and recombinant antibody 4 is the best, and the recombinant antibody 2 is the next.

EXAMPLE 6 evaluation of blocking efficiency of recombinant antibodies

Blocking efficiency of 6 recombinant antibodies against ten false positive samples at 0.1mg/mL use concentration is shown in table 3 below:

TABLE 3 Table 3

/>

As shown in the above table, in some samples, the blocking efficiency of a single recombinant antibody blocking agent can reach 96.27%, but in some samples with particularly strong interference, the blocking efficiency is relatively low, even in individual samples, the blocking agent does not show a blocking effect. The incidence rate of the different interference in the clinical sample is very high, the interference degree of different samples is larger due to the complexity of the sample source, even if the interference degree of the same patient sample is different along with the sampling time, the interference degree of the same patient sample is different, and in order to obtain the blocking agent which can be more universal, the combination of the blocking agents is optimized, and some blocking agents are selected for combined use, so that the blocking efficiency and universality of the blocking agent are further improved.

Example 7 optimization of recombinant antibodies as blocking Agents

The recombinant antibodies 1, 2 and 4 were combined in pairs (condition 1, 2 and 3 below), and the combined effect was tested as a blocking agent for the elimination of false positives, and the amount of the blocking agent used for the recombination was adjusted to test the combined effect.

Condition 1: the recombinant antibodies 1 and 4 were diluted with 10mM PBS buffer, pH 7.4, to respective final concentrations of 0.2mg/mL to treat the sample pads together, i.e., the final treated sample pad had a concentration of 0.4mg/mL (total blocker 18.68 ug);

condition 2: the recombinant antibodies 1 and 2 were diluted with 10mM PBS buffer, pH 7.4, to respective final concentrations of 0.2mg/mL to treat the sample pads together, i.e., the final treated sample pad had a concentration of 0.4mg/mL (total blocker 18.68 ug);

condition 3: recombinant antibody 2 and recombinant antibody 4 were each diluted with 10mM, pH 7.4 PBS buffer to a final concentration of 0.2mg/mL for each sample pad, i.e., the final treated sample pad had a concentration of 0.4mg/mL (total blocker 18.68 ug).

If the blocking agent tests 21 false positive samples and the T/C value is reduced to 0.1 or below, 18 false positive can be eliminated under the condition 1, 16 false positive can be eliminated under the condition 2, 16 false positive can be eliminated under the condition 3, and the blocking effect of the condition 1 is optimal, and specific data are shown in the table 4.

TABLE 4 Table 4

Sample numbering	-	1	2	3	4	5	6	7	8	9	10
												Control	T/C	4.15	0.83	0.29	0.45	0.49	0.10	0.26	0.10	0.13	0.62
Condition 1	T/C	0.08	0.03	0.02	0.03	0.02	0.02	0.02	0.02	0.02	0.02
												Condition 2	T/C	0.11	0.03	0.02	0.02	0.02	0.02	0.02	0.02	0.02	0.02
Condition 3	T/C	0.06	0.02	0.02	0.02	0.02	0.02	0.03	0.02	0.03	0.02
												Sample numbering	11	12	13	14	15	16	17	18	19	20	21
Control	0.12	0.14	10.83	6.97	10.30	10.95	5.52	9.04	1.05	0.59	11.16
												Condition 1	0.03	0.02	0.03	0.02	0.05	0.03	0.12	0.12	0.05	0.03	0.11
Condition 2	0.03	0.02	0.03	0.02	0.39	0.13	0.38	0.14	0.06	0.03	0.07
												Condition 3	0.03	0.02	0.03	0.02	0.19	0.11	0.45	0.12	0.03	0.02	0.10

The blocking efficiency (percent decrease in T/C) of 21 false positive samples under the three conditions described above compared to the T/C value of the control (no blocking agent added) is shown in table 5 below.

TABLE 5

EXAMPLE 8 evaluation of blocking agent stability of recombinant antibody formation

Thermal stability assessment conditions: the recombinant antibodies were placed at 37 degrees celsius for 7 days, or 45 degrees celsius for 3 days, and the effect of the test conditions on the blocking efficiency of the 4 false positive samples was tested.

Repeated freeze thawing assessment: the recombinant antibody was repeatedly frozen and thawed 5 times, or 10 times later, and the effect of the test conditions on the blocking efficiency of the 4 false positive samples was tested.

The test with sample 1, sample 14, sample 16 and sample 21 showed similar blocking efficiency with the heat-stable and repeated freeze-thawing test as compared with the non-tested antibody blocking agent (control), and the recombinant antibody had better stability (see fig. 3).

Nitrocellulose membrane (NC membrane) and labeled fluorescent microspheres were coated with murine IgG antibodies, respectively. The murine IgG antibody was diluted to a final concentration of 1.0mg/ml with 10mM, pH 7.4 PBS buffer, 2% sucrose, then coated onto the NC membrane of Sidoris 140 as the detection line (T line), and the goat anti-mouse antibody as the quality control line (C line), and sealed for use after overnight at 37 ℃. Sample pad preparation: preparing a sample pad with stability check according to the following conditions 4, 5, 6, 7 and 8, wherein the recombinant antibody of the condition 4 is not subjected to high temperature or freeze thawing treatment, and the sample pad is used as a control; and (3) assembling and testing: the labeled fluorescent microspheres, the coated NC film and the sample pad are assembled into double-antibody sandwich fluorescent immunochromatography rapid test cards, 80ul of samples are added into each test card, and after the test card is placed for 15 minutes at room temperature, the ratio (T/C value) of T line signals to C line signals is measured by using a fluorometer.

Condition 4: recombinant antibody 1 was stored at 4 ℃ for 7 days, then the sample pad was treated with 10mM, pH 7.4 PBS buffer diluted to 0.1 mg/mL;

condition 5: recombinant antibody 1 was stored at 37 ℃ for 7 days, then the sample pad was treated with 10mM, pH 7.4 PBS buffer diluted to 0.1 mg/mL;

condition 6: recombinant antibody 1 was stored at 45 ℃ for 3 days, then the sample pad was treated with 10mM, pH 7.4 PBS buffer diluted to 0.1 mg/mL;

condition 7: the recombinant antibody 1 was freeze-thawed 5 times, and then the sample pad was treated with 10mM, pH 7.4 PBS buffer diluted to 0.1 mg/mL;

condition 8: recombinant antibody 1 was freeze-thawed 10 times, and then the sample pad was treated with 10mM, pH 7.4 PBS buffer diluted to 0.1 mg/mL;

the results are shown in Table 6 and FIG. 3, and the blocking effect on false positives is substantially consistent with the recombinant antibody blocking agent treated under the examination conditions of 5 times of freeze thawing, 10 times of freeze thawing, etc. when the recombinant antibody blocking agent is stored at 37℃for 7 days and 45℃for 3 days, as compared with the recombinant antibody blocking agent stored at 4 ℃. The data show that the blocking performance of the blocking agent after high-temperature storage and repeated freezing and thawing is basically consistent with that of a control, and the blocking agent has excellent stability.

TABLE 6

Example 9 use of blocking Agents in the detection of NT-proBNP

Assembling the kit, and coating a mouse anti-NT-proBNP monoclonal antibody and a quality control line (C line) with a goat anti-mouse IgG polyclonal antibody by using a double-antibody sandwich immunochromatography method and a nitrocellulose membrane detection line (T line) of a detection card. During detection, a sample and a diluent are mixed uniformly and then are accurately added into a sample adding hole of a detection card, the liquid is chromatographed upwards under the capillary effect, NT-proBNP antigen in the sample is combined with a fluorescent microsphere marked mouse anti-NT-proBNP monoclonal antibody in the chromatography process, a solid phase mouse anti-NT-proBNP monoclonal antibody-NT-proBNP antigen-marked mouse anti-NT-proBNP monoclonal antibody-fluorescent microsphere particle complex is formed at a T line, and a solid phase goat anti-mouse IgG polyclonal antibody-marked mouse anti-NT-proBNP monoclonal antibody-fluorescent microsphere particle complex is formed at a C line. The fluorescent microsphere particles emit visible light signals under excitation light, the ratio (T/C) of the T line signals and the C line signals is in direct proportion to the concentration value of NT-proBNP in a sample, the concentration of NT-proBNP in the sample is calculated through standard curve fitting of a fluorescent immunoassay analyzer, and the value can be directly read from the screen of the analyzer.

The kit sample pad was treated with the blocking agents of condition 1, condition 2 and condition 3 of example 7, and 500 clinical negative samples (samples that were negative by PCR) were each verified. The results show that: the blocking agent of condition 1 detected negative 496 cases with a specificity of 99.2%; the blocking agent of condition 2 detected negative 494 cases with a specificity of 98.8%; the blocker of condition 3 detected a negative 493 cases with a specificity of 98.6% (wherein specificity = number of negative samples detected 100%/number of samples detected).

Example 10 application of blocking agent in cTnI detection project

Assembling the kit, and coating a mouse anti-cTnI monoclonal antibody and a quality control line (C line) with a goat anti-mouse IgG polyclonal antibody by using a double-antibody sandwich immunochromatography method and a nitrocellulose membrane detection line (T line) of a detection card. During detection, a sample and a diluent are mixed uniformly and then are accurately added into a detection card sample adding hole, liquid is chromatographed upwards under a capillary effect, cTnI antigen in the sample is combined with a fluorescent microsphere marked mouse anti-cTnI monoclonal antibody in a chromatography process, a solid phase mouse anti-cTnI monoclonal antibody-cTnI antigen-marked mouse anti-cTnI monoclonal antibody-fluorescent microsphere particle complex is formed at a T line, and a solid phase goat anti-mouse IgG polyclonal antibody-marked mouse anti-cTnI monoclonal antibody-fluorescent microsphere particle complex is formed at a C line. The fluorescent microsphere particles emit visible light signals under excitation light, the ratio (T/C) of the T line signals and the C line signals is in direct proportion to the concentration value of cTnI in a sample, the concentration of the cTnI in the sample is calculated through standard curve fitting of a fluorescent immunoassay analyzer, and the value can be directly read from the screen of the analyzer.

The kit sample pad was treated with the blocking agents of condition 1, condition 2 and condition 3 of example 7, and 578 clinical negative samples (samples that were negative by PCR) were each verified. The results show that: the blocking agent of condition 1 detected negative 573 cases, the specificity was 99.13%, the blocking agent of condition 2 detected negative 570 cases, the specificity was 98.62%, and the blocking agent of condition 3 detected negative 571 cases, the specificity was 98.79%.

In addition, six recombinant antibodies (recombinant antibody 1, recombinant antibody 2, recombinant antibody 3, recombinant antibody 4, recombinant antibody 5, recombinant antibody 6) were diluted to 0.1mg/ml with 10mM, pH 7.4 PBS buffer as blocking agent for chemiluminescent platform test, and the results are shown in Table 7: normal human serum cTnI20-130pg/ml was tested by antibody detection based on heavbio Anti-cTnI, whereas the blocker of the present application had a significant blocking effect on false positive serum samples (four false positive samples: sample 1, sample 14, sample 16, sample 21), and the blocker of the present application could also eliminate false positives on chemiluminescent platforms.

TABLE 7

The foregoing description of the preferred embodiments of the present application is not intended to be limiting, but is intended to cover any and all modifications, equivalents, and alternatives falling within the spirit and principles of the present application.

Claims (13)

1. A blocking agent, comprising at least one of the following antibodies:

a first antibody having complementarity determining region sequences of: VH CDR1: SEQ ID NO.1, VH CDR2: SEQ ID NO.2, VH CDR3: SEQ ID NO.3; VL CDR1: SEQ ID NO.4, VL CDR2: SEQ ID NO.5, VL CDR1: SEQ ID NO.6;

a second antibody having complementarity determining region sequences of: VH CDR1: SEQ ID NO.7, VH CDR2: SEQ ID NO.8, VH CDR3: SEQ ID NO.9; VL CDR1: SEQ ID NO.10, VL CDR2: SEQ ID NO.11, VL CDR1: SEQ ID NO.12;

a third antibody having complementarity determining region sequences of: VH CDR1: SEQ ID NO.13, VH CDR2: SEQ ID NO.14, VH CDR3: SEQ ID NO.15; VL CDR1: SEQ ID NO.16, VL CDR2: SEQ ID NO.17, VL CDR1: SEQ ID NO.18;

a fourth antibody having complementarity determining region sequences of: VH CDR1: SEQ ID NO.19, VH CDR2: SEQ ID NO.20, VH CDR3: SEQ ID NO.21; VL CDR1: SEQ ID NO.22, VL CDR2: SEQ ID NO.23, VL CDR1: SEQ ID NO.24;

a fifth antibody having complementarity determining region sequences of: VH CDR1: SEQ ID NO.25, VH CDR2: SEQ ID NO.26, VH CDR3: SEQ ID NO.27; VL CDR1: SEQ ID NO.28, VL CDR2: SEQ ID NO.29, VL CDR1: SEQ ID NO.30;

A sixth antibody having complementarity determining region sequences of: VH CDR1: SEQ ID NO.31, VH CDR2: SEQ ID NO.32, VH CDR3: SEQ ID NO.33; VL CDR1: SEQ ID NO.34, VL CDR2: SEQ ID NO.35, VL CDR1: SEQ ID NO.36.

2. The blocking agent of claim 1, wherein the blocking agent comprises at least two of the first antibody, the second antibody, the third antibody, the fourth antibody, the fifth antibody, and the sixth antibody.

3. The blocking agent of claim 2, wherein the blocking agent comprises the first antibody and the second antibody; or alternatively, the process may be performed,

the blocking agent comprises the first antibody and the fourth antibody; or alternatively, the process may be performed,

the blocking agent includes the second antibody and the fourth antibody.

4. The blocking agent of claim 1, wherein each antibody in the blocking agent is used at a concentration of 0.1 to 0.4mg/mL.

5. The blocking agent of claim 4, wherein each antibody in the blocking agent is used at a concentration of 0.1 to 0.2mg/ml.

6. The blocking agent of claim 5, wherein each antibody in the blocking agent is used at a concentration of 0.2mg/ml.

7. The blocking agent of any one of claims 1-6, wherein the antibody in the blocking agent is a monoclonal antibody or a recombinant antibody.

8. A monoclonal cell line having a preservation number of CGMCC No.45250, which secretes the first antibody of the blocking agent of any one of claims 1 to 7.

9. A monoclonal cell line having a preservation number of CGMCC No.45301, which secretes the fourth antibody of the blocking agent of any one of claims 1 to 7.

10. An in vitro immunodiagnostic product comprising the blocker according to any one of claims 1 to 7.

11. The in vitro immunodiagnostic product of claim 10 comprising an in vitro immunodiagnostic kit comprising said blocking agent.

12. The in vitro immunodiagnostic product of claim 10 wherein said in vitro immunodiagnostic product comprises at least one of an N-terminal B-type natriuretic peptide immunodiagnostic product and a cardiac troponin I immunodiagnostic product.

13. Use of a blocker according to any one of claims 1 to 7 for the preparation of an in vitro immunodiagnostic product.

Images