CN115825415A - Blocking agent, in-vitro immunodiagnosis product and application - Google Patents

Abstract

The application relates to the technical field of immunodiagnosis reagents, in particular to a blocking agent, an immunodiagnosis product and application. The blocking agent of the present application includes at least one of a first antibody, a second antibody, a third antibody, a fourth antibody, a fifth antibody, and a sixth antibody. The antibodies have specific complementarity determining region sequences, can reduce or eliminate the influence of endogenous interfering substances on immunodetection when used as a blocking agent, and have low effective concentration and good stability, thereby having good application prospect in the field of in vitro immunodiagnosis.

Description

Blocking agent, in-vitro immunodiagnosis product and application

Technical Field

The application belongs to the technical field of immunodiagnosis reagents, and particularly relates to a blocking agent, an immunodiagnosis product and application.

Background

In Vitro Diagnosis (IVD) refers to the determination of diseases or body functions by detecting a human body sample (blood, body fluid, tissue, etc.) In addition to the human body to obtain clinical diagnostic information. The in vitro diagnosis mode can quickly and accurately diagnose diseases at early stage and plays an important role in the fields of clinical medicine and related medical research. In a healthy human body, the serum may contain endogenous interfering substances, such as Heterophilic Antibodies (HA), rheumatoid Factors (RF), etc., which can be directly bound with detection antibodies in immunoassay, thereby causing false positive or false negative results in diagnosis, particularly immunoassay based on a double antibody sandwich method, which is easily affected by the endogenous interfering substances in the serum.

The blocking agent is a reagent capable of eliminating interference of immunoassay, and can reduce and eliminate the influence of endogenous interfering substances on immunoassay, thereby ensuring that the result of immunoassay is sensitive and accurate. The blocking agent can be used in a double-antibody sandwich method and a competitive inhibition method, such as multiple platforms of immunoturbidimetry, chemiluminescence, colloidal gold chromatography, fluorescence chromatography and the like.

For example, heterophilic antibody blockers can bind heterophilic antibodies in serum or plasma samples, thereby blocking interference of heterophilic antibodies with the detection results. Normally, normal animal serum or normal animal immunoglobulin G (IgG) is used as a blocking agent, and by adding at high concentrations, heterophilic antibodies preferentially bind to such blocking agent and do not bind to the detection antibody or capture antibody, thereby reducing interference. The blocker effect depends on its affinity for heterophilic antibodies. However, the concentration of the conventional blocking agent such as animal serum or animal immunoglobulin G used in the detection is usually as high as several milligrams per milliliter (mg/mL), and the use cost of the blocking agent is high, so the detection cost is high.

Rheumatoid Factor (RF) is a kind of autoantibody in human body, which can react with the antigenic determinant of Fc segment of auto IgG, wherein the classified rheumatoid factor recognizes the common antigenic determinant of human and animal IgG, thus causing cross reaction, and is directly combined with capture antibody and enzyme-labeled secondary antibody in double antibody sandwich method, forming interference to immunoassay, usually causing false positive result. Similarly, the rheumatoid factor blocking agent can be used for blocking the interference of the rheumatoid factor on the detection result.

At present, commercial immune blocking agents aiming at heterophilic antibodies and rheumatoid factors in the market are high in use concentration, poor in product purity and insufficient in stability, precipitates are easy to generate, reagent performance is affected, therefore, the effect of eliminating false positives is poor, and a large improvement space is provided.

Disclosure of Invention

The application aims to provide a blocking agent, an in vitro immunodiagnosis product and application, and aims to solve the technical problems of high use concentration and poor blocking effect of the existing blocking agent.

In order to achieve the purpose of the application, the technical scheme adopted by the application is as follows:

in a first aspect, the present application provides a blocking agent comprising at least one of the following antibodies:

a first antibody, wherein three complementarity determining region sequences of a heavy chain variable region of the first antibody are shown in SEQ ID NO.1-3, and three complementarity determining region sequences of a light chain variable region of the first antibody are shown in SEQ ID NO. 4-6;

a second antibody, wherein the sequences of the three complementarity determining regions of the heavy chain variable region of the second antibody are shown in SEQ ID NO.7-9, and the sequences of the three complementarity determining regions of the light chain variable region of the second antibody are shown in SEQ ID NO. 10-12;

a third antibody, wherein three complementarity determining region sequences of a heavy chain variable region of the third antibody are shown in SEQ ID NO.13-15, and three complementarity determining region sequences of a light chain variable region of the third antibody are shown in SEQ ID NO. 16-18;

a fourth antibody, wherein the sequences of the three complementarity determining regions of the heavy chain variable region of the fourth antibody are shown in SEQ ID NO.19-21, and the sequences of the three complementarity determining regions of the light chain variable region of the fourth antibody are shown in SEQ ID NO. 22-24;

a fifth antibody, wherein the sequences of the three complementarity determining regions of the heavy chain variable region of the fifth antibody are shown in SEQ ID NO.25-27, and the sequences of the three complementarity determining regions of the light chain variable region of the fifth antibody are shown in SEQ ID NO. 28-30;

a sixth antibody, wherein the sequences of the three complementarity determining regions of the heavy chain variable region of the sixth antibody are shown in SEQ ID NO.31-33, and the sequences of the three complementarity determining regions of the light chain variable region of the sixth antibody are shown in SEQ ID NO. 34-36.

In one embodiment, the blocking agent comprises at least two of a first antibody, a second antibody, a third antibody, a fourth antibody, a fifth antibody, a sixth antibody, preferably the first antibody and the second antibody; alternatively, the first and second electrodes may be,

the blocking agent preferably comprises the first antibody and the fourth antibody; alternatively, the first and second electrodes may be,

the blocking agent preferably comprises the second antibody and the fourth antibody.

In one embodiment, each antibody in the blocking agent is used at a concentration of 0.1 to 0.4mg/mL, preferably 0.1 to 0.2mg/mL, and more preferably 0.2mg/mL.

In one embodiment, the antibody in the blocking agent is a monoclonal antibody or a recombinant antibody.

In a second aspect, the present application provides a monoclonal cell strain with a accession number of CGMCC NO.45250, which secretes the first antibody in the blocking agent provided herein.

And another monoclonal cell strain with the preservation number of CGMCC NO.45301, which secretes the fourth antibody in the blocker provided by the application.

In a third aspect, the present application provides an in vitro immunodiagnostic product comprising a blocking agent of the present application.

In one embodiment, the in vitro immunodiagnostic product comprises an in vitro immunodiagnostic kit comprising the blocking agent.

In one embodiment, the in vitro immunodiagnostic product comprises at least one of an N-terminal B-type natriuretic peptide immunodiagnostic product and a cardiac troponin I immunodiagnostic product.

In a fourth aspect, the present application provides the use of a blocking agent in the preparation of an in vitro immunodiagnostic product.

The blocking agent provided by the first aspect of the application comprises at least one antibody of a first antibody to a sixth antibody, wherein the antibody has a specific complementarity determining region sequence, can reduce or eliminate the influence of endogenous interfering substances on immunoassay when used for the blocking agent, and has low effective concentration and good stability, so the blocking agent has good application prospect in the field of in vitro immunodiagnosis.

The second aspect of the present application provides a monoclonal cell strain with a preservation number of CGMCC NO.45250, or a monoclonal cell strain with a preservation number of CGMCC NO.45301, which secretes a first antibody and a fourth antibody, respectively, and such antibodies can effectively reduce or eliminate the influence of endogenous interfering substances on immunodetection, so that the monoclonal cell strain of the present application can be used for preparing a blocking agent in the field of external immunodiagnosis.

The in vitro immunodiagnostic product provided by the third aspect of the present application comprises the blocking agent specific to the present application, and the blocking agent comprises at least one of the first antibody to the sixth antibody, so that the blocking agent has the effects of reducing or eliminating the influence of endogenous interfering substances on immunodetection, and has low effective concentration and good stability, and therefore, the in vitro immunodiagnostic product using the blocking agent can perform in vitro detection more accurately at low cost.

The application provided by the fourth aspect of the application is based on the characteristics that the blocking agent has low effective concentration and good stability, and can be used for preparing in vitro immunodiagnosis products.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present application, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without creative efforts.

FIG. 1 is a graph showing the effect of six monoclonal antibodies on false positive samples provided in the examples of the present application;

FIG. 2 is a graph showing the effect of a recombinant antibody and a monoclonal antibody on the blocking efficiency of a false positive sample;

FIG. 3 is a graph of the stability effect of the recombinant antibody blockers provided in the examples of the present application.

Detailed Description

In order to make the technical problems, technical solutions and advantageous effects to be solved by the present application more clearly apparent, the present application is further described in detail below with reference to the embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the present application and are not intended to limit the present application.

In the present application, "at least one" means one or more, "plural" means two or more. "at least one of the following" or similar expressions refer to any combination of these items, including any combination of the singular or plural items.

It should be understood that, in various embodiments of the present application, the sequence numbers of the above-mentioned processes do not mean the execution sequence, some or all of the steps may be executed in parallel or executed sequentially, and the execution sequence of each process should be determined by its function and inherent logic, and should not constitute any limitation to the implementation process of the embodiments of the present application.

The terminology used in the embodiments of the present application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. As used in the examples of this application and the appended claims, the singular forms "a", "an", and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

The terms "first", "second", and the like are used for descriptive purposes only and are used for distinguishing purposes such as substances from one another and are not to be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated. For example, a first XX may also be referred to as a second XX, and similarly, a second XX may also be referred to as a first XX, without departing from the scope of embodiments of the present application. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature.

Where a range of values is provided, such as a concentration range, a percentage range, or a ratio range, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the subject matter described. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and such embodiments are also encompassed within the subject matter, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the subject matter.

In the context of the present invention, many embodiments use the expression "comprising", "including" or "consisting essentially/consisting of … …". The expressions "comprising", "including" or "consisting essentially of … …" are generally to be understood as open-ended expressions that include not only the elements, components, assemblies, method steps, etc., specifically listed after the expression, but also other elements, components, assemblies, method steps. In addition, in this document, the expression "comprising", "including" or "consisting essentially of … …" may in some cases also be understood as a closed expression, meaning that only the elements, components, method steps specifically listed after the expression are included, and not any other elements, components, method steps. At this time, the expression is equivalent to the expression "consisting of … …".

For a better understanding of the present teachings and not to limit the scope of the present teachings, unless otherwise indicated, all numbers expressing quantities, percentages or proportions used in the specification and claims, as well as other numerical values, are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

The term "antibody" as used herein refers to an immunoglobulin molecule typically composed of two pairs of polypeptide chains, each pair having one "light" (L) chain and one "heavy" (H) chain. Antibody light chains can be classified as kappa and lambda light chains. Heavy chains can be classified as μ, δ, γ, α or ε, and the isotype of an antibody can be defined accordingly as IgM, igD, igG, igA and IgE, respectively. Within the light and heavy chains, the variable and constant regions are connected by a "J" region (hinge region) of about 12 or more amino acids, and the heavy chain also comprises a "D" region of about 3 or more amino acids. Each heavy chain consists of a heavy chain variable region (VH) and a heavy chain constant region (CH). The heavy chain constant region consists of 3 domains (CH 1, CH2 and CH 3). Each light chain consists of a light chain variable region (VL) and a light chain constant region (CL). The light chain constant region consists of one domain CL. The constant region of the antibody may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component of the classical complement system (C1 q). The VH and VL regions can also be subdivided into regions of high denaturation, called Complementarity Determining Regions (CDRs), interspersed with regions that are more conserved, called Framework Regions (FRs). For each heavy or light chain, the variable regions each comprise three CDRs, namely CDR1, CDR2 and CDR3. Thus, each VH and VL is represented by, in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 consist of 3 CDRs and 4 FRs arranged from amino terminus to carboxy terminus. The variable regions (VH and VL) of each heavy/light chain pair form the antigen-binding sites, respectively.

The assignment rules for assigning amino acids to regions or domains are defined in a number of documents: kabat Sequences of Proteins of Immunological Interest (National Institutes of Health, bethesda M.d. (1987 and 1991)); chothia & Lesk j.mol.biol.1987;196, from 901 to 917; chothia et al, nature 1989;342 from 878 to 883; ehrenmann, francois, quentin Kaas, and Marie-PauleLefranc, "IMGT/3Dstructure-DB and IMGT/DomainGapAlign," a database and a tool for immunoglobulin or antibodies, T cell receptors, MHC, igSF and MhcSF, "Nucleic acids research 2009;38 (Suppl _ 1) D301-D307.

The exact boundaries of the CDRs have been defined differently according to different systems, the Kabat system not only provides a clear residue numbering system applicable to any variable region of an antibody, but also provides precise residue boundaries defining 3 CDRs, which are referred to as Kabat CDRs; chothia found that Kabat system CDR within certain sub-part, although at the amino acid sequence level has a large diversity, but with almost the same peptide backbone conformation, these sub-part is called Chothia CDR, chothia CDR with Kabat CDR overlapping boundary. The boundaries of the above overlap are again described by Padlan and MacCallum, and CDR boundary definitions may not strictly adhere to the above system, such as the AbM definition. Herein, the CDRs may be defined according to any of these systems, although the preferred embodiment uses the antibody numbering system of Chothia et al to define the CDRs. According to the Chothia numbering system, the VH CDR1 of an antibody is located at positions 26-32, the VH CDR2 is located at positions 52-57, the VH CDR3 is located at positions 99-108, the VL CDR1 is located at positions 24-39, the VL CDR2 is located at positions 55-61, and the VL CDR3 is located at positions 94-102.

As used herein, the term "monoclonal antibody" or "monoclonal antibody" refers to an antibody or a fragment of an antibody from a population of highly homologous antibody molecules, i.e., a population of identical antibody molecules except for natural mutations that may occur spontaneously. The antibody molecule is an immunoglobulin, whether it is a natural immunoglobulin or an immunoglobulin that is partially or wholly synthetically obtained. The antibody molecules also include those havingAll polypeptides or proteins of antibody domain binding domains, antibody fragments with antibody domains are molecules such as Fab, scFv, fv, dAb, fd, and diabodies. Monoclonal antibodies have high specificity for a single epitope on the antigen. Polyclonal antibodies are relative to monoclonal antibodies, which typically comprise at least 2 or more different antibodies that typically recognize different epitopes on an antigen. Monoclonal antibodies are generally obtained by the hybridoma technique first reported by Kohler et al (

G,Milstein C.Continuous cultures of fused cells secreting antibody of predefined specificity[J]Nature,1975;256 (5517): 495), but can also be obtained using recombinant DNA techniques (see, e.g., U.S. Pat. No.4,816,567). As used herein, the terms "monoclonal antibody" and "monoclonal antibody" have the same meaning and are used interchangeably; the terms "polyclonal antibody" and "polyclonal antibody" have the same meaning and are used interchangeably; the terms "polypeptide" and "protein" have the same meaning and are used interchangeably. Also, in the present invention, amino acids are generally represented by single-letter and three-letter abbreviations as is well known in the art. For example, alanine can be represented by A or Ala.

In a first aspect, embodiments of the present application provide a blocking agent comprising at least one of the following antibodies: in particular, the amount of the solvent to be used,

a first antibody comprising three complementarity determining region sequences of a heavy chain variable region and a light chain variable region, respectively:

VH CDR1：SEQ ID NO.1，VH CDR2：SEQ ID NO.2，VH CDR3：SEQ ID NO.3；VL CDR1：SEQ ID NO.4，VL CDR2：SEQ ID NO.5，VL CDR1：SEQ ID NO.6；

a second antibody comprising three complementarity determining regions of the heavy chain variable region and the light chain variable region, respectively, as follows:

VH CDR1：SEQ ID NO.7，VH CDR2：SEQ ID NO.8，VH CDR3：SEQ ID NO.9；VL CDR1：SEQ ID NO.10，VL CDR2：SEQ ID NO.11，VL CDR1：SEQ ID NO.12；

the third antibody, the three complementarity determining region sequences of the heavy chain variable region and the light chain variable region are respectively:

VH CDR1：SEQ ID NO.13，VH CDR2：SEQ ID NO.14，VH CDR3：SEQ ID NO.15；VL CDR1：SEQ ID NO.16，VL CDR2：SEQ ID NO.17，VL CDR1：SEQ ID NO.18；

a fourth antibody, comprising three complementarity determining regions sequences of a heavy chain variable region and a light chain variable region, respectively:

VH CDR1：SEQ ID NO.19，VH CDR2：SEQ ID NO.20，VH CDR3：SEQ ID NO.21；VL CDR1：SEQ ID NO.22，VL CDR2：SEQ ID NO.23，VL CDR1：SEQ ID NO.24；

a fifth antibody, wherein the sequences of the three complementarity determining regions of the heavy chain variable region and the light chain variable region are:

VH CDR1：SEQ ID NO.25，VH CDR2：SEQ ID NO.26，VH CDR3：SEQ ID NO.27；VL CDR1：SEQ ID NO.28，VL CDR2：SEQ ID NO.29，VL CDR1：SEQ ID NO.30；

a sixth antibody, wherein the sequences of the three complementarity determining regions of the heavy chain variable region and the light chain variable region are:

VH CDR1：SEQ ID NO.31，VH CDR2：SEQ ID NO.32，VH CDR3：SEQ ID NO.33；VL CDR1：SEQ ID NO.34，VL CDR2：SEQ ID NO.35，VL CDR1：SEQ ID NO.36。

the blocking agent of the present application includes at least one of the first to sixth antibodies. Specifically, 1) the blocking agent comprises one of the first to sixth antibodies, such as the blocking agent comprises the first antibody, or the blocking agent comprises the second antibody, or the blocking agent comprises the third antibody, or the blocking agent comprises the fourth antibody, or the blocking agent comprises the fifth antibody, or the blocking agent comprises the sixth antibody. 2) The blocking agent includes two or more (e.g., three, four, etc.) of the first antibody to the sixth antibody, and may be specifically combined according to actual detection needs. For example, the blocking agent includes a first antibody and a second antibody, or the blocking agent includes a first antibody and a fourth antibody, or the blocking agent includes a second antibody and a fourth antibody. Wherein the first antibody and the fourth antibody have better blocking effect. Preferably, the blocking agent comprises the first antibody and the fourth antibody, and other antibodies can be further added or not added according to actual needs.

Further, the application also provides a production method of the monoclonal antibody blocking agent. In one embodiment, the application uses mouse IgG antibody to respectively coat a nitrocellulose membrane (NC membrane) and a marked fluorescent microsphere, prepares a fluorescent immunochromatographic product to screen clinical random samples, and selects a clinical sample (false positive sample) containing a component capable of combining with the mouse IgG antibody. And separating out the interference component existing in the false positive sample, and immunizing a mouse by taking the purified interference component as immunogen to prepare the hybridoma cell strain. In particular, the present application encompasses hybridoma cell lines, including in particular: the monoclonal cell strain with the preservation number of CGMCC NO.45250 is preserved in China general microbiological culture Collection center (GDMCC) at 22.08.2022, and the preservation address is as follows: xilu No.1 Hospital No.3, beijing, chaoyang, north. Or the monoclonal cell strain with the preservation number of CGMCC NO.45301, which has been preserved in China general microbiological culture Collection center (GDMCC) at 22.08.2022. The two hybridoma cell strains secrete the first antibody and the fourth antibody respectively, and the antibodies can effectively reduce or eliminate the influence of endogenous interfering substances on immunodetection, so that the monoclonal cell strain can be used for preparing a blocking agent in the field of external immunodiagnosis. Monoclonal cell lines secreting other antibodies can be screened in the same manner.

The clinical random sample adopted in the production method of the monoclonal antibody blocking agent is a clinical random healthy human serum sample collected from a hospital. Some antibodies against unknown antigens, usually multispecific and weak antibodies, are present in human peripheral blood, some of which have a long contact history with animals, for example, some antibodies are present in peripheral blood of humans, which antibodies bind to animal antibodies used in immunoassays in which false positive results are likely to occur, and such serum samples are referred to herein as false positive samples. Unknown false positive samples exist in clinical random healthy human serum samples, the method adopts a fluorescence immunization method to screen the clinical random healthy human serum samples, and the false positive samples are selected, so that the monoclonal antibody blocking agent can be obtained.

In immunoassays, murine mabs are most commonly used, and therefore in one embodiment, false positive samples are screened for murine IgG antibodies, it being understood that in some other embodiments, false positive samples may be screened for rabbit IgG or other animal IgG antibodies according to the methods of this embodiment.

In one embodiment, the assembled fluorescent immunochromatographic rapid test card has a test line (T line) of mouse IgG antibody and a control line (C line) of goat anti-mouse IgG, and when the sample contains no false positive component, the fluorometric T line reading (T value) is low and is a background value, most of the mouse IgG antibody labeled with fluorescent microspheres is bound to the C line, and the ratio of the T line reading (T value) to the C line reading (C value) is approximately equal to 0. If the sample contains false positive components, the labeled fluorescent microsphere mouse IgG-false positive components are bound to the T line, the remaining labeled fluorescent microsphere mouse IgG is bound to the C line, and the T/C value is proportional to the concentration of the components capable of binding the mouse IgG antibody in the clinical random sample. Most of the clinical random samples have low components capable of being combined with the mouse IgG antibody, and the sample with the T/C value of more than 0.1 is taken as a false positive sample by artificially setting the T/C value of 0.1 as a critical value through a large number of clinical sample tests.

In one example, 319 clinical randomized samples were screened, 12 samples with T/C values greater than 0.1 were selected as false positive samples, and the Sample numbers were recorded as samples (Sample) 1-12.

In one embodiment, three false positive serum samples with the largest T/C value among the above samples are selected, and the interfering components are separated and used as immunogen to immunize mice to prepare monoclonal cell strains.

In one example, the blocking efficiency of the prepared monoclonal antibody was tested using the false positive sample1 and test samples, which included 4 RF samples (RF values greater than 300 IU/ml) and 5 HAMA (Human anti mouse antibodies) samples (HAMA values greater than 300 ng/ml), numbered samples 13-21.

Other antibodies or chimeric molecules that retain the specificity of the original antibody can be produced using monoclonal and other antibody and recombinant DNA techniques, which can include the introduction of DNA encoding the immunoglobulin variable regions or Complementarity Determining Regions (CDRs) of an antibody into the constant regions or constant regions of a different immunoglobulin plus framework regions. On the basis, the inventor further constructs a recombinant antibody eukaryotic expression vector, introduces the vector into CHO host cells, and screens out a recombinant antibody cell strain with stable expression. Thus, the first through sixth antibodies in the blocking agent of the present application may be monoclonal or recombinant antibodies.

Specifically, the six monoclonal antibodies are respectively: D1F3, F6C4, A503, A504, A505 and A506, and the corresponding hybridoma cell strain numbers are respectively as follows: D1F3, F6C4, a503, a504, a505, a506; antibody information is as follows:

antibody 1 (corresponding to hybridoma cell strain number D1F3, preservation number CGMCC NO. 45250)

VH CDR1：GFTFSSF；CDR2：SSGSSI；CDR3：WDGNSFAY

VL CDR1：SASQGISNFLN；CDR2：YTSSLHS；CDR3：QQYSKLPYT。

Antibody 2 (corresponding hybridoma cell line number A504)

VH CDR1：GFTFSNY；CDR2：TSGGLY；CDR3：HYTTATFDF

VL CDR1：RTSQDISNFLN；CDR2：YTSRLHS；CDR3：QQGNALPPT。

Antibody 3 (corresponding hybridoma cell line No. A503)

VH CDR1：GFIFSDY；CDR2：SNGGGN；CDR3：LYYDDDEKRAVYWYFDV

VL CDR1：KASQDINKYLA；CDR2：YTSTLQP；CDR3：LQYDRVTWT。

The fourth antibody (corresponding to hybridoma cell strain number F6C4, preservation number CGMCC NO. 45301)

VH CDR1：GYTFTNY；CDR2：NTYSGE；CDR3：EGNFDY

VL CDR1：KASQDVSTAVA；CDR2：SASYRFS；CDR3：QQHYTTPFT。

Antibody 5 (corresponding hybridoma cell line No. A505)

VH CDR1：GYTFTGS；CDR2：NPGSDY；CDR3：ERGLPNYYGMDS

VL CDR1：KASQNVGTYVA；CDR2：SASYRHS；CDR3：QQYDSYPYT。

Antibody 6 (corresponding hybridoma cell line No. A506)

VH CDR1：GFIFSDY；CDR2：SNGGGN；CDR3：LYYDDDEKRAVYWYFDY

VL CDR1：KASQDINNYIA；CDR2：YTSTLQP；CDR3：LQYDSVTWT。

In one embodiment, the antibody in the blocking agent provided herein can be a recombinant antibody, and methods of producing a recombinant antibody are provided that include culturing a chinese hamster ovary cell line that secretes an antibody of the invention. Expression using a host cell is a preferred method of producing the antibody of the invention, the host cell being transfected with one or more expression vectors encoding the heavy and light chains by standard techniques, by eukaryotic expression vectors. Such transfection includes a wide variety of techniques for introducing foreign DNA into eukaryotic host cells, e.g., electroporation, calcium phosphate precipitation, DEAE dextran transfection, and the like.

Vectors carrying antibody genes can be transiently transfected, e.g., 293 cells, or can be stably transfected into host cells for antibody production. The host cell is preferably a mammalian host cell line, and preferred mammalian host cell lines for expression of the recombinant antibodies of the invention include Chinese Hamster Ovary (CHO) cells, NSO myeloma cells, COS cells, and SP2 cells. After the recombinant expression vector encoding the antibody gene is introduced into the mammalian host cell, the host cell needs to be cultured for a sufficient period of time to produce the antibody, or more preferably, the antibody is secreted into the medium in which the host cell is grown so that the antibody can be recovered from the medium using standard protein purification methods.

Host cells may also be used to produce functional antibody fragments, such as Fab fragments or scFv molecules. Such variations are also included within the scope of the present invention. Recombinant antibodies can be constructed using some or all of the DNA encoding either or both of the light and/or heavy chains of the antibodies of the invention, as well as using the CDRs of the invention and the universal Framework Regions (FRs) and/or the more stable light and/or heavy chain constant regions.

In certain embodiments, the antibody comprises a heavy chain constant region, e.g., an IgG1, igG2, igG3, igG4, igA, igE, igM, or IgD constant region, preferably the heavy chain constant region is the heavy chain constant region of IgG 1. Further, the antibody may comprise a light chain constant region, a kappa light chain constant region or a lambda light chain constant region. Alternatively, the antibody portion may be, for example, a Fab fragment or a single chain Fv fragment.

In a preferred embodiment, the recombinant antibody is constructed using the pcdna3.1 vector, the variable regions of the light and heavy chains of the antibody are introduced into the vector via a multiple cloning site and expressed under the control of the CMV promoter, in a preferred embodiment, the host cell is a CHO cell, and the transfection is preferably electroporation.

The CDR and FR in the light chain variable region and heavy chain variable region are formed in a mode of 'FR 1-CDR1-FR2-CDR2-FR3-CDR3-FR 4', the FR region is a part of non-CDR in the variable region, the amino acid composition and arrangement change is relatively less, the FR regions of the 6 antibodies have consistent sequences, and the light chain and heavy chain FR1-FR4 are consistent with the framework regions of the light chain and heavy chain FR1-FR4 of the monoclonal antibody secreted by the deposited strain D1F3.

In a preferred embodiment, the recombinant antibody has CDR sequences identical to the corresponding monoclonal antibody.

In a preferred embodiment, recombinant antibody 1 has CDR sequences identical to monoclonal antibody D1F 3; in a preferred embodiment, recombinant antibody 1 further has heavy and light chain variable region sequences identical to monoclonal antibody D1F3, and in a preferred embodiment, recombinant antibody 1 further has heavy and light chain constant region sequences identical to monoclonal antibody D1F3.

In a preferred embodiment, recombinant antibody 2 has the same CDR sequences as monoclonal antibody a 504; in a preferred embodiment, recombinant antibody 2 may have FR sequences identical to those of the heavy chain variable region sequence and the light chain variable region sequence of monoclonal antibody D1F3, except for the CDR sequences, and in a preferred embodiment, recombinant antibody 2 further has heavy chain constant region sequences and light chain constant region sequences identical to those of monoclonal antibody D1F3.

In a preferred embodiment, recombinant antibody 3 has the same CDR sequences as monoclonal antibody a 503; in a preferred embodiment, recombinant antibody 3 may have FR sequences identical to those of the heavy chain variable region sequence and the light chain variable region sequence of monoclonal antibody D1F3, except for the CDR sequences, and in a preferred embodiment, recombinant antibody 3 further has heavy chain constant region sequences and light chain constant region sequences identical to those of monoclonal antibody D1F3.

In a preferred embodiment, recombinant antibody 4 has the same CDR sequences as monoclonal antibody F6C 4; in a preferred embodiment, recombinant antibody 4 may have FR sequences identical to those of the heavy chain variable region sequence and the light chain variable region sequence of monoclonal antibody D1F3, except for the CDR sequences, and in a preferred embodiment, recombinant antibody 4 further has heavy chain constant region sequences and light chain constant region sequences identical to those of monoclonal antibody D1F3.

In a preferred embodiment, recombinant antibody 5 has the same CDR sequences as monoclonal antibody a 505; in a preferred embodiment, recombinant antibody 5 may have FR sequences identical to those of the heavy chain variable region sequence and the light chain variable region sequence of monoclonal antibody D1F3, except for the CDR sequences, and in a preferred embodiment, recombinant antibody 5 further has heavy chain constant region sequences and light chain constant region sequences identical to those of monoclonal antibody D1F3.

In a preferred embodiment, recombinant antibody 6 has the same CDR sequences as monoclonal antibody a506; in a preferred embodiment, recombinant antibody 6 may have FR sequences identical to those of the heavy chain variable region sequence and the light chain variable region sequence of monoclonal antibody D1F3, except for the CDR sequences, and in a preferred embodiment, recombinant antibody 6 further has heavy chain constant region sequences and light chain constant region sequences identical to those of monoclonal antibody D1F3.

In a preferred embodiment, the cell supernatant is treated with protein A affinity chromatography column and purified to obtain the recombinant antibody. The recombinant antibody has high batch consistency, is easy and stable to produce, and shows better blocking effect and stability compared with the monoclonal antibody. In one example, the blocking efficiency of recombinant antibodies with the same CDRs was compared to monoclonal antibodies at the same concentrations used for the same false positive samples. Blocking efficiency refers to the percentage of reduction in T/C value for the same sample in the test group with added blocking agent compared to the control without blocking agent, and is calculated as (control T/C value-test group T/C value) × 100%/control T/C value. The monoclonal antibody is secreted by six hybridoma cell strains D1F3, F6C4, A503, A504, A505 and A506 prepared by the application; the recombinant antibody is a monoclonal antibody which has the same CDR with the monoclonal antibody, is recombined and constructed to CHO host cells and is secreted by the CHO cells.

In one example, the stability of recombinant antibodies was evaluated. The activity of the antibody is influenced by high temperature and repeated freezing and thawing, and the stability of the activity of the antibody determines the stability of the immunoassay. The antibody blocking agent is subjected to thermal stability and repeated freeze-thaw treatment, and the blocking performance of the antibody blocking agent is verified through experiments to verify the stability of the effect of the antibody blocking agent, so that the antibody blocking agent meets the performance requirements of the raw materials of the detection reagent.

In one embodiment, the thermostability test condition is that the recombinant antibody is placed at 37 ℃ for 7 days, or 45 ℃ for 3 days, and then tested for the change in blocking efficiency on a false positive sample.

In one embodiment, the repeated freezing and thawing examination condition is that the recombinant antibody is repeatedly frozen and thawed 5 times, or repeatedly frozen and thawed 10 times, and then tested for the change of the blocking efficiency of 4 false positive samples.

In some embodiments, the efficiency of blocking a false positive sample is tested by treating the chromatographic strip sample pad with 0.1mg/mL of recombinant antibody blocking agent. In some embodiments, 0.2mg/mL of recombinant antibody blocking agent is used to treat the chromatographic strip sample pad.

In one example, six recombinant antibodies were tested for blocking efficiency on ten false positive samples. In some samples, the blocking efficiency of a single antibody blocking agent can reach 94.25%, but in some samples with particularly strong interference, the blocking efficiency is low, and even in individual samples, the blocking agent does not show a blocking effect. The incidence of heterophilic interference in clinical samples is high, the interference degree of different samples is different due to the complexity of sample sources, and even if the interference degree of the same patient sample is different along with the sampling time, the interference degree is different, and the interference degree is used in different ways.

In some embodiments, two recombinant antibody blockers are combined and tested for their blocking efficiency. In some embodiments, one or both recombinant antibodies are used at a concentration of 0.1-0.4mg/mL, in some embodiments, one or both recombinant antibodies are used at a concentration of 0.1mg/mL, in some embodiments, one or both recombinant antibodies are used at a concentration of 0.2mg/mL, in some embodiments, one or both recombinant antibodies are used at a concentration of 0.3mg/mL, and in some embodiments, one or both recombinant antibodies are used at a concentration of 0.4mg/mL.

In a preferred embodiment, recombinant antibody 1 (corresponding to the first antibody) and recombinant antibody 4 (corresponding to the fourth antibody) are combined, and further, recombinant antibodies 1 and 4 are used at a concentration of 0.1-0.2mg/mL. In a preferred embodiment, recombinant antibody 1 and recombinant antibody 4 are both used at a concentration of 0.1mg/mL, and in one embodiment, recombinant antibody 1 and recombinant antibody 4 are both used at a concentration of 0.2mg/mL.

In a preferred embodiment, recombinant antibody 1 (corresponding to the first antibody) and recombinant antibody 2 (corresponding to the second antibody) are combined, and further, recombinant antibodies 1 and 2 are used at a concentration of 0.1-0.2mg/mL. In a preferred embodiment, recombinant antibody 1 and recombinant antibody 2 are both used at a concentration of 0.1mg/mL, and in one embodiment, recombinant antibody 1 and recombinant antibody 2 are both used at a concentration of 0.2mg/mL.

In a preferred embodiment, recombinant antibody 2 (corresponding to the second antibody) and recombinant antibody 4 (corresponding to the fourth antibody) are combined, and further, recombinant antibodies 2 and 4 are used at a concentration of 0.1-0.2mg/mL. In a preferred embodiment, recombinant antibody 2 and recombinant antibody 4 are both used at a concentration of 0.1mg/mL, and in one embodiment, recombinant antibody 2 and recombinant antibody 4 are both used at a concentration of 0.2mg/mL.

In some embodiments, higher concentrations of recombinant antibody blocking agent are used. It will be appreciated that those embodiments where the blocking efficiency is high and low concentrations are used are preferred, but in those embodiments where increasing the concentration of the particular recombinant antibody blocking agent used also achieves high blocking efficiency.

In a preferred embodiment, recombinant antibody 1 and recombinant antibody 4 are each diluted to a final concentration of 0.2mg/mL with 10mM, pH7.4 PBS buffer, and the sample pad is treated with both recombinant antibody blockers together, i.e., the final treated sample pad has an antibody blocker concentration of 0.4mg/mL. And assembling a detection test paper strip by using the sample pad, and detecting 21 false positive samples.

In yet another preferred embodiment, the recombinant antibody 1 and the recombinant antibody 2 are diluted to respective final concentrations of 0.2mg/mL with 10mM, pH7.4 PBS buffer, respectively, and the sample pad is treated with both recombinant antibody blockers together, i.e., the final treated sample pad has an antibody blocker concentration of 0.4mg/mL. And assembling a detection test paper strip by using the sample pad, and detecting 21 false positive samples.

In yet another preferred embodiment, the recombinant antibody 2 and the recombinant antibody 4 are each diluted with PBS buffer to a respective final concentration of 0.2mg/mL, and the sample pad is treated with both recombinant antibodies together, i.e., the final treated sample pad has an antibody blocking agent concentration of 0.4mg/mL. And assembling a detection test paper strip by using the sample pad, and detecting 21 false positive samples.

The embodiment of the application also provides an in vitro immunodiagnostic product, which comprises the blocking agent, wherein the blocking agent comprises at least one of the first antibody to the sixth antibody, the blocking agent has the effect of reducing or eliminating the influence of endogenous interfering substances on immunodetection, and the in vitro immunodiagnostic product using the blocking agent has low use concentration and good stability, so that the in vitro immunodiagnostic product using the blocking agent can perform in vitro detection more accurately at low cost.

In one embodiment, the antibody blocking agent is added to the sample dilution, and in another embodiment, the antibody blocking agent is added to the sample pad and dried for use.

In one embodiment, the in vitro immunodiagnostic product may be an N-terminal B-type natriuretic peptide (NT-proBNP) immunodiagnostic product, wherein the antibody blocking agent is used for NT-proBNP immunofluorescence detection.

In another embodiment, the in vitro immunodiagnostic product may be a cardiac troponin I (cTnI) immunodiagnostic product, wherein the antibody blocking agent is for cTnI immunofluorescence detection.

In immunodiagnostic assays, the solid phase used may be porous and non-porous materials, latex particles, magnetic particles, and the like.

The assays and kits of the present application can be used in point of care testing (POCT), or electrochemical immunoassay systems. Any of the exemplary formats of the present application and assays or kits according to the present application can be used and optimized in automated and semi-automated systems.

Finally, the embodiment of the present application also provides an application, namely the application of the blocking agent in the embodiment of the present application in the preparation of in vitro immunodiagnostic products. According to the blocking agent provided by the embodiment of the application, the first antibody to the sixth antibody have a good blocking effect on endogenous interference, false positive or false negative results of immunodetection caused by human endogenous interference substances can be effectively reduced, and the blocking agent is low in use concentration and good in stability, so that the blocking agent can be used for preparing in-vitro immunodiagnosis products such as in-vitro immunodiagnosis kits, and can realize low cost and more accurate detection.

The following examples will help to understand the present invention more clearly, and are for illustrative purposes only and should not be construed as limiting the scope of the present application.

EXAMPLE 1 preparation of monoclonal antibodies

1. Screening for false positive samples

A nitrocellulose membrane (NC membrane) and a labeled fluorescent microsphere are respectively coated with a mouse IgG antibody, a double-antibody sandwich method terminal reagent is simulated, a fluorescent immunochromatography product is prepared, clinical random samples are screened, and clinical samples containing components capable of being combined with the mouse IgG antibody are selected.

1.1 labeling fluorescent microspheres: according to the process for labeling fluorescent microspheres (Bangs laboratories, FCEU 002), 0.1M, pH 6.0.0 of 4-morpholine ethanesulfonic acid (MES) buffer solution is used, after activation, the fluorescent microspheres are coupled with mouse IgG antibody (Gu Shengwu BLOCK-3), 100ug of mouse IgG antibody is coupled with each mg of fluorescent microspheres, the fluorescent microspheres are sealed by bovine serum albumin, stored in the MES buffer solution and freeze-dried for later use;

1.2 coating NC film: a mouse IgG antibody was diluted to a final concentration of 1.0mg/ml with 10mM PBS buffer, pH7.4, 2% sucrose, and then coated on an NC membrane of Sadolis 140 as a test line (T line), a goat anti-mouse antibody was diluted to a final concentration of 1.0mg/ml as a quality control line (C line), and the test line was sealed at 37 ℃ overnight for use.

1.3 sample pad preparation: treating the sample pad with 10mM PBS buffer, pH7.4, and freeze-drying for later use;

1.4 Assembly test: the labeled fluorescent microspheres (with the use concentration of 0.35 mg/ml), the coated NC membrane and the sample pad are assembled into double-antibody sandwich fluorescence immunochromatography rapid test cards, 80ul of clinical random samples are added into each test card, and after the test cards are placed at room temperature for 15 minutes, the ratio of a T-line signal to a C-line signal (T/C value) is measured by using a fluorimeter.

When the sample does not contain false positive components, the T value is very low and is a background value, most of the mouse IgG antibody marked with the fluorescent microspheres is bound to the C line, and the T/C value approaches 0. If the sample contains false positive components, the fluorescent microsphere-labeled mouse IgG-false positive component complex binds to the T line, and the remaining labeled fluorescent microsphere mouse IgG binds to the C line, with the T/C value being proportional to the concentration of the mouse IgG antibody-binding component in the clinically randomized sample. In the clinical random samples, the components capable of binding to the mouse IgG antibody were low, and in this example, false positive samples were selected based on the criterion that the T/C value was greater than 0.1.

319 clinical random samples were screened, 12 samples with a T/C value greater than 0.1 were selected as false positive samples, the sample numbers were recorded as samples 1-12, and the false positive samples are shown in Table 1 below.

TABLE 1

2. Purification of the major component of false positive samples

Preparing a mouse IgG antibody column, wherein a matrix filler is hydrogen bromide activated sepharose gel (CNBr-4 FF), 3 screened false positive serum samples (sample numbers are 1/2/5) are mixed to obtain 10ml of false positive serum samples, after the 3 ml of false positive serum samples are dialyzed by PBS buffer solution with the concentration of 10mM and the pH value of 7.4, the false positive serum samples are separated and eluted through the mouse IgG antibody column, the eluent is 0.2M, pH 2.7.7 Tris-glycine, and finally, a component which can be combined with the mouse IgG antibody in the false positive samples is obtained, and the component is a main component for causing false positive in immunoassay. After the total concentration of the purified protein was measured by BCA method, it was concentrated to 500ug/ml by ultrafiltration.

3. Preparation of immunized mice

And (4) immunizing a mouse by taking the main component of the false positive sample obtained by purification as an immunogen. The mice were 7-10 weeks old, female BALB/c mice. The immunization was performed 4 times, each time at 2 weeks intervals, at an immunization dose of 20. Mu.g/mouse. The primary immunization was performed by mixing the primary false positive sample component with Freund's complete adjuvant (Sigma-Aldrich) in equal volume, and injecting subcutaneously into the back at multiple points, and the secondary immunization was performed by mixing the primary false positive sample component with Freund's incomplete adjuvant (Sigma-Aldrich) in equal volume, and injecting intraperitoneally. And (3) cutting off the tail and collecting blood 7 days after the fourth immunization of the mouse, separating serum, detecting the antibody titer level of the antiserum of the immunized mouse by adopting an indirect ELISA method to observe the immune response effect, and selecting a serum antibody titer higher than 1:10000 mice were subjected to cell fusion experiments, 3 days before which they were boosted intraperitoneally (20. Mu.g/mouse) with the main component of a false positive sample without adjuvant.

4. Establishment and screening of hybridoma cells

4.1 establishment of hybridoma cells

On the day of cell fusion with immunized mice, spleens from immunized mice were removed under sterile conditions and the organs were made into single cell suspensions. Taking mouse myeloma cells (SP 2/0) and the spleen cells of the immunized BALB/c mice according to the ratio of 1:5, mixed well and washed twice before being fused with PEG. Add pre-warmed PEG1500, gently shake, wash cells with pre-warmed serum-free RPMI-1640 medium, and re-suspend cells with HAT selective medium. Plating the cell suspension into 96-well culture plates at 200ul per well and 5% CO at 37 ℃% ₂ Culturing the cells under conditions. After 4-7 days of culture, the cells are cultured by using HT medium, and when the fused cells grow to 1/10-1/5 of the bottom area of the hole of the 96-hole plate, the supernatant is taken for antibody detection.

4.2 screening of Positive hybridoma cells

Diluting the main component of the false positive sample with coating buffer solution (PBS buffer solution of 0.05mol/L, pH 9.6.6) to obtain a final concentration of 1 μ g/ml, adding the diluted sample into a 96-well plate in an amount of 100 μ l/well, coating overnight at 4 ℃, removing the coating solution, washing with phosphate buffer saline solution PBST for 3 times, and patting dry; sealing with 3% skimmed milk-containing PBST, incubating at 150 μ L/well for 2h at 37 deg.C, washing with PBST for 3 times, and drying; the fusion cell supernatant, 1 diluted immune mouse positive serum and 1 diluted 1000 mouse negative serum were added to the corresponding wells at 100 μ L/well, incubated at 37 ℃ for 1h, washed 3 times with pbst, patted dry; add 1; adding 3,3',5,5' -tetramethyl benzidine (TMB) substrate, 100 μ L/hole, and developing for 10min at room temperature in dark place; the reaction was stopped by adding 50. Mu.L of 2mol/L sulfuric acid per well.

In microplate reader 450 _nm At wavelength, detecting all the wells OD of the ELISA plate _450nm A value; OD of negative serum _450nm The value is less than or equal to 0.1 to determine the OD of the well _450nm Value greater than negative well OD _450nm The value more than 2.1 times is positive as a judgment standard, and positive hybridoma cells are obtained so as to carry out the next cloning.

4.3 cloning of Positive hybridoma cells

Sampling and counting antibody-secreting positive hybridoma cell wells, diluting to 100 cells/10 mL of culture medium, adding the diluted cell suspension to a 96-well cell culture plate at 100. Mu.L per well, and 5% CO at 37 ℃% ₂ Culturing in a cell culture box. After 6-7 days, the formation of clonal cells was observed microscopically, and a single long hole of Long Sheng was marked, and the cell supernatant was removed and subjected to ELISA test (the same as the above cell fusion test) to select positive monoclonal cells.

Limiting dilution is carried out on positive hole cells, ELISA values are measured 5-6 days after each limiting dilution, and ELISA OD is selected for detection _450nm And (4) carrying out limited dilution on the monoclonal wells with higher positive values until the whole plate result of the 96-well plate is positive by ELISA (enzyme-Linked immunosorbent assay). The monoclonal fixed strain with high positive value is picked to obtain about 50 cell strains which stably secrete main components of the anti-false positive sample.

5. Preparation and purification of antibodies

Preparing and purifying cell supernatant monoclonal antibody: the 50 hybridoma cell lines thus obtained were cultured in a T175 flask in serum-free RPMI-1640 medium for 1 to 2 weeks, and then the cell death rate was 80 to 90% (in this case, the cell density was 1 to 2X 10 ⁶ And each ml), collecting cell suspension, centrifuging at 6000rpm for 20min, collecting supernatant, and purifying the supernatant by Protein A immunochromatography. The final purified monoclonal antibody concentration was about 3-5mg/mL. The purified monoclonal antibody is subpackaged (100 uL/tube, concentration of 1 mg/ml) and stored at 4-8 ℃.

Example 2 evaluation of blocking Performance of monoclonal antibody:

and testing whether the obtained monoclonal antibody blocking agent can effectively block the false positive sample. The blocking efficiency test was performed using sample1 and the test samples, which were numbered 13-21.

In order to test the effect of the monoclonal antibody blocking agent, 4 parts of RF samples and 5 parts of HAMA samples are screened out from collected clinical Rheumatoid Factor (RF) samples (the RF value is more than 300 IU/ml) and heterophilic HAMA samples according to a method for screening false positive samples, the samples are taken as test samples and are marked as samples 13-21, and the blocking performance of the monoclonal antibody is evaluated. In order to evaluate the blocking effect, the invention selects a sample with the T/C value larger than 0.5 as a test sample. Where samples 15, 16, 17, and 21 are RF samples and samples 13, 14, 18, 19, and 20 are HAMA samples.

A fluorescence immunochromatographic rapid assay product was prepared in the same manner as in "screening of false positive specimen" in example 1, wherein the sample pad was treated with different monoclonal antibodies, specifically, the sample pad was treated with a blocking agent by diluting the different monoclonal antibodies to 0.1mg/ml using a PBS buffer solution of 10mM, pH7.4, and lyophilized for use, at which concentration the amount of the monoclonal antibody blocking agent used per sample pad of the test card was 4.67ug.

Assembling and testing: the marked fluorescent microspheres, the coated NC membrane and the processed sample pad are assembled into an immunofluorescence chromatography rapid test card, samples 1-21 are tested, 80ul of sample is added into each test card, after the test card is placed at room temperature for 15 minutes, a fluorimeter is used for measuring and judging results, the ratio (T/C) of T-line signals and C-line signals is read, and the sample pad treated by PBS buffer solution with the concentration of 10mM and the pH value of 7.4 is used as a control to test the false positive eliminating effect of the monoclonal antibody on the samples.

FIG. 1 shows the blocking effect of 6 monoclonal antibodies on four false positive samples (Sample 13, sample14, sample15, and Sample16 in the figure represent Sample13, sample14, sample15, and Sample16, respectively), plotted with the T/C value as the vertical axis, and compared with the results of the test using the monoclonal antibody-treated Sample pad and the PBS-treated Sample pad (control). Compared with a control, the 6 monoclonal antibodies can obviously reduce the T/C value of a false positive sample, which shows that the 6 monoclonal antibodies have blocking effect on the false positive sample.

The 6 monoclonal antibodies also have obvious blocking effect on other false positive samples, and the blocking efficiency is different from 30 to 90 percent.

The 6 monoclonal antibodies were: D1F3, F6C4, A503, A504, A505 and A506, and the corresponding hybridoma cell line numbers are respectively as follows: D1F3, F6C4, a503, a504, a505, a506.

EXAMPLE 3 cloning and sequencing of variable region sequences of monoclonal antibodies

Total RNA was isolated from the six hybridoma cell lines, cDNA was prepared by reverse transcription to clone an immunoglobulin sequence from the hybridoma cell lines, and the antibody variable region sequence of the hybridoma cell lines was determined.

1, RNA extraction: extracting total RNA of the hybridoma cell strain according to the instruction of a cell total RNA M5 extraction kit (purchased from Beijing polymerAmerican Biotechnology Co., ltd.);

reverse transcription of RNA into cDNA: performing reverse transcription on the total RNA extracted in the previous step by referring to M5 First Strand cDNA Synthesis Kit (purchased from Beijing Polymer science and technology Co., ltd.) to obtain cDNA, and freezing and storing at-20 deg.C for later use;

3. PCR amplification and recovery of variable region sequences: amplifying immunoglobulin heavy chain (IgH) cDNA by PCR using the cDNA obtained in the above step as a template and using a universal heavy chain primer such as MulgVH5'-A and MulgGVH3' -2; similarly, immunoglobulin light chain (IgK) cDNA was amplified by PCR using universal light chain primers, such as MuIg κ VL5'-a and MuIg κ VL3' -1, and the PCR products were recovered; the PCR reaction was carried out using thermostable PfuDNA polymerase throughout.

MulgVH5’-A(GGGAATTCATGRASTTSKGGYTMARCTKGRTTT；SEQ ID NO.37)

MulgGVH3’-2(CCCAAGCTTCCAGGGRCCARKGGATARACNGRTGG；SEQ ID NO.38)

MuIgκVL5'-A(GGGAATTCATGRAGWCACAKWCYCAGGTCTTT；SEQ ID NO.39)

MuIgκVL3'-1(CCCAAGCTTACTGGATGGTGGGAAGATGGA；SEQ ID NO.40)

4. Cloning and sequencing of variable region sequences: according to the instructions of the Cloning vector pTOPO-Blunt Cloning kit (available from Beijing Convergence technologies, inc.), the heavy chain and light chain variable region genes were ligated to pTOPO vector, respectively, to transform E.coli DH 5. Alpha. And positive clones were picked up and subjected to sequencing by Beijing Rui Boxing, biotech, inc. The sequences of the antibody heavy chain variable region gene and the light chain variable region gene of the hybridoma cell strain are obtained by sequencing and analyzed, and the sequences of the complementarity determining regions of the heavy chain and the complementarity determining regions of the light chain are shown as follows.

Antibody 1 (corresponding hybridoma cell line number: D1F 3)

VH CDR1：GFTFSSF；CDR2：SSGSSI；CDR3：WDGNSFAY

VL CDR1：SASQGISNFLN；CDR2：YTSSLHS；CDR3：QQYSKLPYT。

Antibody 2 (corresponding hybridoma cell line number: A504)

VH CDR1：GFTFSNY；CDR2：TSGGLY；CDR3：HYTTATFDF

VL CDR1：RTSQDISNFLN；CDR2：YTSRLHS；CDR3：QQGNALPPT。

Antibody 3 (corresponding hybridoma cell line number: A503)

VH CDR1：GFIFSDY；CDR2：SNGGGN；CDR3：LYYDDDEKRAVYWYFDV

VL CDR1：KASQDINKYLA；CDR2：YTSTLQP；CDR3：LQYDRVTWT。

Antibody 4 (corresponding hybridoma cell line number: F6C 4)

VH CDR1：GYTFTNY；CDR2：NTYSGE；CDR3：EGNFDY

VL CDR1：KASQDVSTAVA；CDR2：SASYRFS；CDR3：QQHYTTPFT。

Antibody 5 (corresponding hybridoma cell line No. A505)

VH CDR1：GYTFTGS；CDR2：NPGSDY；CDR3：ERGLPNYYGMDS

VL CDR1：KASQNVGTYVA；CDR2：SASYRHS；CDR3：QQYDSYPYT。

Antibody 6 (corresponding hybridoma cell line No. A506)

VH CDR1：GFIFSDY；CDR2：SNGGGN；CDR3：LYYDDDEKRAVYWYFDY

VL CDR1：KASQDINNYIA；CDR2：YTSTLQP；CDR3：LQYDSVTWT。

EXAMPLE 4 preparation of blockers of recombinant antibodies

Constructing a recombinant antibody, preparing a cell strain for stably expressing the antibody through eukaryotic expression, and culturing and purifying the cell strain on a large scale:

the variable region genes (VH and VL) of heavy chain and light chain of the monoclonal antibody D1F3 are amplified by an RT-PCR method, and the sequence is determined by sequencing. VL and VH genes of the antibody were constructed on pCDNA3.1 vector. Electrically transducing the heavy chain and light chain gene expression plasmid of the antibody into CHO host cells, adding the CHO host cells into a pressure screening culture medium (50 uM MSX) after electric transduction, culturing for 20 days, taking the supernatant, carrying out ELISA detection (using horseradish peroxidase (HRP) to mark goat anti-mouse IgG as a secondary antibody for screening, and screening out a recombinant antibody cell strain with stable expression.

And (3) carrying out large-scale cell culture on the screened stably transformed recombinant antibody cell strains by adopting a cell roller bottle culture technology to prepare the recombinant antibody. Cells were plated at (0.2-0.3) x10 with medium (Vega CHO) ⁶ cells/ml were inoculated into roller bottles containing 300ml of medium (Vega CHO) in 1L roller bottles, the number of which was determined according to the production requirements, and the roller bottles inoculated with cells were placed in a cell spinner and cultured in a cell incubator. The culture conditions were 900 rpm, the temperature was 37 ℃ and the carbon dioxide was 5%. And (4) after culturing for 7-9 days, sampling under a microscope, observing, and centrifuging to collect samples when the cell viability is less than 50%. And (3) carrying out affinity purification on the sample by using a protein A affinity chromatographic column to obtain an antibody, namely the recombinant antibody.

Example 5 test of blocking Effect of recombinant antibodies on false Positive samples

Testing the blocking effect of different recombinant antibodies on false positive serum

A nitrocellulose membrane (NC membrane) and a labeled fluorescent microsphere were coated with a mouse IgG antibody, respectively. A mouse IgG antibody was diluted to a final concentration of 1.0mg/ml with 10mM PBS buffer, pH7.4, and 2% sucrose, and then coated on an NC membrane of Sadolis 140 as a test line (T line) and a goat anti-mouse antibody as a quality control line (C line), and sealed overnight at 37 ℃ for use. Sample pad preparation: treating the sample pad with 10mM PBS buffer solution with pH7.4 diluted to 0.1mg/mL as blocking agent, and lyophilizing with 10mM PBS buffer solution with pH7.4 as control; assembling and testing: and (3) assembling the marked fluorescent microspheres, the coated NC membrane and the sample pad into a double-antibody sandwich fluorescence immunochromatographic rapid test card, adding 80ul of sample into each test card, standing at room temperature for 15 minutes, and then measuring the ratio of the T-line signal to the C-line signal (T/C value) by using a fluorimeter.

Recombinant antibody 1 has the same CDRs as antibody 1 (D1F 3), recombinant antibody 2 has the same CDRs as antibody 2 (a 504), recombinant antibody 3 has the same CDRs as antibody 3 (a 503), recombinant antibody 4 has the same CDRs as antibody 4 (F6C 4), recombinant antibody 5 has the same CDRs as antibody 5 (a 505), and recombinant antibody 6 has the same CDRs as antibody 6 (a 506).

And assembling an immunofluorescence chromatography rapid test card, testing the samples 1-21, and testing the false positive elimination effect of each recombinant antibody on the samples. The recombinant antibody blocking agents were 0.1mg/mL, 80ul of the false anode sample was added for each test, and after 15 minutes at room temperature, the results were measured and judged using a fluorometer, with a 10mM, pH7.4 PBS buffer treated sample pad as a control.

Recombinant antibodies with the same CDRs had similar or slightly better blocking effects than monoclonal antibodies at the same concentrations. FIG. 2 shows the blocking effect of monoclonal antibody D1F3 (i.e., antibody 1 of example 3) and recombinant antibody D1F3 (i.e., recombinant antibody 1 of example 5) in four of the false positive samples. In sample1, the blocking efficiency of the recombinant antibody is greatly improved compared with that of the monoclonal antibody. In the other three samples, the blocking efficiency of the recombinant antibody D1F3 was slightly higher than that of the monoclonal antibody D1F3.

In addition, the recombinant antibody D1F3 showed similar blocking effects in other false positive samples, either HAMA samples or RF samples, compared to the monoclonal antibody D1F3, and the blocking efficiency data are shown in table 2.

TABLE 2

False positive sample	Monoclonal antibody D1F3	Recombinant antibody D1F3
			13	94.25％	96.27％
14	74.45％	85.58％
			15	43.89％	54.27％
16	78.94％	80.13％
			17	43.45％	48.92％
18	51.14％	53.71％
			19	63.67％	65.33％
20	78.74％	81.41％
			21	71.64％	75.95％
1	39.21％	67.49％

The other five recombinant antibodies, which were also compared with the monoclonal antibody having the same CDR, showed similar or better blocking effect. Among them, recombinant antibody 1 and recombinant antibody 4 showed the best blocking efficiency, followed by recombinant antibody 2.

Example 6 evaluation of blocking efficiency of recombinant antibody

The blocking efficiency of the 6 recombinant antibodies against ten false positive samples at the applied concentration of 0.1mg/mL is shown in table 3 below:

TABLE 3

As shown in the above table, in some samples, the blocking efficiency of a single recombinant antibody blocking agent can reach 96.27%, but in some samples with particularly strong interference, the blocking efficiency is low, and even in individual samples, the blocking agent does not show blocking effect. The incidence rate of heterophilic interference in clinical samples is high, due to the complexity of sample sources, the interference degrees of different samples are different, even if the interference degree of the same patient sample is different along with the sampling time, the interference degrees are used differently, in order to obtain a blocking agent which can be more universal, the combination of the blocking agents is optimized, and some blocking agents are selected for combined use, so that the blocking efficiency and universality of the blocking agent are further improved.

Example 7 optimization of recombinant antibodies as blockers

The recombinant antibody 1, the recombinant antibody 2 and the recombinant antibody 4 are combined in pairs (as shown in the following conditions 1, 2 and 3), the combined effect of the combination as a blocking agent on false positive is tested, the dosage of the recombinant antibody of the blocking agent is adjusted, and the combined effect is tested.

Condition 1: recombinant antibody 1 and recombinant antibody 4 were treated together with the sample pad diluted to respective final concentrations of 0.2mg/mL with 10mM PBS buffer, pH7.4, i.e. the final treated sample pad concentration was 0.4mg/mL (18.68 ug total of blocking agents);

condition 2: recombinant antibody 1 and recombinant antibody 2 were treated together with the sample pad diluted to respective final concentrations of 0.2mg/mL with 10mM PBS buffer, pH7.4, i.e. the final treated sample pad concentration was 0.4mg/mL (total of blockers was 18.68 ug);

condition 3: the sample pads were treated together with recombinant antibody 2 and recombinant antibody 4, respectively, diluted to respective final concentrations of 0.2mg/mL with 10mM, pH7.4 PBS buffer, i.e., the final treated sample pad had a concentration of 0.4mg/mL (18.68 ug total of blocking agent).

The blocking agent is tested on 21 false positive samples, if the T/C value is reduced to 0.1 or below as the standard for eliminating the false positive, 18 false positives can be eliminated under the condition 1, 16 false positives can be eliminated under the condition 2, 16 false positives can be eliminated under the condition 3, and the blocking effect of the condition 1 is optimal, and specific data are shown in a table 4.

TABLE 4

Sample numbering	-	1	2	3	4	5	6	7	8	9	10
												Control	T/C	4.15	0.83	0.29	0.45	0.49	0.10	0.26	0.10	0.13	0.62
Condition 1	T/C	0.08	0.03	0.02	0.03	0.02	0.02	0.02	0.02	0.02	0.02
												Condition 2	T/C	0.11	0.03	0.02	0.02	0.02	0.02	0.02	0.02	0.02	0.02
Condition 3	T/C	0.06	0.02	0.02	0.02	0.02	0.02	0.03	0.02	0.03	0.02
												Sample numbering	11	12	13	14	15	16	17	18	19	20	21
Control	0.12	0.14	10.83	6.97	10.30	10.95	5.52	9.04	1.05	0.59	11.16
												Condition 1	0.03	0.02	0.03	0.02	0.05	0.03	0.12	0.12	0.05	0.03	0.11
Condition 2	0.03	0.02	0.03	0.02	0.39	0.13	0.38	0.14	0.06	0.03	0.07
												Condition 3	0.03	0.02	0.03	0.02	0.19	0.11	0.45	0.12	0.03	0.02	0.10

The blocking efficiency (percent reduction in T/C value) for 21 false positive samples compared to the T/C value for the control (no blocker added) under the three conditions described above is shown in Table 5 below.

TABLE 5

Example 8 blocker stability evaluation of recombinant antibody formation

Thermal stability assessment conditions: the recombinant antibody is placed at 37 ℃ for 7 days or 45 ℃ for 3 days, and the influence of the examination conditions on the blocking efficiency of 4 false positive samples is tested.

Repeated freeze-thaw assessment: and (3) repeatedly freezing and thawing the recombinant antibody for 5 times or repeatedly freezing and thawing for 10 times, and testing the influence of the examination conditions on the blocking efficiency of the 4 false positive samples.

When the sample1, the sample14, the sample16 and the sample 21 are used for testing, compared with an antibody blocking agent (control) which is not examined, the blocking efficiency of the blocking agent subjected to thermal stability examination and repeated freeze-thaw examination is similar and is not obviously reduced, and the recombinant antibody has better stability (see fig. 3).

A nitrocellulose membrane (NC membrane) and a labeled fluorescent microsphere were coated with a mouse IgG antibody, respectively. A mouse IgG antibody was diluted to a final concentration of 1.0mg/ml with 10mM PBS buffer, pH7.4, and 2% sucrose, and then coated on an NC membrane of Sadolis 140 as a test line (T line) and a goat anti-mouse antibody as a quality control line (C line), and sealed overnight at 37 ℃ for use. Sample pad preparation: preparing a sample pad for stability examination under the following conditions 4, 5, 6, 7and 8, wherein the recombinant antibody of condition 4 is not subjected to high temperature or freeze-thaw treatment as a control; assembling and testing: and (3) assembling the marked fluorescent microspheres, the coated NC membrane and the sample pad into double-antibody sandwich fluorescence immunochromatographic rapid test cards, adding 80ul of sample into each test card, standing at room temperature for 15 minutes, and then measuring the ratio of the T-line signal to the C-line signal (T/C value) by using a fluorimeter.

Condition 4: recombinant antibody 1 was stored at 4 ℃ for 7 days, then diluted with 10mM, pH7.4 PBS buffer to 0.1mg/mL treatment sample pad;

condition 5: recombinant antibody 1 was stored at 37 ℃ for 7 days, and then diluted to 0.1mg/mL in 10mM, pH7.4 PBS buffer to treat the sample pad;

condition 6: recombinant antibody 1 was stored at 45 ℃ for 3 days, and then diluted to 0.1mg/mL with 10mM, pH7.4 PBS buffer to treat the sample pad;

condition 7: recombinant antibody 1 was freeze-thawed 5 times and then diluted to 0.1mg/mL treatment sample pad with 10mM, pH7.4 PBS buffer;

condition 8: recombinant antibody 1 was freeze-thawed 10 times and then diluted to 0.1mg/mL treatment sample pad with 10mM, pH7.4 PBS buffer;

as shown in Table 6 and FIG. 3, the blocking effect of the recombinant antibody blocking agent treated under the evaluation conditions of 7 days at 37 ℃,3 days at 45 ℃,5 times of freeze thawing, 10 times of freeze thawing and the like on false positive was substantially consistent compared with the recombinant antibody blocking agent stored at 4 ℃. The data show that the blocking performance of the blocking agent after high-temperature storage and repeated freeze-thaw is basically consistent with that of a control, and the blocking agent has excellent stability.

TABLE 6

Example 9 application of blockers in NT-proBNP assay

And assembling the kit, namely coating the mouse anti-NT-proBNP monoclonal antibody on a nitrocellulose membrane detection line (T line) of the detection card and coating the goat anti-mouse IgG polyclonal antibody on a quality control line (C line) by using a double-antibody sandwich immunochromatography method. During detection, a sample and a diluent are uniformly mixed and then accurately added into a sample adding hole of a detection card, liquid is subjected to upward chromatography under a capillary effect, NT-proBNP antigen in the sample is combined with a mouse anti-NT-proBNP monoclonal antibody marked by a fluorescent microsphere in the chromatography process, a solid-phase mouse anti-NT-proBNP monoclonal antibody-NT-proBNP antigen-marked mouse anti-NT-proBNP monoclonal antibody-fluorescent microsphere particle compound is formed at a T line, and a solid-phase goat anti-mouse IgG polyclonal antibody-marked mouse anti-NT-proBNP monoclonal antibody-fluorescent microsphere particle compound is formed at a C line. The fluorescent microsphere particles emit visible light signals under exciting light, the ratio (T/C) of T line signals to C line signals is in direct proportion to the concentration value of NT-proBNP in a sample, the concentration of NT-proBNP in the sample is calculated through standard curve fitting of a fluorescence immunoassay analyzer, and the value can be directly read from a screen of the analyzer.

The kit sample pad was treated with the blockers of condition 1, condition 2 and condition 3 in example 7, and 500 clinical negative samples (samples verified to be negative by PCR) were each verified. The results show that: the blocker of the condition 1 detects 496 negative cases, and the specificity is 99.2%; 494 negative blocking agents are detected under the condition 2, and the specificity is 98.8%; the blocking agent of condition 3 detected 493 negative cases, and had a specificity of 98.6% (wherein, specificity = number of detected negative samples x 100%/number of detected samples).

Example 10 application of blockers to cTnI assay

The kit is assembled, a double-antibody sandwich immunochromatography method is used, a nitrocellulose membrane detection line (T line) of a detection card is coated with a mouse anti-cTnI monoclonal antibody, and a quality control line (C line) is coated with a goat anti-mouse IgG polyclonal antibody. During detection, a sample and a diluent are uniformly mixed and then accurately added into a detection card sample adding hole, liquid is subjected to upward chromatography under the capillary effect, a cTnI antigen in the sample is combined with a mouse anti-cTnI monoclonal antibody marked by a fluorescent microsphere in the chromatography process, a solid-phase mouse anti-cTnI monoclonal antibody-cTnI antigen-marked mouse anti-cTnI monoclonal antibody-fluorescent microsphere particle compound is formed at a T line, and a solid-phase goat anti-mouse IgG polyclonal antibody-marked mouse anti-cTnI monoclonal antibody-fluorescent microsphere particle compound is formed at a C line. The fluorescent microsphere particles emit visible light signals under exciting light, the ratio (T/C) of T line signals to C line signals is in direct proportion to the concentration value of cTnI in a sample, the concentration of cTnI in the sample is calculated through standard curve fitting of a fluorescence immunoassay analyzer, and the value can be directly read from a screen of the analyzer.

Kit sample pads were treated with the blockers of condition 1, condition 2 and condition 3 of example 7and 578 clinically negative samples (samples verified to be negative by PCR) were each verified. The results show that: the specificity of 573 cases negative to the blocker under condition 1 was 99.13%, the specificity of 570 cases negative to the blocker under condition 2 was 98.62%, and the specificity of 571 cases negative to the blocker under condition 3 was 98.79%.

In addition, six recombinant antibodies (recombinant antibody 1, recombinant antibody 2, recombinant antibody 3, recombinant antibody 4, recombinant antibody 5, recombinant antibody 6) were diluted to 0.1mg/ml with 10mM PBS buffer, pH7.4, as a blocking agent for the test of the chemiluminescence platform, and the results are shown in Table 7: through detection based on a HeavyBio Anti-cTnI antibody, the normal human serum cTnI is 20-130pg/ml, while the blocker has obvious blocking effect on false positive serum samples (four false positive samples: sample1, sample14, sample16 and sample 21), and the blocker can also eliminate false positive on a chemiluminescence platform.

TABLE 7

The above description is only exemplary of the present application and should not be taken as limiting the present application, as any modification, equivalent replacement, or improvement made within the spirit and principle of the present application should be included in the protection scope of the present application.

Claims (10)

1. A blocking agent, wherein the blocking agent comprises at least one of the following antibodies:

a first antibody, wherein three complementarity determining region sequences of a heavy chain variable region of the first antibody are shown in SEQ ID NO.1-3, and three complementarity determining region sequences of a light chain variable region of the first antibody are shown in SEQ ID NO. 4-6;

a second antibody, wherein the sequences of the three complementarity determining regions of the heavy chain variable region of the second antibody are shown in SEQ ID NO.7-9, and the sequences of the three complementarity determining regions of the light chain variable region of the second antibody are shown in SEQ ID NO. 10-12;

a third antibody, wherein the sequences of three complementarity determining regions of a heavy chain variable region of the third antibody are shown in SEQ ID NO.13-15, and the sequences of three complementarity determining regions of a light chain variable region of the third antibody are shown in SEQ ID NO. 16-18;

a fourth antibody, wherein the sequences of the three complementarity determining regions of the heavy chain variable region of the fourth antibody are shown in SEQ ID NO.19-21, and the sequences of the three complementarity determining regions of the light chain variable region of the fourth antibody are shown in SEQ ID NO. 22-24;

a fifth antibody, wherein the sequences of the three complementarity determining regions of the heavy chain variable region of the fifth antibody are shown in SEQ ID NO.25-27, and the sequences of the three complementarity determining regions of the light chain variable region of the fifth antibody are shown in SEQ ID NO. 28-30;

a sixth antibody, wherein the sequences of the three complementarity determining regions of the heavy chain variable region of the sixth antibody are shown in SEQ ID NO.31-33, and the sequences of the three complementarity determining regions of the light chain variable region of the sixth antibody are shown in SEQ ID NO. 34-36.

2. The blocking agent according to claim 1, wherein the blocking agent comprises at least two of the first, second, third, fourth, fifth and sixth antibodies, preferably the first and second antibodies; alternatively, the first and second electrodes may be,

the blocking agent preferably comprises the first antibody and the fourth antibody; alternatively, the first and second electrodes may be,

the blocking agent preferably comprises the second antibody and the fourth antibody.

3. The blocking agent according to claim 1, wherein each antibody is used in a concentration of 0.1 to 0.4mg/mL, preferably 0.1 to 0.2mg/mL, and more preferably 0.2mg/mL.

4. The blocking agent according to any one of claims 1 to 3, wherein the antibody in the blocking agent is a monoclonal antibody or a recombinant antibody.

5. A monoclonal cell strain having a accession number of CGMCC No.45250, which secretes the first antibody of the blocking agent of any one of claims 1 to 4.

6. A monoclonal cell strain characterized by having a accession number of CGMCC NO.45301, secreting the fourth antibody of the blocking agent of any one of claims 1 to 4.

7. An in vitro immunodiagnostic product comprising the blocking agent of any of claims 1 to 4.

8. The in vitro immunodiagnostic product of claim 7, wherein the in vitro immunodiagnostic product comprises an in vitro immunodiagnostic kit comprising the blocking agent.

9. The in vitro immunodiagnostic product of claim 7, wherein the in vitro immunodiagnostic product comprises at least one of an N-terminal B-type natriuretic peptide immunodiagnostic product and a cardiac troponin I immunodiagnostic product.

10. Use of a blocking agent according to any one of claims 1 to 4 for the preparation of an in vitro immunodiagnostic product.

Images