CN111269867B

CN111269867B - Gene engineering strain for directionally producing antiviral and antibacterial active compound and application thereof

Info

Publication number: CN111269867B
Application number: CN201911274866.0A
Authority: CN
Inventors: 鞠建华; 陈姜; 桂春; 李青连; 田新朋
Original assignee: South China Sea Institute of Oceanology of CAS
Current assignee: South China Sea Institute of Oceanology of CAS
Priority date: 2019-12-12
Filing date: 2019-12-12
Publication date: 2022-05-10
Anticipated expiration: 2039-12-12
Also published as: CN111269867A

Abstract

The invention discloses a genetic engineering strain for directionally producing antiviral and antibacterial active compounds and application thereof. The gene engineering strain is obtained by singly knocking out Pak13 gene, Pak15 gene, Pak20 gene, Pak31 gene or Pak38 gene in Streptomyces sp.SCSIO 01680 genome, and the nucleotide sequences of the Pak13 gene, the Pak15 gene, the Pak20 gene, the Pak31 gene and the Pak38 gene are respectively shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4 and SEQ ID No. 5. The genetic engineering strain capable of directionally producing the polyether compound with the antiviral and antibacterial activities, provided by the invention, can provide chemical entities for screening antiviral drugs and antibacterial drugs, and has important significance for developing Chinese marine drug resources.

Description

Gene engineering strain for directionally producing antiviral and antibacterial active compound and application thereof

Technical Field

The invention belongs to the field of microbial genetic engineering and metabolic engineering, and particularly relates to a genetic engineering strain for directionally producing polyether antibiotics with antiviral and antibacterial activities and application thereof.

Background

The ocean is the largest and most environment-complex ecosystem on the earth, the biomass in the ocean accounts for 87 percent of the total amount of the earth, and besides 500-5000 ten thousand marine organisms, more than 10 hundred million marine microorganisms exist, so the ocean is always the resource treasure house. The sea has high salt content, low temperature, low oxygen deficiency, low illumination and oligotrophy, etc. different from the ecological environment of land, and has a total content of 10/ml in sea water⁶-10⁷A total of up to 10 virus particles³⁰The biological agent is the life body with the highest abundance in the ocean and is also a great threat factor for the survival of other organisms. In the face of such a plurality of environmental stress factors, microorganisms living therein obtain a unique genetic system and a metabolic mechanism through long-term biological evolution, and secondary metabolites with novel structures and unique activities can be generated to antagonize external harmful substances, defend natural enemies and obtain nutrition so as to maintain the survival and the multiplication of the microorganisms. Therefore, most of secondary metabolites produced by marine microorganisms, especially marine actinomycetes, have good biological activity, and the novelty of the structure provides a huge natural product library for the excavation of new compounds.

Polyether antibiotics are natural polyketonecarboxylic acids with multiple asymmetric centers and containing multiple tetrahydrofuran and tetrahydropyran rings.

Disclosure of Invention

The first purpose of the invention is to provide a genetic engineering strain capable of directionally producing polyether antibiotics with antiviral and antibacterial activities.

The genetic engineering strain for directionally producing the polyether antibiotics with the antiviral and antibacterial activities is constructed by a method which is obtained by singly knocking out a Pak13 gene, a Pak15 gene, a Pak20 gene, a Pak31 gene or a Pak38 gene in a Streptomyces sp.SCSIO 01680 genome, wherein the nucleotide sequences of the Pak13 gene, the Pak15 gene, the Pak20 gene, the Pak31 gene and the Pak38 gene are respectively shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4 and SEQ ID No. 5.

The second purpose of the invention is to provide the application of the genetically engineered strain Streptomyces sp.SCSIO 01680/delta pak13 after pak13 gene knockout in preparing the compound 1 and the compound 2:

the structural formulas of the compound 1 and the compound 2 are respectively shown as 1 and 2 in the formula (I):

the third purpose of the invention is to provide the application of the genetically engineered strain Streptomyces sp.SCSIO 01680/delta pak15 after pak15 gene knockout in preparing the compound 3:

the structural formula of the compound 3 is shown as 3 in the formula (II):

the fourth purpose of the invention is to provide the application of the genetically engineered strain Streptomyces sp.SCSIO 01680/delta pak20 after pak20 gene knockout in preparing the compound 4 and the compound 5;

the structural formulas of the compound 4 and the compound 5 are respectively shown as 4 and 5 in the formula (III):

the fifth purpose of the invention is to provide the application of the genetic engineering strain Streptomyces sp.SCSIO 01680/. DELTA.pak 31 after pak31 gene knockout in the preparation of

compounds

6, 7 and 8;

the structural formulas of the compound 6, the compound 7 and the compound 8 are respectively shown as 6-8 in the formula (IV):

the sixth purpose of the invention is to provide the application of the genetic engineering strain Streptomyces sp.SCSIO 01680/delta pak38 after pak38 gene knockout in preparing the compound 9;

the structural formula of the compound 9 is shown as 9 in the formula (V):

it is a seventh object of the present invention to provide any one of the compounds represented by formula (VI):

an eighth object of the present invention is to provide the use of

compound

1, 2, 3, 4, 5, 6, 7, 8 or 9 for the preparation of an antiviral or antibacterial medicament.

The antiviral drug is preferably an anti-HIV drug.

The antibacterial agent is preferably an agent against Micrococcus luteus, Staphylococcus simulans AKA1, Staphylococcus aureus 16162, Staphylococcus aureus 16339, Staphylococcus aureus ATCC 29213, Staphylococcus aureus, Bacillus subtilis and/or methicillin-resistant Staphylococcus aureus.

The original strain Streptomyces sp.SCSIO 01680 is separated from sediment samples in northern south China sea, and can better grow and produce spores on an MS solid culture medium (soybean meal 20g/L, mannitol 20g/L, pH 7.2-7.4, agar powder 2%). Through resistance testing, it was found to be sensitive to 50. mu.g/mL of apramycin (Apr) and 50. mu.g/mL of kanamycin (Kan), but can tolerate 50. mu.g/mL of trimethoprim (Tmp). Therefore, Apr and Kan can be used as resistance selection markers for gene knockout, and Tmp can be used to kill e.coli ET12567/pUZ8002 after conjugation transfer. The Streptomyces sp.SCSIO 01680 is proved to have the condition for establishing a genetic operation system, and is convenient for constructing a gene mutation engineering strain.

The invention obtains 5 genetic engineering strains which can directionally produce polyether antibiotic compounds 1-9 with antiviral and antibacterial activities by respectively knocking out 5 methyltransferase genes pak13, pak15, pak20, pak31 and pak38 on a polyether antibiotic gene cluster in Streptomyces sp.SCSIO 01680. The culture is prepared by fermentation respectively, the product of each mutant strain is separated by an activity-oriented method, and the structure of each compound is analyzed by mass spectrum and nuclear magnetic spectrum, so that the compounds 1-9 are all identified as new compounds.

The pak13 gene, pak15 gene, pak20 gene, pak31 gene and pak38 gene all encode methyltransferases, but methylation positions catalyzed by the methyltransferases are different, so that the constructed mutant strain can produce demethylated derivatives at different positions. The genetic mutation engineering strain is used for carrying out mutation inactivation on each methyltransferase gene by adopting a PCR-targeting technology, and the key part of the sequence of the methyltransferase gene is replaced by an Apr resistance gene fragment with homologous arms at two ends by mainly utilizing a homologous recombination method, so that the gene is inactivated and cannot be normally expressed.

The genetic engineering strain capable of directionally producing the polyether compound with the antiviral and antibacterial activities, which is provided by the invention, can provide chemical entities for screening antiviral drugs and antibacterial drugs, and has important significance for developing Chinese marine drug resources.

The Streptomyces sp.scsio 01680 of the present invention was deposited in the chinese typical culture collection (CCTCC) at 7/18/2011, and in wuhan, wuhan university, postcode: 430072, preservation number is CCTCC NO: m2011256.

Drawings

FIG. 1 is a chemical structural formula of polyether antibiotic produced by the mutant strain;

FIG. 2 shows the construction (A) and PCR confirmation of a Pak13 gene double-crossover mutant, wherein Δ Pak13 is a Pak13 gene double-crossover mutant, and WT is a wild-type strain;

FIG. 3 shows the construction (A) and PCR confirmation of a Pak15 gene double-crossover mutant, wherein both Δ Pak15-2 and Δ Pak15-3 are Pak15 gene double-crossover mutants, and WT is a wild-type strain;

FIG. 4 shows construction (A) and PCR confirmation of a Pak20 gene double-crossover mutant, in which Δ Pak20-5, Δ Pak20-8 and Δ Pak20-30 are all Pak20 gene double-crossover mutants, and WT is a wild-type strain;

FIG. 5 shows construction (A) and PCR confirmation of a double crossover mutant of pak31 gene, wherein Δ pak31-6, Δ pak31-11, Δ pak31-12 and Δ pak31-17 are all double crossover mutants of pak31 gene, WT is a wild type strain;

FIG. 6 shows construction (A) and PCR confirmation of a double-crossover mutant of pak38 gene, where both Δ pak38-3 and Δ pak38-4 are pak38 gene double-crossover mutants and WT is a wild-type strain;

FIG. 7 is a mass spectrum of Compound 1;

FIG. 8 is a mass spectrum of Compound 2;

FIG. 9 is a mass spectrum of Compound 3;

FIG. 10 is a mass spectrum of Compound 4;

FIG. 11 is a mass spectrum of Compound 5;

FIG. 12 is a mass spectrum of Compound 6;

FIG. 13 is a mass spectrum of Compound 7;

FIG. 14 is a mass spectrum of Compound 8;

fig. 15 is a mass spectrum of compound 9.

The specific implementation mode is as follows:

the following examples are further illustrative of the present invention and are not intended to be limiting thereof.

Example 1:

construction of a genetic operation system of Streptomyces sp.SCSIO 01680 and construction of an engineering strain by knocking out a methyltransferase gene.

Culture of Streptomyces sp.SCSIO 01680 and establishment of genetic manipulation System

1.1 culture conditions of Streptomyces sp.SCSIO 01680

Streptomyces sp.SCSIO 01680 is isolated from northern sediment sample of south China sea, and the strain produces spores better on MS solid culture medium, and the MS culture medium comprises:20g/L of soybean meal, 20g/L of mannitol, 7.2-7.4 of pH, 20g/L of agar powder and water as a solvent, and the preparation method comprises the steps of uniformly mixing the components and sterilizing for later use. And preferably RA medium (glucose 10g/L, malt extract 10g/L, corn flour 5g/L, soluble starch 20g/L, maltose 10g/L, trace elements 100 μ L/L, sea salt 30g/L, CaCO₃2g/L, pH 7.2-7.4, and water as solvent, and is prepared by mixing the above components, sterilizing, and culturing in deep liquid culture to stably produce polyether antibiotics. The formula of the trace elements is as follows: 800mg/L of zinc chloride, 4000mg/L of ferric trichloride hexahydrate, 200mg/L of copper chloride dihydrate, 200mg/L of manganese chloride tetrahydrate, 200mg/L of sodium tetraborate decahydrate and water as a solvent are uniformly mixed to prepare the zinc chloride-ferric chloride hexahydrate composite material.

1.2 establishment of Streptomyces sp.SCSIO 01680 genetic operating System

Antibiotic sensitivity tests on Streptomyces sp.SCSIO 01680 found that it was sensitive to 50. mu.g/mL of apramycin (Apr) and 50. mu.g/mL of kanamycin (Kan) as a subsequent resistance selection marker and was not sensitive to 50. mu.g/mL of trimethoprim (Tmp), whereas the E.coli ET12567/pUZ8002 strain was very sensitive to 50. mu.g/mL of trimethoprim, and thus, after conjugative transfer, E.coli could be killed with trimethoprim.

Construction of Streptomyces sp.SCSIO 01680 genomic library and screening of cosmids containing methyltransferase Gene

2.1 construction of Streptomyces sp.SCSIO 01680 genomic library

Construction of the Streptomyces sp.SCSIO 01680 genomic library was performed with reference to SuperCos1 Cosmid Vector Kit and Gigapck III XL packing Extract manual. Culturing Streptomyces sp.SCSIO 01680 strain in liquid for 2 days, centrifuging, collecting thallus, and extracting genome DNA by phenol-chloroform extraction method. Adding a high-purity DNA with a proper concentration into a Sau3AI enzyme with a certain concentration, reacting for a certain time to cut the genome DNA into a proper fragment size, detecting by running nucleic acid gel, extracting and purifying the cut product by using phenol-chloroform, and carrying out dephosphorylation treatment. Meanwhile, the SuperCos1 vector was treated with XbaI restriction enzyme, and after phenol-chloroform extraction, dephosphorylation was performed in the same manner, and after dephosphorylation, BamHI restriction enzyme treatment was performed again, followed by extraction and purification. The genomic DNA treated by the method is randomly connected with the SuperCos1 vector under the action of T4 ligase, and the connection efficiency is verified by running glue. The ligation products were then packaged with packaging protein and infected with library strain e.coli LE392, which was then spread on kanamycin-containing resistant plates. After the single clone grows out, randomly selecting about 2000 clones to inoculate in a 96-well plate, culturing at 37 ℃ to a certain concentration, and then storing in a refrigerator at-80 ℃ to complete the construction of the genome library of Streptomyces sp.

2.2 screening of cosmid plasmids containing methyltransferase Gene

And (3) carrying out whole genome sequencing on Streptomyces sp.SCSIO 01680 by adopting a second generation sequencing technology Illumina Hiseq and splicing to obtain a whole genome map and a sequence. The sequence is uploaded to online bioinformatics analysis software anti SMASH (https:// anti major. second genome oligonucleotides. org/#./start) or 2ndFind (http:// biosyn. nih. go. jp/2ndFind /), gene sequence comparative analysis is carried out, and a secondary metabolite gene cluster which possibly encodes a polyether compound is searched and verified through a gene knockout experiment. The functions of the respective genes in the gene cluster were further analyzed and genes encoding methyltransferases were selected as pak13, pak15, pak20, pak31 and pak38, and the locations of their distribution were determined. Since cosmid can carry DNA fragments of 30-40kb in size, in order to screen cosmid plasmids containing the methyltransferase gene, three pairs of screening primers were designed at appropriate positions on the gene cluster: pak12-SF (GCCACCGTCCCGGAGCGGCC), pak12-SR (GGCCGCTCCGGGACGGTGGC); pak27-SF (ACATCCTGTGTGGGTCCGGGGGGC), pak27-SR (AGCCGGCCCCCCTCTGGCCTCTC) and pak38-SF (CGGAAGAGGCCACCGACCGG), pak38-SR (ACTCCCGGGCGGCAGCGCAGG). Using these three primers, 3 cosmid plasmids 17-4E, 10-11F and 16-11G were screened by PCR, which contained the above 5 methyltransferase genes, using the following PCR protocol: 5min at 95 ℃; 45s at 95 ℃, 45s at 60 ℃, 1min at 72 ℃ and 30 cycles; 10min at 72 ℃.

3. Construction of Each methyltransferase Gene mutant

The construction of the gene knockout mutant strain mainly adopts a PCR-targeting technology, and the specific operation steps are as follows: cosmid plasmids 17-4E, 10-11F and 16-11G carrying the methyltransferase genes were obtained by genomic library screening. The plasmids were introduced into E.coli BW25113/pIJ790, respectively, and made competent. Meanwhile, knockout primers of each methyltransferase gene are designed to amplify an apramycin (Apr) resistance gene segment with homologous arms at two ends, and the sequences of the primers are shown in the table 1 of the specification. The fragment is introduced into an E.coli BW25113/pIJ790 competent strain carrying cosmid, and a homologous recombination system of the E.coli BW25113/pIJ790 is utilized to carry out homologous recombination on an Apr gene (apramycin (Apr) resistance gene fragment) and a key function region of a target gene on the cosmid, so that the target gene is mutated and inactivated and cannot be expressed normally. The mutated cosmid plasmid was then extracted and introduced into e.coli ET12567/pUZ 8002. And finally, inducing cosmid carrying mutant genes by using non-shuttle pUZ8002 plasmid in E.coli ET to transfer the mutant genes into wild Streptomyces sp.SCSIO 01680 through conjugative transfer, mutating target genes in the genome through homologous recombination to obtain each methyltransferase gene mutant strain, and verifying whether the constructed mutant strains are correct or not through resistance verification and PCR verification, wherein verification primers are shown in the table 1 of the specification. Finally, the correctly verified mutants were stored in a-80 ℃ freezer.

Thus obtaining a gene double-exchange mutant Streptomyces sp.SCSIO 01680/. DELTA.pak 13 after pak13 gene knockout; (corresponding to the primer at the beginning of Pak13 in Table 1, del represents the knockout primer, and test represents the verification primer), the specific construction process is shown in FIG. 2.

Thus obtaining a gene double-exchange mutant Streptomyces sp.SCSIO 01680/. DELTA.pak 15 after pak15 gene knockout; (corresponding to the primer at the beginning of Pak15 in Table 1, del represents the knockout primer, and test represents the verification primer), the specific construction process is shown in FIG. 3.

Thus obtaining a gene double-exchange mutant Streptomyces sp.SCSIO 01680/. DELTA.pak 20 after pak20 gene knockout; (corresponding to the primer at the beginning of Pak20 in Table 1, del represents the knockout primer, and test represents the verification primer), the specific construction process is shown in FIG. 4.

Thus obtaining a gene double-exchange mutant Streptomyces sp.SCSIO 01680/. DELTA.pak 31 after pak31 gene knockout; (corresponding to the primer at the beginning of Pak31 in Table 1, del represents the knockout primer, and test represents the verification primer), the specific construction process is shown in FIG. 5.

Thus, a gene double-crossover mutant Streptomyces sp.SCSIO 01680/. DELTA.pak 38 was obtained after the pak38 gene had been knocked out. (corresponding to the primers at the beginning of Pak38 in Table 1, del represents the knockout primer, and test represents the verification primer), the specific construction process is shown in FIG. 6.

TABLE 1 knock-out and validation primers for construction of individual methyltransferase gene mutants

Note: the capital letter sequences are from the respective methyltransferase genes in the Streptomyces sp.scsio 001680 genome and the lowercase letter sequences are from the apramycin gene.

The experimental operation flow of the joint transfer is as follows:

the constructed E.coli ET12567/pUZ8002 strain was inoculated into 3-5mL LB liquid medium supplemented with 50. mu.g/mL chloramphenicol (Cm), 50. mu.g/mL apramycin (Apr), and 50. mu.g/mL kanamycin (Kan), and cultured overnight at 37 ℃ in a shaker at 200 rpm. 500-1000ul of overnight culture broth (the inoculum size is determined according to the broth concentration) was transferred to a 250mL flask containing 50mL LB (50. mu.g/mL chloramphenicol, 50. mu.g/mL adriamycin, and 50. mu.g/mL kanamycin were added), and cultured at 37 ℃ for 2-3 hours in a shaker at 200rpm to obtain OD₆₀₀The value is within the range of 0.6-0.8. And (3) putting 45ml of bacterial liquid into a 50ml centrifuge tube, centrifuging at normal temperature and 4000rpm for 10min, removing supernatant and absorbing residual liquid. The cells were washed with 40ml of non-antibiotic LB, antibiotics were washed off, centrifuged at 4000rpm for 10min at room temperature, the supernatant was discarded and the residual liquid was aspirated, and the washing was repeated once. According to the concentration of the thallus, an appropriate amount of LB is added to fully suspend the thallus and subpackaged into a sterile EP tube of 1.5 ml.

Streptomyces sp.scsio 01680 spores were scraped into a 50ml centrifuge tube containing a suitable amount of LB and vortexed to thoroughly disperse the spores. Subpackaging into 1.5ml EP tube, sealing with sealing film, placing in 50 deg.C constant temperature water bath, thermally shocking for 10min, cooling with tap water for 2-3min, and stimulating spore pregermination due to external temperature change. The EP tube was placed on a shaker at 28 ℃ and 200rpm for approximately 5 h.

Adding the subpackaged E.coli ET into the subpackaged spores, uniformly mixing, and coating the mixture on the spores with 10mMMg²⁺Or 20 mMMg²⁺The MS plate is laid with the bacterial liquid evenly, dried and cultured at the constant temperature of 28 ℃ for 16-20h for covering, and the covering step is as follows: each plate was supplemented with apramycin (Apr) at a final concentration of 50. mu.g/mL and trimethoprim (Tmp) at a final concentration of 50. mu.g/mL, and for ease of coverage, the antibiotics were added to 1mL of double distilled water, mixed well, applied to the plate, coated uniformly with a glass coating rod, air dried, incubated at 28 ℃ and allowed to grow after 3-4 days.

Example 2:

directionally producing polyether compounds 1-9 by using the methyltransferase gene mutation engineering strains, and detecting the anti-HIV virus activity and the antibacterial activity of the compounds.

1. Separating and purifying from fermentation product of each methyltransferase mutant strain to obtain compounds 1-9

Streptomyces sp.SCSIO 01680/delta pak13, Streptomyces sp.SCSIO 01680/delta pak15 and Streptomyces sp.SCSIO 01680/delta pak20, Streptomyces sp.SCSIO 01680/delta pak31 and Streptomyces sp.SCSIO 01680/delta pak38 were inoculated into seed media, respectively, and cultured in a shaker at 28 ℃ and 200rpm for 2 days, followed by transfer to a fermentation medium at 28 ℃ and 200rpm for 7 days to prepare a fermentation culture of the engineered strain with single gene mutation. Here, both the seed culture medium and the fermentation culture medium are RA culture media, and the composition thereof is: according to the mass fraction, the malt extract is 1 percent, the corn flour is 0.5 percent, the soluble starch is 2 percent, the maltose is 1 percent, the glucose is 1 percent, the trace elements are 100 mu L/L, the sea salt is 3 percent, CaCO₃0.2 percent, the PH value is adjusted to 7.2 to 7.4, the solvent is water, and the preparation method is thatMixing the above materials, and sterilizing.

a. Preparing

compounds

1 and 2 by using a gene double-exchange mutant Streptomyces sp.SCSIO 01680/delta pak 13;

and (2) centrifugally separating a fermentation culture of a gene double-exchange mutant Streptomyces sp.SCSIO 01680/delta pak13 to obtain a thallus and a fermentation broth, respectively extracting the thallus and the fermentation broth by using ethyl acetate, and detecting that extracts of the thallus and the fermentation broth have activity, so that ethyl acetate extracts of the thallus and the fermentation broth are concentrated and combined to obtain a crude extract.

Mixing the crude extract, separating with silica gel column chromatography (normal phase silica gel column, silica gel particle size: 200-. And (3) taking each gradient elution component for antibacterial activity detection, and taking Micrococcus luteus as an indicator bacterium.

The active fractions with resistance to Micrococcus luteus were combined and purified by medium pressure reverse phase liquid chromatography (MPLC) (Flash C18, 40-60 μm,

) Gradient separation is carried out, and the mobile phase composition is as follows: phase A: ddH2O, phase B: acetonitrile +1 ‰ acetic acid; elution procedure: 95% of phase B washing column for 20 min; equilibrating the column for 10min with 0% phase B; 0% -100% linear elution for 120min, 100% isocratic elution for 30min, and flow rate of 10 ml/min. Collecting the eluent in a segmented manner according to the peak appearance condition and the elution time, taking each segment of components for activity detection, and taking Micrococcus luteus as an indicator bacterium.

TLC analysis was performed on the active fraction, and the appropriate developing system was determined to be chloroform-methanol: 92/8v/v, and performing chromatography separation of silica gel plate by using the system, drying the prepared plate after the chromatography is finished, respectively scraping each separation band (the RF value of the compound 1 is 0.52, the RF value of the compound 2 is 0.61), grinding the silica gel into powder, eluting by ethyl acetate, spin-drying to obtain purer samples of the

compounds

1 and 2, and further purifying by gel columns respectively, wherein the volume ratio of chloroform: methanol was used as an eluent to obtain a pure product (compound 1: 10.0 mg; compound 2: 65.0mg) for mass spectrometry and NMR detection.

b. Preparing a compound 3 by using a gene double-exchange mutant Streptomyces sp.SCSIO 01680/delta pak 15;

and (2) centrifugally separating a fermentation culture of a gene double-exchange mutant Streptomyces sp.SCSIO 01680/delta pak15 to obtain a thallus and a fermentation broth, respectively extracting the thallus and the fermentation broth by using ethyl acetate, and detecting that extracts of the thallus and the fermentation broth have activity, so that ethyl acetate extracts of the thallus and the fermentation broth are concentrated and combined to obtain a crude extract.

TLC analysis of the active fraction with resistance to Micrococcus luteus was performed to determine the appropriate developing system to be petroleum ether-ethyl acetate: 2.5/7.5v/v, performing chromatographic separation by using the system to prepare a silica gel plate, drying the prepared plate after finishing the chromatographic separation, scraping a target strip (the RF value of the compound 3 is 0.55), grinding the silica gel into powder, eluting by using ethyl acetate, performing spin drying to obtain a pure sample compound 3, loading on a gel column, and performing chromatographic separation by using chloroform with the volume ratio of 1: and (4) eluting with methanol, and further purifying to obtain 30.3mg of a pure compound 3 for mass spectrum and NMR detection.

c. Preparing

compounds

4 and 5 by using a gene double-exchange mutant Streptomyces sp.scsio 01680/Δ pak 20;

and (2) centrifugally separating a fermentation culture of a gene double-exchange mutant Streptomyces sp.SCSIO 01680/delta pak20 to obtain a thallus and a fermentation broth, respectively extracting the thallus and the fermentation broth by using ethyl acetate, and detecting that extracts of the thallus and the fermentation broth have activity, so that ethyl acetate extracts of the thallus and the fermentation broth are concentrated and combined to obtain a crude extract.

) Gradient separation is carried out, and the mobile phase composition is as follows: phase A: ddH2O, phase B: acetonitrile +1 ‰ acetic acid; elution procedure: 95% phase B washing column for 20 min; equilibrating the column for 10min with 0% phase B; 0% -100% linear elution for 120min, 100% isocratic elution for 30min, and flow rate of 10 ml/min. Collecting the eluent in a segmented manner according to the peak appearance condition and the elution time, taking each segment of components for activity detection, and taking Micrococcus luteus as an indicator bacterium.

TLC analysis was performed with anti-Micrococcus luteus and the appropriate developing system was determined to be petroleum ether-ethyl acetate: 1/9v/v, performing chromatographic separation of silica gel plate with the system (RF value of compound 4 is 0.64, RF value of compound 5 is 0.59), air drying the plate after the chromatography is finished, scraping each separation strip, grinding silica gel into powder, eluting with ethyl acetate, spin drying to obtain

pure compounds

4 and 5, and loading on gel column respectively, and separating with chloroform: methanol was used as an eluent, and the purified product (Compound 4: 13.7 mg; Compound 5: 48.1mg) was further purified for mass spectrometry and NMR detection.

d. Preparing

compounds

6, 7 and 8 by using a gene double-crossover mutant Streptomyces sp.scsio 01680/Δ pak 31;

and (2) centrifugally separating a fermentation culture of a gene double-exchange mutant Streptomyces sp.SCSIO 01680/delta pak31 to obtain a thallus and a fermentation broth, respectively extracting the thallus and the fermentation broth by using ethyl acetate, and detecting that extracts of the thallus and the fermentation broth have activity, so that ethyl acetate extracts of the thallus and the fermentation broth are concentrated and combined to obtain a crude extract.

TLC analysis was performed with anti-Micrococcus luteus to determine the appropriate developing system to be petroleum ether-ethyl acetate: 4/8v/v, performing chromatographic separation of silica gel plate with the system (RF value of compound 6 is 0.51, RF value of compound 7 is 0.68, RF value of compound 8 is 0.61), air drying the plate after the chromatography is finished, scraping each separation strip, grinding silica gel into powder, eluting with ethyl acetate, spin drying to obtain pure samples of

compounds

6, 7 and 8, and loading on gel column respectively, and performing chloroform: methanol was used as an eluent, and the purified product (Compound 6:: 54.7 mg; Compound 7: 112.4 mg; Compound 8: 49.2mg) was further purified for mass spectrometry and NMR detection.

e. Preparing a compound 9 by using a gene double-exchange mutant Streptomyces sp.SCSIO 01680/delta pak 38;

and (2) centrifugally separating a fermentation culture of a gene double-exchange mutant Streptomyces sp.SCSIO 01680/delta pak38 to obtain a thallus and a fermentation broth, respectively extracting the thallus and the fermentation broth by using ethyl acetate, and detecting that extracts of the thallus and the fermentation broth have activity, so that ethyl acetate extracts of the thallus and the fermentation broth are concentrated and combined to obtain a crude extract.

) Gradient separation is carried out, and the mobile phase composition is as follows: phase A: ddH2O, phase B: acetonitrile +1 ‰ acetic acid; elution procedure: 95% of phase B washing column for 20 min; column equilibration for 0% phase B for 10 min; 0 percent of-100% linear elution for 120min, 100% isocratic elution for 30min, flow rate 10 ml/min. Collecting the eluent in a segmented manner according to the peak appearance condition and the elution time, taking each segment of components for activity detection, and taking Micrococcus luteus as an indicator bacterium.

TLC analysis was performed with anti-Micrococcus luteus to determine the appropriate developing system to be petroleum ether-ethyl acetate: 5/5v/v, and performing chromatographic separation with the system to prepare silica gel plate, air drying the plate and scraping target strip (RF value of compound 9 is 0.57) after chromatography, grinding silica gel into powder, eluting with ethyl acetate, spin drying to obtain pure compound 9, loading on gel column, and separating with chloroform at volume ratio of 1: methanol was used as eluent, and further purified to obtain a total of 36.9mg of pure compound 9 for mass spectrometry and NMR detection.

Analysis by high resolution mass spectrometry (HRESIMS) compound 1: m/z803.4438[ M-H]^-The molecular formula is as follows: c₄₀H₆₇O₁₆Molecular weight: 803.4438, respectively; compound 2: m/z931.5279[ M-H]^-The molecular formula is as follows: c₄₇H₇₉O₁₈Molecular weight: 931.5279, respectively; compound 3: m/z931.5276[ M-H]^-The molecular formula is as follows: c₄₇H₇₉O₁₈Molecular weight: 931.5276, respectively; compound 4: 1059.6106 [ M-H]^-The molecular formula is as follows: c₅₄H₉₁O₂₀Molecular weight: 1059.6106, respectively; compound 5: 1073.6264[ M-H]^-The molecular formula is as follows: c₅₅H₉₃O₂₀Molecular weight: 1073.6264, respectively; compound 6: m/z929.5125[ M-H]^-The molecular formula is as follows: c₄₇H₇₇O₁₈Molecular weight: 929.5125, respectively; compound 7: m/z817.4589[ M-H]^-The molecular formula is as follows: c₄₁H₆₉O₁₆Molecular weight: 817.4589, respectively; compound 8: m/z831.4738[ M-H]^-The molecular formula is as follows: c₄₂H₇₁O₁₆Molecular weight: 831.4738, respectively; compound 9: 931.5298 [ M-H]^-The molecular formula is as follows: c₄₇H₇₉O₁₈Molecular weight: 931.5298. the nuclear magnetic data are shown in tables 2 to 6. The mass spectra are shown in FIGS. 7-15.

TABLE 2 Nuclear magnetic data for Compound 1 and Compound 2

TABLE 3 NMR data for Compound 3 and Compound 4

TABLE 4 NMR data for Compound 5 and Compound 6

TABLE 5 NMR data for Compound 7 and Compound 8

TABLE 6 NMR data for Compound 9

In summary, the structural formulas of

compounds

1 and 2 are shown as 1 and 2 in formula (I), respectively:

the structural formula of the compound 3 is shown as 3 in the formula (II):

the structural formula of the compound 9 is shown as 9 in the formula (V):

2. anti-HIV activity and cytotoxic activity assay for Compounds 1-9

2.1 culture of HIV viruses and cells

In the study for testing the anti-HIV viral and cytotoxic activity of the compounds 1-9, the virus strain used in the invention was HIV-1_IIIBThe virus belongs to X4 type virus, and the cell strain is Hela cell line TZM-bl and human lymphocyte cell line MT-2. The culture medium of TZM-bl cells was DMEM medium containing 10% (volume fraction) of heat-inactivated bovine fetal serum (FBS), 100IU/ml of penicillin, 100. mu.g/ml of streptomycin and 1% of L-glutamine. MT-2 cells were cultured in RPMI1640 medium containing 10% (volume fraction) fetal bovine serum, 100IU/ml penicillin, 100. mu.g/ml streptomycin, and 1% L-glutamine. The cells were cultured at 37 ℃ with 5% CO₂In humid ambient conditions.

2.2 detection of anti-HIV Virus Activity

By HIV-1_IIIBTZM-bl and HIV-1_IIIBMT-2 Virus-cell System the anti-HIV activity of compounds 1-9 was examined. With respect to HIV-1_IIIBThe TZM-bl detection system takes TZM-bl cells in logarithmic growth phase and adds the cells to a 96-well plate with the concentration of 1 multiplied by 10⁴One well, 40. mu.l of the diluted solution was added to each well after 24 hours of incubationTest compounds and 1 titer (MOI ═ 1) of HIV-1_IIIBThe virus was supplemented with DMEM complete medium per well to a total volume of 200. mu.l. After further culturing for 48 hours, the number of HIV viruses in TZM-bl cells was measured using the Bright-GloLuciferase assay kit from Promega. Three replicates per sample. Calculation of test sample vs HIV-1 Using graphpad software_IIIBHalf maximal Inhibitory Concentration (IC)₅₀)。

With respect to HIV-1_IIIBMT-2 detection system, MT-2 cells in logarithmic growth phase are added to 96-well plate at a concentration of 3.2 × 10⁴One well, 40 μ l of the test compound diluted in a gradient and 1 titer (MOI ═ 1) of HIV-1 were added simultaneously to each well_IIIBThe virus was supplemented to a final volume of 200. mu.l per well with RPMI1640 complete medium. After 72 hours of incubation, 50. mu.l of supernatant per well was transferred to a well containing 90. mu.l of 3X 10⁵The number of HIV viruses in TZM-bl cells was measured using the Bright-GloLuciferase assay kit from Promega after further culturing for 24 hours in 96-well plates per ml of TZM-bl cell culture. Three replicates per sample. Calculation of test sample vs HIV-1 Using graphpad software_IIIBHalf maximal Inhibitory Concentration (IC)₅₀)。

2.3 cell viability assay

The method adopts CellTiter of Promega corporation

The LuminescentCellViabilityassay kit detects cell viability. The above-mentioned cell lines in the logarithmic growth phase were added to 96-well plates, respectively, while adding the compound diluted in a gradient and 1 titer (MOI ═ 1) of HIV-1_IIIBThe virus was mixed homogeneously in a final volume of 200. mu.l, the density of TZM-bl cells and MT-2 cells was 1X 10⁴A/hole and 3.2X 10⁴Cell culture time was synchronized with the detection of anti-HIV activity per well. 3 replicates per sample, and CellTiter-

Reagents were added to each cell culture and the luminescence signal from each well was detected using an enzyme markerTo calculate the number of cells surviving, half the cytotoxic concentration CC of the test samples on TZM-bl and MT-2 cells was calculated using graphpad software₅₀And a selection coefficient SI. Specific results are shown in table 7.

TABLE 7 results of measurement of anti-HIV viral activity and cytotoxic activity of Compounds 1 to 9

3. Antibacterial Activity assay of Compounds 1-9

The invention firstly adopts a filter paper sheet method to screen and test the antibacterial activity of the compounds 1-9, and the result shows that the compounds 1-9 have no inhibitory activity to all gram-negative strains and 2 gram-positive strains which are tested, and the gram-negative strains comprise: escherichia coli SHPP45, Klebsiella pneumoniae 1069, Proteus mirabilis SG0508, Escherichia coli 920, Pseudomonas aeruginosa 1873, Acinetobacter baumii ADR-2, Acinetobacter baumii Abs-8, Salmonella typhimurium SH138, multidrug-resistant Escherichia coli, Klebsiella pneumoniae ATCC 13883, Escherichia coli (ST117) SC0517, Salmonella heidelberg SH36, Klebsiella pneumoniae KPA 1757, Escherichia coli E11, Escherichia coli ATCC 1324, 2 strain blue positive bacteria are Staphylococcus cohnii DKdhi 4 and Clostridium fs 20. All test strains in the antibacterial activity test were kept in the laboratory and isolated from patients or animals, respectively, and had varying degrees of tolerance to clinically used antibacterial agents.

According to the screening result of the filter paper sheet experiment, 10 gram-positive bacteria are selected to further detect the minimum inhibitory concentration of the compounds 1-9, and vancomycin (Van), erythromycin (Ery) and kanamycin (Kan) are selected as positive controls. The compound and the positive drug are both prepared into 3.2mg/ml, wherein vancomycin and kanamycin are prepared into water solution, and the rest is prepared into DMSO solution.

Sterile Mueller-Hinton (MH) broth was added to 96 well plates, 50. mu.l for each well, except for 96. mu.l for column 1. Add 4. mu.l compound or positive drug into column 1 and mix well, do 3 parallels for each sample, aspirate 50. mu.l of mix from column one to column 2, aspirate 50. mu.l to column 3 after mixing well, dilute to column 11 in this order, and remove 50. mu.l from column 11 and discard, column 12 does not add compound or drug as negative control. Then diluting to OD₆₀₀Is 10^-3The resulting suspension was added to a 96-well plate in an amount of 50. mu.l/well. At this time, the concentrations of the compound or drug from column 1 to column 11 were 64, 32, 16, 8, 4, 2, 1, 0.5, 0.25, 0.125, 0.0625. mu.g/ml, respectively. Finally, the 96-well plate is placed in an incubator at 37 ℃ for culture, the result is observed after 12-18h, and the Minimum Inhibitory Concentration (MIC) value of each compound and each drug to different pathogenic bacteria is determined, and the result is shown in Table 8.

TABLE 8 results of Minimum Inhibitory Concentration (MIC) assay for Compounds 1-9

Note: van is vancomycin; ery is erythromycin; kan kanamycin. ML is Micrococcus luteus; ljh13 Staphylococcus simulans AKA 1; SA1 Staphylococcus aureus 16162; SA 2: staphylococcus aureus 16339; SA 3: staphylococcus aureus ATCC 29213; SA 4: staphylococcus aureus (cfr) GDQ6P 012P; BS: bacillus subtilis; MRSA: methicillin-resistant Staphylococcus aureus.

Sequence listing

<110> oceanic institute of south China sea of academy of sciences

<120> genetic engineering strain for directionally producing antiviral and antibacterial active compound and application thereof

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 951

<212> DNA

<213> Streptomyces SCSIO 01680(Streptomyces sp.)

<400> 1

atgagcaatc aaccgatcac tggtgaacgc agccgcacct cccagggcaa gctggcgaag 60

gtccggcgga tgttccgctc ctccgagacg cccgacgacc gggtgcgctc gttctacgag 120

gtcctcgacc ggatgcgcga cgacggcttc taccgcgaca tcctcggcaa cgacagcctc 180

tatatgaact acggctactg ggctcccggg tgcacggacc acgacgacgc gtgccaggcc 240

ctggccgagg agctgggtga ggcggccggc atcggagcgg gcgaccgggt gctggacgtc 300

ggattcggct tcgccgaaca ggacttccac tggctgcgca cccgcaagcc ccgggagatc 360

gtcggcatca atgtgacacc gagccaggtg gcggctgcac agcagcgcgc cgaggaactg 420

ggcttcgccg accggctcga cctgcgggtg ggctccgcca cctcgctgcc gttcgaggac 480

ggctcgttcg acgcggtggt ggcgttggag gcgtcggccc acttccacac ccgcgaccgg 540

ttcttcgccg aggccttccg ggtgctgcgg cccggcggca tcctcgccac gaccgacccg 600

ctgcccgcgc ccgcgggaac cggcgggaag agcctgctgg ggcggctgga cgagtggcgc 660

cgcaagcgcg tcatcccgga cgagaactgg tactcgcggc aggtgtacgc ggagcggctc 720

accagcgccg gattcgcccc ggtgacggtc cgggacgtca ccgaccgggt gctggtgccg 780

aacgcggagt acgtgcggga gcggtgcgcc aagctgctcc gggacccgcg ctaccgctcc 840

tccaagcaga agaacagcat cacctggcac gtcaagctca ccgaactgcg cgcaacgacg 900

agggagtacg tcctcgcctc cgccgagaaa ccccaggacc cgcacggctg a 951

<210> 2

<211> 843

<212> DNA

<213> Streptomyces SCSIO 01680(Streptomyces sp.)

<400> 2

atgacgtcct catcgctcag gccgactccc gatcagatga ccgactacta cgacgggatg 60

ggggcgctgc tgcaagtcgc ctggaacgac aatctgcact tcgggtactg ggacgggccc 120

gaggacgaga gctcgatcga ggaggccacc aaccgcttca ccgacatgct ggccgcgcgg 180

ctcagggtgg ggcccggcga ccgggtcctg gacgcgggct gcggtatcgg gaagccggcg 240

atccaggtgg cccgcacgac cggtgccgag gtgctgggca tctccatcag cccgcaccag 300

gtcgagcagg ccggtgagcg ggccgagcgc gagggaatga ccgaccgggt ctccttccag 360

catgtcaacg cgatggacat gcccttcgag tccgagtcct tcgacgcggt gctcgccttc 420

gagtcgatca tccatatgga ccgccccgcc gcactgcgcg agttcgcccg ggtgctcaag 480

cccggtggcc gggtggccct cacggatgtg accgtcgtgc aggaggaccc cgggaacatc 540

gagttcttcg aggggttccc gcgcaagcag ccggcgaaga acgaagcgca catcgcgagc 600

gtcgtcgagc ccggtgacta ccccgggttg atgacggacg ccgggctcca gctcgacgag 660

ttgctggacg tcacggagaa caccaagcgg accttcaacc tgctgctcga cggtgtgatc 720

aaacaccgca gggagttcga gcgcaagcac ggcatcacgg ccgaggaggt gctcggctcg 780

tccaccgtgg aggaccccgg caagggtccg ggctgcgtgg tcgtcaccgc ccacaagccg 840

taa 843

<210> 3

<211> 849

<212> DNA

<213> Streptomyces SCSIO 01680(Streptomyces sp.)

<400> 3

atgaactctc caccggccgg gccccccgcg tccgacctca tggccgacta ttacaggttg 60

ctgggagaac tgcttcagat ggcctggggg gacaatttcc acctcgggta ctgggaaggg 120

cccgacgaca cgagttcggt ccaggaggcc accgaccggc tcaccgatgt gctcgccgca 180

cgactgcggg tcggcccgga ctcccgtgtc ctcgacgtgg gctgcggcat cggaagcccc 240

gcgctgcggg tggcggccac cacgggtgcc ggcgtgctcg gcatcaccac gacccccgag 300

catgtggagc aggccgcgaa gcgcgcccgc gagcagggca tggccgaccg ggtgacgttc 360

cagcaggcgg acgggatgga catgccgttc gagtccgggt ccttcgacgc cgtgctcgca 420

cttgagtcga tcatgcatat ggaacggccc accgcgctgc gtgagatggc ccgggtgctg 480

gctcccggcg ggcggctggt gctgaccgac gtgttcccgc tcgcggagga ggcgagcgac 540

aacccccagg cgttcggcac cctcttcggc gacgcgccgg tcagcgagca gaaccccggg 600

atggcctctc tggcacggtt cgaggactgg ccggacctgg tctccgcggc cgggctgcgg 660

ctggacgagt tgaccgacat caccgagaac gtccagaaca ccttcccccg gatgctcgac 720

ggcttcatcg accggcgccg ggagttcgag cggcggcacg gcgtcagcgt ggagcaggtg 780

ctcgaccaca cgcggcaggc caacccggtg gccgccggct gcctggtgat ggccgcgcac 840

aagccctga 849

<210> 4

<211> 990

<212> DNA

<213> Streptomyces SCSIO 01680(Streptomyces sp.)

<400> 4

atggcacagg gtttgcaggc gagtcggcag tggcagcgca tcagcgagct gtgggtcacc 60

gaagaggcgt ccgccgatct gaccgacttc aagtcggacc cgaggaattt ccatctcgca 120

ctctgggacc cgacgacgaa cggagtgcgg tatctcaagg cgctgctgta cgagctggcc 180

acccggctga ccccggagga atgggcgagg atcgagaagg tgcgcaaccg cgaggtgggg 240

aacccgatcg cggtccgtat cgacggaaag tccgtgtgtc tggactacct gcaggcctcg 300

caggagctgg gattcatcga gaaggccgtc gagttgcgcg gcgcccgcgt cctggagatc 360

ggtgccgggt acgggcgggt gtgccacgcg atgctctcca actacgacct ggccgagtac 420

tgcatcgtcg acctgaagaa cacactggga ctgagccgcc gctatctgcg cgaggtgctg 480

gacgacaagc agttcgcgaa ggtgcggttc atccctgtgg acgacgacgt ggcagccgcg 540

ctggagtcgt cccgcttcga tctgtgcgtc aatgtgcact cgttcacgga gatggctccg 600

gaaacggtga cggagtatct gaggatcatc gaccgtgtct gcacggggtt cttcgtgaag 660

aaccccgtcg ggaagtatct cgacaagagc atggacggtt accggaaggg cgatgaagcc 720

gtgcagatgg cgctggagaa cgggcctctt cggcagctgc tcgacattca cgacaccgag 780

gccgtcaagg cggccgtgcc cgccttcctc gacgcctatc ggcccggtga cgcgtggacc 840

tgcgtcaggg agggccgcgg tattccgtgg agctatttct ggcaggccgt ctacacgaag 900

aacgccggtg gcaccaacgg cgagggcggc acgaatggtg cgggcggcgg caacggtgag 960

ggcggcacga acggcagcgc cggccagtga 990

<210> 5

<211> 876

<212> DNA

<213> Streptomyces SCSIO 01680(Streptomyces sp.)

<400> 5

atgacgttcc catcagctcc gccgcccacg tctccgacgg gcgaacaggt caccgactac 60

tacagcgcgc tgggcccgct gctgcacatg gcttggggcg acaacctgca cttcggctac 120

tgggagggcc ccacggaccg cagctccccg gaagaggcca ccgaccggtt caccgacctg 180

ctcgcggccc ggttgcgggt gcgccccggc gagcgggtgc tggacgccgg gtgcggtgtg 240

ggcaggccgg cgctgcgcgt ggcctccgcg acgggtgcgc aggtgctggg cgtgaccatc 300

agccaggagc aggtcacccg ggcgagggaa ctggctcgcg aggcggggca ggaggagagc 360

gtacggttcg agcacgggga cgtgatgcgc ctgccgcacc cggcgggctc gttcgacgcg 420

gtgctcgcct tcgagtcgat cgtgcacatg gaccggctca cggcactgcg ggagatgacg 480

cgggtgctgc gccccggcgg gcggatcgta ctgaccgaca ccttcgccct gggtgacggc 540

cccgggaacc cgccctccgc ccccggcacg caggccgcgg cggacgcggg cgaggtcgcg 600

tcgttcgggc ggctggaggc ataccccgaa ctggtgaagg gcgcgggtct ggaactggtc 660

gagctgaccg atgtcaccga gcacaccaag tacacgttca tgcgggtgat cgacgggatc 720

ctgcgctgcc gccgggagtt cgagcgggaa cacggcgtca gcgtcgagga gatcctcgac 780

tcgctgaagc cggcacaccc ggacgtggcc acccagggcg gggccgaggc cgtcggctgc 840

ctggtcgcgg tcgcgcggaa gcccctcggc gcatga 876

Claims

1. A genetic engineering strain for directionally producing polyether antibiotics with antiviral and antibacterial activities is characterized in that the genetic engineering strain is obtained by singly knocking out Pak13 gene, Pak15 gene, Pak20 gene, Pak31 gene or Pak38 gene in Streptomyces sp.SCSIO 01680 genome, nucleotide sequences of the Pak13 gene, the Pak15 gene, the Pak20 gene, the Pak31 gene and the Pak38 gene are respectively shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4 and SEQ ID No.5, and the Streptomyces sp.SCSIO 01680 has the preservation number of CCTCC NO: m2011256.

2. The use of the genetically engineered strain Streptomyces sp.scsio 01680/Δ pak13 of claim 1 after the pak13 gene knockout in the preparation of compounds 1 and 2:

3. the use of the genetically engineered strain Streptomyces sp.scsio 01680/Δ pak15 of claim 1 after the pak15 gene knockout in the preparation of compound 3:

the structural formula of the compound 3 is shown as 3 in the formula (II):

4. the use of the genetically engineered strain Streptomyces sp.scsio 01680/Δ pak20 of claim 1 after the pak20 gene knockout for the preparation of compounds 4 and 5;

5. use of the genetically engineered strain Streptomyces sp.scsio 01680/Δ pak31 of claim 1 after the pak31 gene knockout in the preparation of compound 6, compound 7 and compound 8;

6. use of the genetically engineered strain Streptomyces sp.scsio 01680/Δ pak38 of claim 1 after the pak38 gene knockout in the preparation of compound 9;

the structural formula of the compound 9 is shown as 9 in the formula (V):