CN111254143A

CN111254143A - Construction method of arthrobacter simplex engineering strain with excellent stress tolerance, strain and application thereof

Info

Publication number: CN111254143A
Application number: CN202010069420.0A
Authority: CN
Inventors: 骆健美; 王敏; 朱文成; 崔慧林; 贾红晨; 申雁冰
Original assignee: Tianjin University of Science and Technology
Current assignee: Tianjin University of Science and Technology
Priority date: 2020-01-21
Filing date: 2020-01-21
Publication date: 2020-06-09
Anticipated expiration: 2040-01-21
Also published as: CN111254143B

Abstract

The invention relates to an arthrobacter simplex engineering strain with excellent stress tolerance, which is obtained by adopting a promoter engineering method, a global transcription mechanism engineering method or a method combining the promoter engineering method and the global transcription mechanism engineering method. The strain still keeps good activity in a high-concentration organic solvent (8%) and substrate (15-45g/L) conversion system, and C of the strain_1,2The dehydrogenation yield was increased 1.1-2.2 times over control strain I (containing wild-type promoter and wild-type irrE). This excellent stress toleranceThe construction and the application of the strain of the engineering strain improve the concentration of an organic solvent and a substrate in a conversion system, further improve the product yield, and have important guiding significance for improving the conversion efficiency of the high-concentration substrate of the steroid hydrophobic compound.

Description

Construction method of arthrobacter simplex engineering strain with excellent stress tolerance, strain and application thereof

Technical Field

The invention belongs to the technical field of metabolic engineering and microbial transformation, and particularly relates to a construction method of a simple arthrobacter engineering strain with excellent stress tolerance, the strain and application thereof.

Background

Steroid hormone drugs are the second class of drugs with clinical dosage only second to antibiotics at present, and have the effects of resisting inflammation, allergy, shock, allergic reaction and the like, and in addition, the steroid hormone also has the effects of improving protein metabolism, restoring and enhancing physical strength, promoting urination, reducing blood pressure and the like. The dehydrogenation reaction of C1,2 position of steroid compound is a typical representative for producing steroid medicine by using microbial conversion method in industry, and is also a reaction for producing prednisolone and its homologue. Arthrobacter simplex (Arthrobacter simplex) is a steroid C1,2 dehydrogenation reaction strain commonly used in domestic industry at present, and has the advantages of high specificity, high reaction rate and the like. For example, the derivative has high activity on Cortisone Acetate (CA), and the anti-inflammatory activity of the generated product Prednisone Acetate (PA) is increased by 3-4 times. However, steroids have poor water solubility (solubility typically 10)^-5-10^-6mol/L) limits the effective contact of the substrate and the intracellular biological enzyme, thereby limiting the efficiency of the catalytic reaction. The addition of organic solvents has been a common method used to improve substrate solubility in industrial steroid biosynthesis processes. However, the amount of organic solvent used is strictly controlled because of its adverse effect on the microorganisms, which greatly limits the amount of substrate charged in the conversion system and ultimately affects the yield. In addition, high concentrations of substrates and products in the conversion system can also inhibit the viability of the strain, thereby affecting the conversion yield. Therefore, increasing stress tolerance, especially organic solvent tolerance, of a strain is an effective strategy to create efficient strains.

IrrE is a global transcription factor derived from Deinococcus radiodurans (Deinococcus radiodurans) R1. Researchers find that the gene can generate important regulation and control action on the whole intracellular metabolic network after being introduced into host bacteria, and further improve various stress tolerance of organisms. However, numerous studies have shown that there is a non-linear relationship between gene expression levels and complex target phenotypes. In order to obtain the desired phenotype, fine control of the expression level of the gene in the host organism is required.

A promoter is a DNA sequence that is specifically recognized and bound by RNA polymerase to initiate transcription, and its structural composition significantly affects the level of transcription of a gene. In most prokaryotes, the promoter core region is mainly composed of a-10 region and a-35 region, and these two conserved regions are the binding sites of RNA polymerase and promoter, and can recognize each other with sigma factor and have high affinity. Thus, the higher the sequence similarity between the promoter and the sigma factor, the higher the strength of the promoter. In addition, the distance between the ribosome binding site and the start codon is also an important factor that affects the level of gene expression. At present, researchers mainly adopt error-prone PCR or site-directed mutagenesis technology to construct a promoter library, and effective expression elements capable of finely regulating and controlling gene expression levels are obtained through screening.

The global transcription mechanism engineering is a brand-new directed evolution method for improving cell phenotype, and mutation modification is carried out on transcription elements in cells through error-prone PCR (polymerase chain reaction), DNA (deoxyribonucleic acid) shuffling and other technologies, so that the transcription efficiency of RNA (ribonucleic acid) polymerase and the affinity to a promoter are changed, and the transcription of the cells is changed on the whole level. Thus, this approach has significant advantages in improving complex phenotypes controlled by multiple genes.

At present, a method for finely regulating and directionally evolving the expression level of irrE gene by adopting promoter engineering, global transcription mechanism engineering or a method combining promoter engineering and global transcription mechanism engineering to construct an arthrobacter simplex engineering strain with excellent stress tolerance and a method for carrying out steroid C by using the engineering strain are not found_1,2The dehydrogenation reaction is reported.

Through searching, no published patent literature relevant to the present patent application has been found.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provides a construction method of a simple arthrobacter engineering strain with excellent stress tolerance, the strain and application thereof.

The technical scheme adopted by the invention for solving the technical problems is as follows:

a target promoter library applicable to Arthrobacter simplex, which is a promoter mutant obtained by random mutation and site-directed mutation techniques based on the wild-type promoter hdnOp of expression vector pART2 (SEQ ID NO.2 of the sequence Listing), and has the sequence: SEQ ID NO.3, and/or SEQ ID NO.4, and/or SEQ ID NO.5, and/or SEQ ID NO.6, and/or SEQ ID NO.7, and/or SEQ ID NO.8, and/or SEQ ID NO.9, and/or SEQ ID NO.10, and/or SEQ ID NO.11, and/or SEQ ID NO.12, and/or SEQ ID NO.13, and/or SEQ ID NO.14, and/or SEQ ID NO.15, and/or SEQ ID NO. 16.

The method for constructing the target promoter library applicable to arthrobacter simplex comprises the following steps:

⑴ introducing restriction enzyme cutting site EcoRV at 5' end of wild promoter hdnOp on plasmid pART2 to obtain recombinant plasmid pART2A for replacing wild promoter on plasmid with subsequent promoter mutant;

⑵ the green fluorescent protein EGFP coding gene is connected with pART2A to construct a recombinant plasmid pART 2A-EGFP;

⑶ designing random mutation primer and site-directed mutation primer according to the sequence of the wild promoter in step ⑴, wherein the random mutation primer is designed to introduce random mutation in the full promoter region by error-prone PCR, and the site-directed mutation primer is designed to delete the base C of the-10 region (TATCAAT) of the original promoter sequence or increase the number of bases from the ribosome binding Site (SD) to the initiation codon (ATG);

⑷ using the recombinant plasmid pART2A-EGFP in step ⑵ as a template, obtaining a promoter nucleotide sequence containing a mutation site by PCR amplification by using the mutation primer in step ⑶, and replacing the promoter nucleotide sequence with a wild type promoter on the plasmid pART2A-EGFP or a whole plasmid containing the mutation site to jointly form a promoter mutant plasmid library for expressing EGFP;

⑸ transferring the promoter mutant plasmids obtained in step ⑷ into Escherichia coli E.coli DH5 α, performing flow sorting by using a flow cytometer to obtain cells with 0.1-1% of fluorescence intensity, and coating the obtained cells on an LB solid culture medium containing kanamycin for culture;

⑹, selecting the single colony in step ⑸, culturing in a liquid LB test tube overnight, detecting the fluorescence intensity by using a microplate reader, and obtaining a promoter mutant with different expression intensities relative to a wild type promoter hdnOp in escherichia coli;

⑺ from the promoter mutants with different expression intensities in the escherichia coli obtained in the step ⑹, the promoter mutants with gradient differences are screened according to the expression intensities and are electrically transferred into arthrobacter simplex, the arthrobacter simplex is cultured to a stable stage, and the fluorescence intensity is detected by a microplate reader, so that a target promoter library with different expression intensities in the arthrobacter simplex is obtained.

An engineered strain of Arthrobacter simplex with superior stress tolerance comprising the promoter library of interest as described above.

Furthermore, the Arthrobacter simplex engineering strain also comprises wild type irrE_(W)Or irrE_(W)Mutant gene irrE_(M2)The wild type irrE_(W)The gene codes the amino acid sequence as follows: SEQ ID No. 1; the irrE_(W)Mutant gene irrE_(M2)The encoded amino acid sequence is: SEQ ID NO. 17.

Also, the irrE_(W)Mutant gene irrE_(M2)The organic solvent tolerance of the Arthrobacter simplex can be obviously improved;

or, said irrE_(W)Mutant gene irrE_(M2)Carries four mutation sites, namely Arg111His, Asp130Asn, Glu182Gly and Ser230 Gly.

Also, the irrE_(W)Mutant gene irrE_(M2)The construction method comprises the following steps:

⑴ with pART2A-irrE_(W)Plasmid as template, Mg at different concentrations²⁺、Mn²⁺Carrying out reaction under the conditions of different template adding amounts and unequal concentration dNTPs, and establishing error-prone PCR conditions;

⑵ to carry wild type irrE_(W)pART2A-irrE of the Gene_(W)Mutating plasmid as template, combining error-prone PCR condition established in step ⑴ to obtain irrE_(W)The mutant gene is connected to a plasmid pART2A to construct an irrE gene mutation library;

⑶ after being transformed into Arthrobacter simplex, the Arthrobacter simplex is coated on LB plate containing kanamycin, the single colony grown out is respectively inoculated into a culture medium containing ethanol with gradient concentration, strains with growth rate higher than that of a control strain I are preliminarily screened, and the control strain I contains a wild type promoter and a wild type irrE_(W)Then re-screening on the basis of the strain to screen out the growth rate and the maximum OD₆₀₀All the strains are higher than the strain of the control strain I, finally obtaining the optimal resistant strain PWT-IrrE (M2), culturing the excellent resistant strain PWT-IrrE (M2), and re-extracting the plasmid pART2A-irrE_(M2)Obtaining irrE_(W)Mutant gene irrE_(M2)。

Moreover, the arthrobacter simplex engineering strain has the following characteristics:

the strain shows excellent stress tolerance, and the stress conditions are that the concentration of ethanol is 0-6% and the concentration of methanol is 0-8%. Wherein the maximum OD of the engineered strain is at 6% ethanol and 8% methanol pressure growth conditions compared to control strain I₆₀₀Respectively improved by 10 to 125 percent and 1.9 to 128.1 percent; the high pressure impingement conditions were 16% ethanol, 20% methanol and 2.5mol/L salt. Wherein the maximum viable count under the impact of 16% ethanol, 20% methanol and 2.5mol/L salt was increased 338 each compared to control strain I.7% -524.2%, 103.7% -117.3% and 278.0% -380.7%; under a conversion system of 45g/L cortisone acetate and 8% ethanol, the viable count of the PM1210-IrrE (M2) engineering strain is respectively 4 times and 25 times that of the control strain II when the strain is fermented for 12 hours and 60 hours;

wherein, the control strain I contains a wild type promoter and a wild type irrE_(W)The control strain II was a strain containing an empty plasmid, and the above percentages were volume percentages.

The construction method of the engineering strain of arthrobacter simplex with excellent stress tolerance comprises the following steps:

⑴ construction of promoter mutants with different expression intensities and irrE_(W)Or irrE_(M2)The recombinant plasmid of (1)

Plasmid pART2A-irrE was treated with both BamHI and Xba I restriction enzymes_(W)Or pART2A-irrE_(M2)Obtaining irrE separately_(W)Or irrE_(M2)Replacing nucleotide fragments with EGFP fragments containing promoter mutants with different expression strengths and EGFP recombinant plasmids, transferring the obtained recombinant plasmids into escherichia coli DH5 α, culturing on a resistant plate containing 50ug/mL kanamycin at 37 ℃ overnight, re-extracting plasmids from positive transformants grown on the plate, and verifying by PCR, enzyme digestion and sequencing to obtain the recombinant plasmids containing the promoter mutants with different expression strengths and irrE_(W)Or irrE_(M2)The recombinant plasmid of (1);

⑵ construction of promoter mutants with different expression intensities and irrE_(W)Or irrE_(M2)Engineering strain of recombinant plasmid

Electrically transferring the correctly verified recombinant plasmid into a simply arthrobacter competent state, adding a sterile recovery culture medium, uniformly mixing, slowly shaking and culturing at 32 ℃ for 11h, coating the mixture on a resistant plate containing 50ug/mL kanamycin, carrying out inversion culture at 32 ℃ for 3-4 days, re-extracting the plasmid from a positive transformant growing on the plate, and verifying by PCR (polymerase chain reaction), enzyme digestion and sequencing to obtain promoter mutants containing different expression strengths and irrE_(W)Or irrE (M2) recombinant plasmid engineering strain, namely the simple arthrobacter engineering strain with excellent stress tolerance.

The application of the engineering strain of arthrobacter simplex with excellent stress tolerance in the aspect of biological transformation of steroids is disclosed.

Moreover, the addition amount of ethanol in the converted conversion system is 8 percent, the feeding concentration of a substrate Cortisone Acetate (CA) is increased to 15-45g/L, and the C concentration is_1,2The dehydrogenation yield is increased by 1.1-2.2 times compared with that of the control strain I.

The invention has the advantages and positive effects that:

1. the invention carries out fine regulation and directed evolution on the expression level of the global transcription factor IrrE by promoter engineering, global transcription mechanism engineering or a method combining the promoter engineering and the global transcription mechanism engineering, creates an arthrobacterium simplex engineering strain with excellent stress tolerance and provides a new strategy for constructing high-efficiency arthrobacterium simplex.

2. The invention provides a construction method for obtaining a promoter library with wide intensity distribution and obvious gradient difference, which mainly comprises random mutation of the whole promoter region, site-specific mutation of the promoter core region and optimization of the distance from a ribosome binding Site (SD) to an initiation codon (ATG). The three ideas act together to finally obtain a target promoter library suitable for Arthrobacter simplex, and an important regulation element is provided for the fine regulation of the expression level of the subsequent global transcription factor. The target promoter library has high expression strength, and the promoter sequence is SEQ ID NO. 12-SEQ ID NO.16 in the sequence table, so that the effect is good.

3. The invention obtains the excellent global transcription factor mutant, and the amino acid sequence of the global transcription factor mutant is SEQ ID NO.17 in the sequence table, thus having better effect.

4. The engineering strain of Arthrobacter simplex contains promoter regulatory elements with different expression strengths and irrE_(W)Or irrE (M2). Wherein, the sequences of the promoter regulatory elements with different expression intensities are as follows: SEQ ID NO.2, SEQ ID NO.12 to SEQ ID NO. 16. Wherein, the amino acid sequences of the IrrE wild type and the mutant are SEQ ID NO.1 and SEQ ID NO. 17. The strain of the present invention exhibits excellent stress tolerance. At appropriate pressures of 6% ethanol and 8% methanol compared to control strain IMaximum OD of engineered strain under vigorous growth conditions₆₀₀Respectively improved by 10 to 125 percent and 1.9 to 128.1 percent; the high pressure impingement conditions were 16% ethanol, 20% methanol and 2.5mol/L salt. Wherein, compared with the contrast strain I, the maximum viable count under the impact of 16 percent ethanol, 20 percent methanol and 2.5mol/L salt is respectively improved by 338.7 to 524.2 percent, 103.7 to 117.3 percent and 278.0 to 380.7 percent. Under a transformation system of 45g/L cortisone acetate and 8% ethanol, the viable count of the PM1210-IrrE (M2) engineering strain is respectively 4 times and 25 times that of a control strain II (strain containing empty plasmid) when the strain is fermented for 12h and 60 h;

5. the Arthrobacter simplex engineering strain can be applied to the aspect of biological transformation of steroid compounds, the addition amount of ethanol in a transformation system is 8%, and the feeding concentration of a substrate Cortisone Acetate (CA) is improved to 15-45 g/L. It C_1,2Dehydrogenation yields were compared to control strain I (containing wild-type promoter and wild-type irrE)_(W)) The improvement is 1.1 to 2.2 times.

Drawings

FIG. 1 is a graph showing EGFP fluorescence intensity of 33 promoter mutants relative to a wild-type promoter in E.coli in accordance with the present invention;

FIG. 2 is a graph (a) showing the relative fluorescence intensity and correlation analysis of expression intensity of EGFP expressed in E.coli and Arthrobacter simplex, respectively, from a library of promoter of interest according to the present invention;

FIG. 3 is a graph showing the relative expression levels of IrrE in the IrrE differentially expressed strains according to the present invention;

FIG. 4 is a graph showing the stress tolerance of IrrE differentially expressed strains according to the present invention; wherein (a): growth curve under 6% ethanol; (b) growth curve in 8% methanol; (c) survival after 1h impact with 16% (v/v) ethanol, 20% (v/v) methanol or 2.5mol/L NaCl;

FIG. 5 is a graph showing the stress tolerance of the engineered PWT-IrrE (M2) strain in the present invention; wherein (a): growth curve under 6% ethanol; (b) growth curve in 8% methanol; (c) survival after 1h impact with 16% (v/v) ethanol, 20% (v/v) methanol or 2.5mol/L NaCl;

FIG. 6 shows the mutant containing promoters of different strengths and irrE in the present invention_(W)Or irrE_(M2)Steroid C of series Arthrobacter simplex engineering strain of recombinant plasmid_1,2A dehydrogenation performance map; wherein, I: 15g/L CA, 8% ethanol; II: 35g/LCA, 8% ethanol; III: 45g/L CA, 8% ethanol.

Detailed Description

The following detailed description of the embodiments of the present invention is provided for the purpose of illustration and not limitation, and should not be construed as limiting the scope of the invention.

The raw materials used in the invention are conventional commercial products unless otherwise specified; the methods used in the present invention are conventional in the art unless otherwise specified.

Plasmid pART2A-irrE was treated with two restriction enzymes BamH I and Xba I_(W)Or pART2A-irrE_(M2)Obtaining irrE separately_(W)Or irrE_(M2)Replacing nucleotide fragments with EGFP fragments containing promoter mutants with different expression strengths and EGFP recombinant plasmids, transferring the obtained recombinant plasmids into escherichia coli DH5 α, culturing on a resistant plate containing 50ug/mL kanamycin at 37 ℃ overnight, re-extracting plasmids from positive transformants grown on the plate, and verifying by PCR, enzyme digestion and sequencing to obtain the recombinant plasmids containing the promoter mutants with different expression strengths and irrE_(W)Or irrE_(M2)The recombinant plasmid of (1);

Firstly, constructing a recombinant plasmid pART 2A-EGFP.

The present invention utilizes green fluorescent protein (EGFP) as a reporter gene to describe and characterize the strength of the promoter regulating its expression. In order to facilitate the replacement of the wild-type promoter, an EcoRV cleavage site needs to be introduced at the 5' end of the promoter hdnOp.

The specific method comprises the following steps:

(1) a nucleotide sequence of an EcoRV enzyme cutting site is introduced at the 5' end of a promoter hdnOp on a pART2 plasmid by using a pART2 vector as a template and primers pART2-F and pART 2-R.

pART2-F：CCCATGGTCTTGACAA

pART2-R：CCCATGGAGCGTCAGACCC

Table 1: PCR reaction system

The PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 64 ℃ for 30s, extension at 72 ℃ for 2min, and extension at 72 ℃ for 10min after 30 cycles.

The nucleotide sequence and the pART2 plasmid obtained above are respectively treated with restriction enzyme Nco I (37 ℃, 2h), target fragments are respectively recovered by utilizing a PCR product purification kit (Shanghai Bioengineering technology service Co., Ltd.), the plasmid and the nucleotide sequence after enzyme digestion are subjected to ligation reaction (16 ℃, 12h) according to the proportion of 1:3 (the ratio of the amount of substances), the ligation product is transferred into escherichia coli DH5 α, the plate is cultured overnight at 37 ℃, plasmids are re-extracted from positive transformants growing on the plate, and the plasmid pART2A is obtained after PCR, enzyme digestion and sequencing verification through screening.

(2) The green fluorescent protein is connected to the plasmid pART2A, and pART2A-EGFP is successfully constructed.

Second, construction and high-throughput screening of promoter library in escherichia coli

(1) Random mutations were introduced in the entire region of the wild-type promoter hdnOp on the recombinant plasmid pART 2A-EGFP. The specific method comprises the following steps: recombinant plasmid pART2A-EGFP as template, hdnOp-F and hdnOp-R as error-prone PCR primers, in Mn²⁺At a concentration of 0.5mM, Mg²⁺Random mutations were made to wild-type promoter hdnOp on plasmid pART2A-EGFP at concentrations of 4, 5, 6mM, respectively. The PCR amplification mutation reaction system is shown in Table 2, and the amplification conditions are pre-denaturation at 95 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 59 ℃ for 30s, extension at 72 ℃ for 1min, 30 cycles and extension at 72 ℃ for 10 min.

hdnOp-F：aggatatctcttgacaaggacaagtgtcc；

hdnOp-R：cgggatccatttccaactcctttgtctg；

Table 2: error-prone PCR reaction system

Omega e.z.n.a was used.^TMThe Cycle-Pure kit verifies the size of a strip through agarose gel electrophoresis, purifies a PCR product with the correct size, fully and uniformly mixes the PCR product, uses the PCR product as a template to perform a second round of error-prone PCR, connects the obtained PCR product to a plasmid pART2A-EGFP treated by the same restriction enzyme (EcoR V, BamH I), transfers the plasmid into Escherichia coli DH5 α, and plates the plasmid for overnight culture.

(2) Site-directed mutations were introduced between the wild-type promoter hdnOp SD to ATG on the recombinant plasmid parc 2A-EGFP. The specific method comprises the following steps: mutant primers designed to alter the number of bases between SD and ATG in the wild-type promoter hdnOp on recombinant plasmid pART2A-EGFP (Table 3). The recombinant plasmid pART2A-EGFP is used as a template, a PCR amplification mutation reaction system is shown in Table 1, and amplification conditions are pre-denaturation at 95 ℃ for 5 minutes, denaturation at 94 ℃ for 30s, annealing at 61 ℃ for 30s, extension at 72 ℃ for 1min, 30 cycles and extension at 72 ℃ for 10 min.

Table 3: mutation primer for changing base number between SD and ATG in wild type promoter hdnOp

The obtained PCR product was ligated to plasmid pART2A-EGFP treated with the same restriction enzymes (EcoR I, BamH I), transformed into E.coli DH5 α, plated overnight and cultured.

(3) Site-directed mutations were introduced in the wild-type promoter hdnOp core region-10 region on recombinant plasmid pART 2A-EGFP. The specific method comprises the following steps: recombinant plasmid pART2A-EGFP as template and-10_△C-F and-10_△CAnd (4) taking the-R as a primer, amplifying a whole plasmid with a deleted base C of a hdnOp promoter-10 region (TATCAAT) by using a NuoZan rapid site-directed Mutagenesis Kit Mut Express II Fast Mutagenesis Kit V2, transferring the whole plasmid into Escherichia coli DH5 α, and coating a plate for overnight culture.

-10_△C-F：tataatagggtgatcactctctcgaag；

-10_△C-R：gatcaccctattatacatggacagctg；

(4) 5mL of the sterilized PBS solution was added to the plate on which the colonies grew obtained in the above steps (1), (2), and (3), and the colonies were scraped with a sterilized large tip to prepare a bacterial suspension. The whole of the above bacterial suspension was transferred to a 250mL Erlenmeyer flask containing 50mL of LB medium (containing 50. mu.g/mL of kanamycin), and cultured overnight at 37 ℃ at 200 r/min. 1mL of the culture solution was put into a 1.5mL centrifuge tube, centrifuged at 3000r/min at 4 ℃ for 5min to collect the cells, washed twice with PBS buffer and resuspended. Diluting the bacterial liquid to OD₆₀₀0.1 to 0.5. The obtained cells were subjected to flow sorting using a flow cytometer MoFlo XDP flow cytometry Sorter (Beckman Coulter, USA). The fluorescence channel was chosen as excitation 488nm, emission wavelength was 530/40 channel. The flow cytometer purification mode was chosen to increase the proportion of positive clones in the screened library. Sorting Pre-fluorescence intensity 01-1% of cells. And (4) transferring all sorted strain culture solutions to a 5mL LB liquid culture medium test tube, and performing recovery culture at 37 ℃ at 200r/min for 8 h. 200. mu.L of the culture broth was spread on an LB plate containing 50. mu.g/mL kanamycin and isolated, and cultured overnight at 37 ℃.

(5) The single colonies grown on the plate were inoculated into 5mL tubes containing LB liquid medium containing 50. mu.g/mL kanamycin, and cultured at 37 ℃ for 14 hours with shaking at 200 r/min. The culture broth was transferred to fresh LB liquid medium and the initial OD of the culture broth was allowed to stand₆₀₀After centrifugation at 5000rpm/min for 2min to collect the cells at 0.1, 1mL of sterile water was added to wash the cells for 2 times, and the cells were resuspended in 1mL of sterile water to prepare a bacterial suspension. Adding 200 μ L bacterial suspension into transparent 96-well plate (Costar 96 Flat White) and Black 96-well plate (Costar 96 Flat Black), respectively, and detecting OD with microplate detector (BioTek, Synergy 4)₆₀₀And fluorescence intensity, with an excitation wavelength of 488nm and an emission wavelength of 520nm when detected.

Using the above method, a total of about 500 promoter mutants were obtained, and 33 samples with different (low, medium, and high) relative fluorescence intensities were selected to constitute a promoter library (as shown in FIG. 1) in combination with their relative fluorescence intensity distribution in E.coli.

Third, characterization of the target promoter library in E.coli and Arthrobacter simplex

From the above promoter library containing 33 samples with different intensities, 13 gradient-different promoters were selected to constitute the target promoter library according to the relative fluorescence intensity of FIG. 1. Extracting plasmid, transferring into Arthrobacter simplex by electric shock transformation, and detecting relative fluorescence intensity (RFU/OD)₆₀₀) And performing correlation analysis. As can be seen from FIG. 2a, the relative fluorescence intensity levels of these promoter mutants were from the lowest 247 (P)_M226SEQ ID NO.3) to the highest 3002 (P)_M798SEQ ID NO.16) with moderate span. The expression level of the wild promoter is 1, the relative expression intensity variation range of the promoter mutant is 26-316%, and the control of different intensities of target genes is satisfied. As can be seen from FIG. 2b, these promoter mutants have expression intensities in Arthrobacter simplex and Escherichia coliGood correlation (plot R)²0.9889). This indicates that the promoter element has good stability when the regulatory gene is expressed in different hosts.

Fourthly, construction and verification of IrrE differential expression strain

In order to obtain engineered strains of Arthrobacter simpliciens with better stress tolerance, P was selected in this example_M680，P_M470，P_M588，P_M1210，P_M798The 5 promoter mutants with gradient expression strength have the sequences of SEQ ID NO.9, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.15 and SEQ ID NO.16 in the sequence table respectively, and can regulate and control the expression of a wild type global transcription factor IrrE in Arthrobacter simplex respectively. The main experimental process is as follows:

(1) construction of promoters containing different expression intensities and irrE_(W)The recombinant plasmid of (1)

irrE is obtained by PCR amplification by taking a Deinococcus radiodurans (Deinococcus radiodurans) R1 genome as a template and irrE-F (cggggatccca gtgccaacgt cagcccc) and irrE-R (tgctctagac tggcagcgtcgcg) as primers_(W)The nucleotide fragment of the gene was ligated to pART2A plasmid treated with the same restriction enzymes (preferably BamH I, Xba I) to give recombinant plasmid pART2A-irrE_(W)。

The PCR amplification reaction system is shown in Table 4, and the amplification conditions are pre-denaturation at 95 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 63 ℃ for 30s, extension at 72 ℃ for 1min, 30 cycles and extension at 72 ℃ for 10 min.

Table 4: PCR reaction system

Replacing EGFP fragments on promoter mutants with different expression strengths and EGFP recombinant plasmids with the obtained PCR products, transforming into escherichia coli DH5 α, culturing overnight at 37 ℃ on a resistant plate containing 50ug/mL kanamycin, extracting plasmids from positive transformants grown on the plate, verifying through PCR, enzyme digestion and sequencing, and obtaining the promoter mutants with different expression strengths and irr through screeningE_(W)The recombinant plasmid of (1).

(2) Construction of promoters containing different expression intensities and irrE_(W)Simple arthrobacterium engineering strain

Electrically transferring the obtained recombinant plasmid into a simply arthrobacter competent state, adding a sterile recovery culture medium, uniformly mixing, slowly shaking and culturing at 32 ℃ for 11h, coating the mixture on a resistant plate containing 50ug/mL kanamycin, carrying out inverted culture at 32 ℃ for 3-4 days, re-extracting the plasmid from a positive transformant growing on the plate, and carrying out PCR (polymerase chain reaction), enzyme digestion and sequencing verification to obtain a promoter with different expression strengths and a wild irrE (irrE)_(W)The engineered strains of (1) are respectively named as PM680-IrrE (W), PM470-IrrE (W), PM588-IrrE (W), PM1210-IrrE (W) and PM798-IrrE (W).

(3) Expression level of IrrE in Arthrobacter simplex engineering strain

Respectively selecting IrrE differential expression engineering strains from the inclined plane, inoculating the IrrE differential expression engineering strains into a kanamycin LB liquid culture medium with the final concentration of 50ug/mL, and carrying out shaking culture at 32 ℃ and 160r/min for 40 h. Inoculating into fresh LB liquid culture medium (peptone 10g/L, yeast powder 5g/L, NaCl 10g/L) with an inoculum size of 4% (v/v), and performing shaking culture at 32 deg.C and 160r/min until bacterial liquid OD₆₀₀About 4.0.

Placing the culture solution on ice for at least 10min, centrifuging at 4 deg.C for 15min at 5000r/min, and collecting thallus. Washed twice with cooled PBS buffer, and 10mL of cell disruption solution was added to resuspend the cells by vortexing. And ultrasonically crushing the resuspended thalli under the ice bath condition until the bacterial liquid becomes transparent. Centrifuging at 4 deg.C and 6000r/min for 10min, collecting supernatant, preparing protein sample, and storing at-80 deg.C; then, performing SDS-PAGE electrophoresis, membrane transfer, blocking and antibody combined immunoreaction; and finally, scanning and imaging the PVDF film by using an Odyssey infrared laser imaging system, wherein the specific parameters are as follows: scan channel 700nm, scan 4 s. The Image J software is used for carrying out gray scanning on the target band and calculating the integrated optical density value (IOD), GAPDH (glyceraldehyde-3-phosphate dehydrogenase) is used as an internal reference in the experiment, and the expression level of IrrE protein is equal to the ratio of the IrrE band and the IOD of the internal reference band. As shown in FIG. 3, the expression level of IrrE protein in Arthrobacter simplex (PWT-IrrE (W)) for IrrE expression mediated by a wild-type promoter is set to be 1, and the expression levels of IrrE protein in Arthrobacter simplex IrrE differential expression strains PM470-IrrE (W), PM588-IrrE (W), PM680-IrrE (W), PM798-IrrE (W) and PM1210-IrrE (W) are respectively 1.09, 1.44, 1.18, 2.10 and 1.70, which indicates that the construction of the Arthrobacter simplex IrrE differential expression strains is successful.

Fifthly, analyzing the stress tolerance of IrrE differential expression engineering strains

(1) Growth conditions of IrrE differential expression engineering strain under different concentrations of ethanol and methanol

Selecting IrrE differential expression engineering strains PM680-IrrE (W), PM470-IrrE (W), PM588-IrrE (W), PM1210-IrrE (W), PM798-IrrE (W), and control strain I (containing wild promoter and wild irrE)_(W)) PWT-IrrE (W)) and control strain II (containing empty plasmid, pART2A) were inoculated in liquid LB medium containing kanamycin to a final concentration of 50ug/mL, shake-cultured at 32 ℃ and 160r/min for 40 hours, inoculated in a certain amount into a fresh liquid medium containing 6% (v/v) ethanol or 8% (v/v) methanol, and the initial OD was adjusted₆₀₀Concordant (0.2), shaking and culturing at 32 deg.C and 160r/min, sampling at regular intervals, and determining OD₆₀₀And drawing a growth curve of the strain under appropriate pressure. Kanamycin with the final concentration of 50ug/mL is required to be added into the culture medium containing the plasmid strain in the experiment. As shown in FIG. 4(a), in the growth system with 6% ethanol, 6 IrrE differential expression strains of Arthrobacter simplex all showed good growth ability and the maximum OD₆₀₀Between 2.0 and 2.9. Wherein the PM798-IrrE (W) strain has the best growth performance, and OD is obtained after 72 hours of culture₆₀₀The value reached 2.9, the maximum OD of the control strain I₆₀₀Is 2.0; no significant growth was seen for control strain II. FIG. 4(b) shows that the growth performance (maximum OD) of IrrE differentially expressed strain of Arthrobacter simplex under the growth system with 8% methanol added₆₀₀Between 3.2 and 7.3). Wherein, the PM798-IrrE (W) strain has the best growth performance, and OD is obtained after 72 hours of culture₆₀₀The value reached a maximum of 7.3, the maximum OD of the control strain I₆₀₀Is 3.2; control Strain II maximum OD₆₀₀The value was 2.1.

(2) Survival condition of IrrE differential expression engineering strain under high-concentration pressure impact

Respectively selecting IrrE differential expression engineering strains PM680-IrrE (W), PM470-IrrE (W), PM588-IrrE (W), PM1210-IrrE (W), PM798-IrrE (W), a reference strain I (containing a wild promoter and wild IrrE, PWT-IrrE (W)) and a reference strain II (containing an empty plasmid, pART2A) from a slant, inoculating the strains into a kanamycin liquid LB culture medium with a final concentration of 50ug/mL, carrying out shaking culture at 32 ℃ and 160r/min for 40h, inoculating the strains into a fresh LB liquid culture medium with a certain inoculation amount, and inoculating an initial OD₆₀₀The values were all adjusted to 1.0. 1mL of the culture medium was added to 4mL of 50ug/mL kanamycin LB liquid medium containing 16% ethanol, 18% methanol and 2.5mol/L NaCl, respectively, and the mixture was shaken at 160r/min at 32 ℃ for 1 hour. Culturing the culture solution on an LB plate by adopting a 10-time stepwise dilution method, culturing for a certain time at 32 ℃, observing the survival condition of the plate strain, and calculating the survival rate.

As shown in FIG. 4(c), the survival rate of the IrrE differentially expressed strain of Arthrobacter simplex after 1h of ethanol impact at 16% (v/v) was between 10.7% and 66.8%. Among them, the PM798-irrE strain showed the highest survival rate, which reached 66.8%, the survival rate of the control strain I was 10.7%, and the survival rate of the control strain II was only 6.3%; after 20% (v/v) methanol impact for 1h, the survival rate of the IrrE differential expression strain of the arthrobacter simplex is between 29.7% and 82.4%. Wherein, PM798-IrrE (W) has the highest survival rate, which reaches 82.4 percent, the survival rate of the control strain I is 29.7 percent, and the survival rate of the control strain II is 23.4 percent. The survival rate of the strain under the condition of impacting 2.5mol/L NaCl for 1h is further examined, and the result shows that the survival rate of the IrrE differential expression strain of the Arthrobacter simplex is between 17.2% and 82.7%. Wherein, PM798-IrrE (W) has the highest survival rate which reaches 82.7 percent, the survival rate of a control strain I is 17.2 percent, and the survival rate of a control strain II is 13.4 percent; the above results demonstrate that an increase in the expression level of IrrE in the host organism significantly enhances the stress tolerance of the strain.

Construction of six, irrE mutant libraries

(1) Establishment of error-prone PCR conditions

Alignment of wild type irrE by one round of error-prone PCR_(W)Gene randomizationAnd (4) mutation. In the error-prone PCR reaction system, irrE-F and irrE-R are used as primers, and pART2A-irrE is used_(W)Plasmid as template, Mg at different concentrations²⁺(2, 3, 4, 5, 6 and 7mmol/L), Mn²⁺(0.1, 0.2, 0.25, 0.3, 0.35, 0.4 and 0.45mmol/L), different template additions (5, 3, 1 and 0.5ng) and unequal concentrations of dNTPs (molar ratio a: T: C: G ═ 1:5:1: 5).

irrE-F：cgggatccca gtgccaacgt cagccc

irrE-R：tgctctagac tgtgcagcgt cctgcg

The PCR amplification mutation reaction system is shown in Table 6, and the amplification conditions are pre-denaturation at 95 ℃ for 5 minutes, denaturation at 94 ℃ for 30s, annealing at 63 ℃ for 30s, extension at 72 ℃ for 1min, 30 cycles and extension at 72 ℃ for 10 min.

Table 6: PCR reaction system

Conditions for obtaining error-prone PCR were optimized: mg (magnesium)²⁺The concentration is 3mmol/L, Mn²⁺The concentration is 0.3mmol/L, and the adding amount of the template is 0.5 ng.

(2) Obtaining irrE mutant library

PCR amplification was performed using the error-prone PCR conditions of (1) above, and the PCR product was ligated to plasmid pART2A-irrE treated with the same restriction enzyme_(W)Then, the ligation products were electroporated into the sensitive cells of Arthrobacter simplex, cultured overnight at 32 ℃ in an inverted state on LB solid medium containing 50. mu.g/mL kanamycin, and colonies grown on the plate were scraped off to prepare a cell number of 10⁵The liquid library of (1).

Screening of Excellent mutants of hepta and irrE

(1) The liquid mutation library was inoculated into LB liquid medium containing 50. mu.g/mL kanamycin at the final concentration, cultured at 32 ℃ to several days and then transferred to the same medium for secondary culture, the transfer was continued 2 to 3 times, the concentration of ethanol in the medium was increased by a gradient of 2% (v/v) increase for each transfer until the concentration of ethanol was 8%, and the culture solution under 8% conditions was spread on LB solid plate containing 50. mu.g/mL kanamycin and cultured overnight at 32 ℃.

(2) Selecting several single colonies growing on the plate, inoculating in 50mL LB liquid culture medium containing 50ug/mL kanamycin, culturing at 32 deg.C and 160r/min under shaking for 48 hr, inoculating the partial bacterial liquid into 250mL triangular flask containing 50mL liquid LB culture medium containing 50ug/mL kanamycin and 0%, 4%, 6% ethanol, and using LB liquid culture medium to obtain the initial OD of the above bacterial strain culture liquid₆₀₀Adjusting the values to 0.2, 32 deg.C, 160r/min, shaking for culture, and sampling at intervals to determine OD₆₀₀The value is obtained. The growth performance is obviously higher than that of wild irrE_(W)Strains of the recombinant strain are identified as candidate mutants having improved tolerance to organic solvents.

(3) The initial selection of a strain I (containing a wild-type promoter and a wild-type irrE) with a higher growth rate than the control strain I_(W)) Then re-screening on the basis of the strain to screen out the growth rate and the maximum OD₆₀₀All higher than control strain I. Primarily screening out strains with growth rate higher than that of a control strain I through primary screening and secondary screening of ethanol with gradient concentration, wherein the control strain I contains a wild type promoter and a wild type irrE_(W)Then re-screening on the basis of the strain to screen out the growth rate and the maximum OD₆₀₀All the strains are higher than the control strain I, finally obtaining the optimal resistant strain PWT-IrrE (M2), and obtaining 1 strain PWT-IrrE (M2) with improved ethanol tolerance. Culturing the excellent resistant strain PWT-IrrE (M2), and re-extracting plasmid pART2A-irrE_(M2)The sequencing was performed by Jinzhi Biotechnology, Inc., Suzhou. The sequencing results are shown in the list: SEQ ID NO. 17. The mutant irrE_(W)Compared with a wild type, 6 mutations occur in the nucleotide sequence, namely, G at the 332 th position is mutated into A; the 388G mutation is A; 489 mutation of A to G; the 545A mutation is G; the 663C is mutated into T; 688A mutation is G. The corresponding amino acid has 4 mutation sites, namely Arg111His, Asp130Asn, Glu182Gly and Ser230 Gly.

Eighthly, analysis of stress tolerance of Arthrobacter simplex PWT-IrrE (M2)

Respectively picking PWT-IrrE (M2) engineering from inclined planeThe strain, control strain I (PWT-IrrE) and control strain II (pART2A) were inoculated into a liquid LB medium containing 50ug/mL of kanamycin to a final concentration, cultured with shaking at 32 ℃ and 160r/min for 40 hours, inoculated into a fresh liquid LB medium containing 6% (v/v) ethanol or 8% (v/v) methanol to a final concentration of 50ug/mL of kanamycin in a predetermined amount, and the initial OD was measured₆₀₀Concordant (0.2), shaking and culturing at 32 deg.C and 160r/min, sampling at regular intervals, and determining OD₆₀₀And drawing a growth curve of the strain under appropriate pressure. As shown in FIG. 5(a), in the growth system with 6% ethanol, the strain PWT-IrrE (M2) showed better growth performance than other strains, and the maximum OD₆₀₀Up to 4.5 OD, compared with control strain I and control strain II₆₀₀2.0 and 0.5 respectively. From 5(b), it was found that OD was not observed when the PWT-IrrE (M2) strain was cultured for 60 hours in a growth system in which 8% methanol was added₆₀₀The maximum OD reached 5.1, while the OD of the control strain I and the control strain II was then obtained₆₀₀Respectively 3.2 and 2.1.

(2) Survival of the PWT-IrrE (M2) Strain under high concentration pressure shocks

Respectively picking up an IrrE excellent mutant expression strain PWT-IrrE (M2), a control strain I (PWT-IrrE (W)), and a control strain II (pART2A) from a slant, inoculating the above strains into a liquid LB medium containing 50ug/mL kanamycin at a final concentration, shaking-culturing at 32 ℃ and 160r/min for 40h, transferring the obtained strain into a fresh LB liquid medium containing 50ug/mL kanamycin at a final concentration in a certain amount, and inoculating the original strain OD₆₀₀The values were all adjusted to 1.0. 1mL of the culture medium was added to 4mL of LB liquid media containing 16% ethanol, 20% methanol and 2.5mol/L NaCl, respectively, and the mixture was shaken at 160r/min at 32 ℃ for 1 hour. Culturing the culture solution on an LB plate by adopting a 10-time stepwise dilution method, culturing for a certain time at 32 ℃, observing the survival condition of the plate strain, and calculating the survival rate.

As seen from 5(c), after 1 hour of ethanol impact at 16% (v/v), the survival rate of the PWT-IrrE (M2) strain was 15.4%, that of the control strain I was 10.7%, and that of the control strain II was only 6.3%; after 1h of 20% (v/v) methanol shock, the survival rate of the PWT-IrrE (M2) strain was 34.4%, and the survival rates of the control strain II and the control strain I were 29.7% and 23.4%, respectively; after 1h of 2.5mol/L NaCl shock, the survival rate of the PWT-IrrE (M2) strain was 24.1%, and the survival rates of the control strain I and the control strain II were 17.2% and 13.4%, respectively.

The above results indicate that the PWT-IrrE (M2) strain exhibits better stress tolerance.

Nine, containing promoter mutants of different strengths and irrE_(M2)Construction of the Arthrobacter simplex engineering Strain

This example selects P_M1210And P_M798The 2 promoter mutants with higher expression strength and the wild hdnOp promoter mediate the expression of IrrE (M2) in arthrobacter simplex. The construction process of the engineering strain is as follows:

(1) construction of mutants containing promoters of different strengths and irrE_(M2)The recombinant plasmid of (1)

Plasmid pART2A-irrE was treated with two restriction enzymes BamH I and Xba I_(M2)Obtaining irrE_(M2)The nucleotide fragment is used for replacing the EGFP fragment on the plasmid pART2A-EGFP, the obtained recombinant plasmid is transferred into escherichia coli DH5 α, the escherichia coli DH5 α is cultured on a resistant plate containing 50ug/mL kanamycin at 37 ℃ overnight, plasmids of positive transformants grown on the plate are re-extracted, and PCR, enzyme digestion and sequencing verification are carried out to obtain promoter mutants containing different expression strengths and irrE_(M2)The recombinant plasmid of (1).

(2) Construction of mutants containing promoters of different strengths and irrE_(M2)Engineering strains of recombinant plasmids of (1)

Electrically transferring the obtained recombinant plasmid into a simply arthrobacter competent state, adding a sterile recovery culture medium, uniformly mixing, slowly shaking and culturing at 32 ℃ for 11h, coating the mixture on a resistant plate containing 50ug/mL kanamycin, performing inverted culture at 34 ℃ for 3-4 days, re-extracting the plasmid from a positive transformant growing on the plate, and performing PCR (polymerase chain reaction), enzyme digestion and sequencing verification to obtain engineering strains containing irrE (M2) recombinant plasmids regulated and controlled by promoter mutants with different expression strengths, namely PM1210-IrrE (M2) and PM798-IrrE (M2).

Ten, steroid C of Arthrobacter simplex engineering strain_1,2Performance of dehydrogenation reaction

(1) Preparation of resting cells

Selecting PWT-IrrE (M2), PM798-IrrE (W), PM1210-IrrE (M2), PM798-IrrE (M2), control strain I (PWT-IrrE (W)) and control strain II (pART2A) from the inclined plane, inoculating into liquid LB culture medium containing 50ug/mL kanamycin resistance at final concentration, culturing at 32 deg.C and 160r/min with shaking for 40h, inoculating into liquid LB culture medium containing 50ug/mL kanamycin resistance at final concentration, and inoculating the initial OD₆₀₀Concocting to be consistent (0.2), culturing at 32 deg.C under shaking at 160r/min to logarithmic phase growth phase, adding substrate Cortisone Acetate (CA) with final concentration of 0.5g/L to induce C_1,2Producing dehydrogenase, culturing at 32 deg.C and 160r/min under shaking for 18h, centrifuging at 7000r/min and 4 deg.C for 10min, collecting thallus, and adding precooled KH of 0.1M with pH of 7.2₂PO₄The cells were washed 2 times with NaOH solution (PBS buffer solution) and suspended in an appropriate amount of PBS buffer solution to prepare resting cells.

(2) Steroid substrate conversion

The transformation system includes the following three types:

transformation System I-thallus OD₆₀₀2.0, the concentration of a substrate CA is 15g/L, and the dissolution is assisted by 8 percent ethanol;

transformation System II-bacterial OD₆₀₀2.0, the concentration of a substrate CA is 35g/L, and the dissolution is assisted by 8 percent ethanol;

transformation System III-bacterial OD₆₀₀2.0, substrate CA concentration 45g/L, 8% ethanol to aid dissolution.

After shaking and converting at 34 ℃ and 180r/min for a period of time, samples are taken from the three systems respectively to determine the concentration of the product Prednisone Acetate (PA). 0.2mL of each sample was added with 1.6mL of ethyl acetate to terminate the reaction, the reaction was extracted by sonication for 10min or more, centrifuged at 12000r/min for 10min, and the amount of the product produced was measured by HPLC.

The HPLC detection conditions are as follows:

high performance liquid chromatograph: agilent 1100 Series LC (G1314 Pump, G1322ADEGASSERG1314VWD detector, 10uL, AN sampler, HP ChemStation);

a chromatographic column: AgelaVenusal XBP Silica: 250 mm. times.4.6 mm. times.5 μm;

mobile phase: dichloromethane: diethyl ether: methanol (86: 12: 2);

column temperature: 30 ℃;

sample introduction amount: 10 mu L of the solution;

flow rate: 1.0 mL/min;

a detector: UV detector, wavelength: 240 nm.

As shown in FIG. 6, the yield of prednisolone acetate PA produced by the engineering strain transformed by cortisone acetate was improved to a different extent in different transformation systems compared with the control strain I. The engineering strain still keeps good activity under a conversion system of a high-concentration organic solvent (8%) and a substrate (15-45g/L), and C of the engineering strain_1,2The dehydrogenation yield is improved by 1.1-2.2 times compared with that of the control strain. In system II, the maximum production amounts of prednisone acetate of the excellent tolerance strains PWT-IrrE (M2), PM798-IrrE (W), PM1210-IrrE (M2) and PM798-IrrE (M2) are respectively as follows: 24.5, 20.3, 23.3, 26.8 and 29.5g/L, which are respectively improved by 1.8, 1.5, 1.7, 2.0 and 2.2 times compared with the control strain I (13.7 g/L).

Eleven, survival of the optimal engineered and control strains II in the dehydrogenation reaction System of steroid C1,2

Respectively selecting optimal engineering strain PM1210-IrrE (M2) and control strain II (containing empty plasmid, pART2A) from inclined plane, inoculating into liquid LB culture medium containing kanamycin with final concentration of 50ug/mL, shake culturing at 32 deg.C and 160r/min for 40h, inoculating into fresh liquid culture medium with kanamycin resistance with final concentration of 50ug/mL, and inoculating initial OD₆₀₀And (3) adjusting to be consistent (0.2), carrying out shaking culture at 32 ℃ and 160r/min until the logarithmic phase growth phase, adding a substrate Cortisone Acetate (CA) with the final concentration of 0.5g/L to induce C1, producing dehydrogenase at position 2, carrying out further shaking culture at 32 ℃ and 160r/min for 18h, and then adding 45g/L CA and 8% ethanol to carry out a fermentation experiment. Taking 100uL of fermentation liquid during 12h and 60h of fermentation, culturing the culture liquid on an LB plate (adding kanamycin with the final concentration of 50 mu g/mL) by adopting a 10-time stepwise dilution method, and counting the plates after culturing for a certain time at 32 ℃.

The experimental result shows that fermentation is carried out under a conversion system of 45g/L cortisone acetate and 8% ethanol12h, the number of the living bacteria of the optimal engineering strain is 6.0 multiplied by 10⁶(CFU/mL), is control strain II (1.5X 10)⁶(CFU/mL)) 4 times; after 60 hours of fermentation, the number of viable bacteria of the optimal engineering strain is 5.0 multiplied by 10⁴(CFU/mL), is control strain II (2.0X 10)³(CFU/mL)) 25 times the total volume of the sample.

Sequence listing

SEQ ID NO.1

Amino acid sequence coded by wild irrE gene

ValProSerAlaAsnValSerProProCysProSerGlyValArgGlyGlyGlyMetGlyProLysAlaLysAlaGluAlaSerLysProHisProGlnIleProValLysLeuProPheValThrAlaProAspAlaLeuAlaAlaAlaLysAlaArgMetArgAspLeuAlaAlaAlaTyrValAlaAlaLeuProGlyArgAspThrHisSerLeuMetAlaGlyValProGlyValAspLeuLysPheMetProLeuGlyTrpArgAspGlyAlaPheAspProGluHisAsnValIleLeuIleAsnSerAlaAlaArgProGluArgGlnArgPheThrLeuAlaHisGluIleGlyHisAlaIleLeuLeuGlyAspAspAspLeuLeuSerAspIleHisAspAlaTyrGluGlyGluArgLeuGluGlnValIleGluThrLeuCysAsnValAlaAlaAlaAlaIleLeuMetProGluProValIleAlaGluMetLeuGluArgPheGlyProThrGlyArgAlaLeuAlaGluLeuAlaLysArgAlaGluValSerAlaSerSerAlaLeuTyrAlaLeuThrGluGlnThrProValProValIleTyrAlaValCysAlaProGlyLysProProArgGluGlnAlaAlaSerAspGluAspAlaGlyProSerThrGluLysValLeuThrValArgAlaSerSerSerThrArgGlyValLysTyrThrLeuAlaSerGlyThrProValProAlaAspHisProAlaAlaLeuAlaLeuAlaThrGlyMetGluValArgGluGluSerTyrValProPheArgSerGlyArgLysMetLysAlaGluValAspAlaTyrProSerArgGlyIleValAlaValSerPheGluPheAspProAlaArgLeuGlyArgLysAspSerGluGlnAlaAspArgAspGluProGlnAspAlaAlaGln

Nucleotide sequence of wild promoter

SEQ ID NO.2

GTCTTGACAAGGACAAGTGTCCATGTCAGGGACAAAGAGCGATGTGTTCCGGCCTCCCCTAGTCCCGCAAAAATAACCCCCATTGACATGGACAGCTGTCCATGTATCAATAGGGTGATCACTCTCTCGAAGACGAGAATGCTGATTGTCAGCAGACAAAGGAGTTGGAAAT

Promoter mutant nucleotide sequence

SEQ ID NO.3

GTCTTGACAAGCACAAGTGTCCTTGTCAGGGACAAAGAGCGATGTGTTCCGGCCTCCCCTAGTCCCGCAAAAATAACCCCCATTGACATGGACAGCTGTCCATGTATCAATAGGGTGATCACTCTCTCGAAGACGAGAATGCTGATTGACAGCAGACAAAGGAGTTGGAAAT

SEQ ID NO.4

SEQ ID NO.5

SEQ ID NO.6

GTCTTGACAAGGACAAGTGTCCTTGTCAGGGACAAAGAGCGATGTGTTCCGGCCCCCCCTAGTCCCGCAAAAGTATCCCCCATTGACATGGACAGCTGTCCATGTTTCAATAGGGTGATCACTCTCTTGAAGACGAGAATGCAGATTGTCAGCAGACAAAGGAGTTGGAAAT

SEQ ID NO.7

GTCTTGACAAGGACAAGTGTCCATGTCAGGGACAAAGAGCGATGTGTTCCGGCCTCCCCTAGTCCCGCAAAAATAACCCCCATTGACATGGACAGCTGTCCATGTATCAATAGGGTGATCACTCTCTCGAAGACGAGAATGCTGATTGTCAGCAGACAAAGGAGTTGGAATTAT

SEQ ID NO.8

GTCTTGACAAGGACAAGTGTCCATGTCAGGGACAAAGAGCGATGTGTTCCGGCCTCCCCTAGTCCCGCAAAAATAACCCCCATTGACATGGACAGCTGTCCATGTATCAATAGGGTGATCACTCTCTCGAAGACGAGAATGCTGATTGTCAGCAGACAAAGGAGTTGGAAAAT

SEQ ID NO.9

GTCTTGACAAGGACAAGTGTCCTTGTCAGGGACAAAGAGCGAAGTGTTCCGGCCTCCCCTAGTCCCGCAAAAATAACCCCCATTGACATGGGCAGCTGTCCATGTATCAATAGGGTGATCACTCTCTCGAAGACGAGAATGCTGATTGTCTGCAGACAAAGGAGTTGGAAAT

SEQ ID NO.10

GTCTTGACAAGGACAAGTGTCCATGTCAGGGACAAAGAGCGATGTGTTCCGGCCTCCCCTAGTCCCGCAAAAATAACCCCCATTGACATGGACAGCTGTCCATGTATCAATAGGGTGATCACTCTCTCGAAGACGAGAATGCTGATTGTCAGCAGACAAAGGAGTTGGTAAATTAT

SEQ ID NO.11

GTCTTGACAAGGACAAGTGTCCATGTCAGGGACAAAGAGCGATGTGTTCCGGCCTCCCCTAGTCCCGCAAAAATAACCCCCATTGACATGGACAGCTGTCCATGTATCAATAGGGTGATCACTCTCTCGAAGACGAGAATGCTGATTGTCAGCAGACAAAGGAGTTGGAAATTAT

SEQ ID NO.12

GTCTTGACAAGGACAAGTGTCCTTGTCAGGGACAAAGAGCGATGTGTTCCGGCCTCCCCTAGTCCCGCAAAAATAACCCCCATTGACTTGGACAGCTGTCCATGTATCAATAGGGTGATCACTCTCTCGAAGACGAGAATGCTGATTGTCAGCAGACAAAGGAGTTGGAAAT

SEQ ID NO.13

GTCTCGACAAGGACAAGTGTCCTTGTCAGGGACAAAGAGCGATGTGTTCCGGCCTCCCCTAGTCCCGCAAAAGTAACCCCCATTGACATGGACAGCTGTCCATGTATCAATAGGGTGATCACTCTCTTGAATACGAGAATGCTGATTGTCAGCAGACAAAGGAGTTGGAAAT

SEQ ID NO.14

GTCTTGACAAGGACAAGTGTCCATGTCAGGGACAAAGAGCGATGTGTTCCGGCCTCCCCTAGTCCCGCAAAAATAACCCCCATTGACATGGACAGCTGTCCATGTAT.AATAGGGTGATCACTCTCTCGAAGACGAGAATGCTGATTGTCAGCAGACAAAGGAGTTGGAAAT

SEQ ID NO.15

SEQ ID NO.16

GTCTTGACAAGGACAAGTGTCCATGTCAGGGACAAAGAGCGATGTATCCCGGCCTCCCCTAGTCCCGCAAAAGTAACCCCCATTGACATGGACAGCTGTCCATGTTTCAATAGGGTGATCACTCTCTTGAAGACGAGAATGCTGATTGTCGGCAGACAAAGGAGTTGGAAAT

SEQ ID NO.17

Mutant irrE_(M2)Gene-encoded amino acid sequences

ValProSerAlaAsnValSerProProCysProSerGlyValArgGlyGlyGlyMetGlyProLysAlaLysAlaGluAlaSerLysProHisProGlnIleProValLysLeuProPheValThrAlaProAspAlaLeuAlaAlaAlaLysAlaArgMetArgAspLeuAlaAlaAlaTyrValAlaAlaLeuProGlyArgAspThrHisSerLeuMetAlaGlyValProGlyValAspLeuLysPheMetProLeuGlyTrpArgAspGlyAlaPheAspProGluHisAsnValIleLeuIleAsnSerAlaAlaArgProGluHisGlnArgPheThrLeuAlaHisGluIleGlyHisAlaIleLeuLeuGlyAspAspAsnLeuLeuSerAspIleHisAspAlaTyrGluGlyGluArgLeuGluGlnValIleGluThrLeuCysAsnValAlaAlaAlaAlaIleLeuMetProGluProValIleAlaGluMetLeuGluArgPheGlyProThrGlyArgAlaLeuAlaGlyLeuAlaLysArgAlaGluValSerAlaSerSerAlaLeuTyrAlaLeuThrGluGlnThrProValProValIleTyrAlaValCysAlaProGlyLysProProArgGluGlnAlaAlaSerAspGluAspAlaGlyProGlyThrGluLysValLeuThrValArgAlaSerSerSerThrArgGlyValLysTyrThrLeuAlaSerGlyThrProValProAlaAspHisProAlaAlaLeuAlaLeuAlaThrGlyMetGluValArgGluGluSerTyrValProPheArgSerGlyArgLysMetLysAlaGluValAspAlaTyrProSerArgGlyIleValAlaValSerPheGluPheAspProAlaArgLeuGlyArgLysAspSerGluGlnAlaAspArgAspGluProGlnAspAlaAlaGln

Although the embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that: various substitutions, changes and modifications are possible without departing from the spirit and scope of the invention and the appended claims, and therefore the scope of the invention is not limited to the embodiments disclosed.

Sequence listing

<110> Tianjin science and technology university

<120> construction method of Arthrobacter simplex engineering strain with excellent stress tolerance, strain and application thereof

<160>30

<170>SIPOSequenceListing 1.0

<210>1

<211>328

<212>PRT

<213> amino acid sequence encoded by wild type irrE gene (Unknown)

<400>1

Val Pro Ser Ala Ala Val Ser Pro Pro Cys Pro Ser Gly Val Ala Gly

1 5 10 15

Gly Gly Met Gly Pro Leu Ala Leu Ala Gly Ala Ser Leu Pro His Pro

20 25 30

Gly Ile Pro Val Leu Leu Pro Pro Val Thr Ala Pro Ala Ala Leu Ala

35 40 45

Ala Ala Leu Ala Ala Met Ala Ala Leu Ala Ala Ala Thr Val Ala Ala

50 55 60

Leu Pro Gly Ala Ala Thr His Ser Leu Met Ala Gly Val Pro Gly Val

65 70 75 80

Ala Leu Leu Pro Met Pro Leu Gly Thr Ala Ala Gly Ala Pro Ala Pro

85 90 95

Gly His Ala Val Ile Leu Ile Ala Ser Ala Ala Ala Pro Gly Ala Gly

100 105 110

Ala Pro Thr Leu Ala His Gly Ile Gly His Ala Ile Leu Leu Gly Ala

115 120 125

Ala Ala Leu Leu Ser Ala Ile His Ala Ala Thr Gly Gly Gly Ala Leu

130 135 140

Gly Gly Val Ile Gly Thr Leu Cys Ala Val Ala Ala Ala Ala Ile Leu

145 150 155 160

Met Pro Gly Pro Val Ile Ala Gly Met Leu Gly Ala Pro Gly Pro Thr

165 170 175

Gly Ala Ala Leu Ala Gly Leu Ala Leu Ala Ala Gly Val Ser Ala Ser

180 185 190

Ser Ala Leu Thr Ala Leu Thr Gly Gly Thr Pro Val Pro Val Ile Thr

195 200 205

Ala Val Cys Ala Pro Gly Leu Pro Pro Ala Gly Gly Ala Ala Ser Ala

210 215 220

Gly Ala Ala Gly Pro Ser Thr Gly Leu Val Leu Thr Val Ala Ala Ser

225 230 235 240

Ser Ser Thr Ala Gly Val Leu Thr Thr Leu Ala Ser Gly Thr Pro Val

245 250 255

Pro Ala Ala His Pro Ala Ala Leu Ala Leu Ala Thr Gly Met Gly Val

260 265 270

Ala Gly Gly Ser Thr Val Pro Pro Ala Ser Gly Ala Leu Met Leu Ala

275 280 285

Gly Val Ala Ala Thr Pro Ser Ala Gly Ile Val Ala Val Ser Pro Gly

290 295 300

Pro Ala Pro Ala Ala Leu Gly Ala Leu Ala Ser Gly Gly Ala Ala Ala

305 310 315 320

Ala Gly Pro Gly Ala Ala Ala Gly

325

<210>2

<211>172

<212>DNA/RNA

<213> wild-type promoter hdnOp nucleotide sequence (Unknown)

<400>2

gtcttgacaa ggacaagtgt ccatgtcagg gacaaagagc gatgtgttcc ggcctcccct 60

agtcccgcaa aaataacccc cattgacatg gacagctgtc catgtatcaa tagggtgatc 120

actctctcga agacgagaat gctgattgtc agcagacaaa ggagttggaa at 172

<210>3

<211>172

<212>DNA/RNA

<213> nucleotide sequence of promoter mutant (Unknown)

<400>3

gtcttgacaa gcacaagtgt ccttgtcagg gacaaagagc gatgtgttcc ggcctcccct 60

agtcccgcaa aaataacccc cattgacatg gacagctgtc catgtatcaa tagggtgatc 120

actctctcga agacgagaat gctgattgac agcagacaaa ggagttggaa at 172

<210>4

<211>172

<212>DNA/RNA

<213> nucleotide sequence of promoter mutant (Unknown)

<400>4

gtcttgacaa gcacaagtgt ccttgtcagg gacaaagagc gatgtgttcc ggcctcccct 60

agtcccgcaa aaataacccc cattgacatg gacagctgtc catgtatcaa tagggtgatc 120

actctctcga agacgagaat gctgattgac agcagacaaa ggagttggaa at 172

<210>5

<211>172

<212>DNA/RNA

<213> nucleotide sequence of promoter mutant (Unknown)

<400>5

gtcttgacaa gcacaagtgt ccttgtcagg gacaaagagc gatgtgttcc ggcctcccct 60

agtcccgcaa aaataacccc cattgacatg gacagctgtc catgtatcaa tagggtgatc 120

actctctcga agacgagaat gctgattgac agcagacaaa ggagttggaa at 172

<210>6

<211>172

<212>DNA/RNA

<213> nucleotide sequence of promoter mutant (Unknown)

<400>6

gtcttgacaa ggacaagtgt ccttgtcagg gacaaagagc gatgtgttcc ggccccccct 60

agtcccgcaa aagtatcccc cattgacatg gacagctgtc catgtttcaa tagggtgatc 120

actctcttga agacgagaat gcagattgtc agcagacaaa ggagttggaa at 172

<210>7

<211>174

<212>DNA/RNA

<213> nucleotide sequence of promoter mutant (Unknown)

<400>7

gtcttgacaa ggacaagtgt ccatgtcagg gacaaagagc gatgtgttcc ggcctcccct 60

agtcccgcaa aaataacccc cattgacatg gacagctgtc catgtatcaa tagggtgatc 120

actctctcga agacgagaat gctgattgtc agcagacaaa ggagttggaa ttat 174

<210>8

<211>173

<212>DNA/RNA

<213> nucleotide sequence of promoter mutant (Unknown)

<400>8

gtcttgacaa ggacaagtgt ccatgtcagg gacaaagagc gatgtgttcc ggcctcccct 60

agtcccgcaa aaataacccc cattgacatg gacagctgtc catgtatcaa tagggtgatc 120

actctctcga agacgagaat gctgattgtc agcagacaaa ggagttggaa aat 173

<210>9

<211>172

<212>DNA/RNA

<213> nucleotide sequence of promoter mutant (Unknown)

<400>9

gtcttgacaa ggacaagtgt ccttgtcagg gacaaagagc gaagtgttcc ggcctcccct 60

agtcccgcaa aaataacccc cattgacatg ggcagctgtc catgtatcaa tagggtgatc 120

actctctcga agacgagaat gctgattgtc tgcagacaaa ggagttggaa at 172

<210>10

<211>176

<212>DNA/RNA

<213> nucleotide sequence of promoter mutant (Unknown)

<400>10

gtcttgacaa ggacaagtgt ccatgtcagg gacaaagagc gatgtgttcc ggcctcccct 60

agtcccgcaa aaataacccc cattgacatg gacagctgtc catgtatcaa tagggtgatc 120

actctctcga agacgagaat gctgattgtc agcagacaaa ggagttggta aattat 176

<210>11

<211>175

<212>DNA/RNA

<213> nucleotide sequence of promoter mutant (Unknown)

<400>11

gtcttgacaa ggacaagtgt ccatgtcagg gacaaagagc gatgtgttcc ggcctcccct 60

agtcccgcaa aaataacccc cattgacatg gacagctgtc catgtatcaa tagggtgatc 120

actctctcga agacgagaat gctgattgtc agcagacaaa ggagttggaa attat 175

<210>12

<211>172

<212>DNA/RNA

<213> nucleotide sequence of promoter mutant (Unknown)

<400>12

gtcttgacaa ggacaagtgt ccttgtcagg gacaaagagc gatgtgttcc ggcctcccct 60

agtcccgcaa aaataacccc cattgacttg gacagctgtc catgtatcaa tagggtgatc 120

actctctcga agacgagaat gctgattgtc agcagacaaa ggagttggaa at 172

<210>13

<211>172

<212>DNA/RNA

<213> nucleotide sequence of promoter mutant (Unknown)

<400>13

gtctcgacaa ggacaagtgt ccttgtcagg gacaaagagc gatgtgttcc ggcctcccct 60

agtcccgcaa aagtaacccc cattgacatg gacagctgtc catgtatcaa tagggtgatc 120

actctcttga atacgagaat gctgattgtc agcagacaaa ggagttggaa at 172

<210>14

<211>171

<212>DNA/RNA

<213> nucleotide sequence of promoter mutant (Unknown)

<400>14

gtcttgacaa ggacaagtgt ccatgtcagg gacaaagagc gatgtgttcc ggcctcccct 60

agtcccgcaa aaataacccc cattgacatg gacagctgtc catgtataat agggtgatca 120

ctctctcgaa gacgagaatg ctgattgtca gcagacaaag gagttggaaa t 171

<210>15

<211>172

<212>DNA/RNA

<213> nucleotide sequence of promoter mutant (Unknown)

<400>15

gtcttgacaa ggacaagtgt ccttgtcagg gacaaagagc gatgtgttcc ggccccccct 60

agtcccgcaa aagtatcccc cattgacatg gacagctgtc catgtttcaa tagggtgatc 120

actctcttga agacgagaat gcagattgtc agcagacaaa ggagttggaa at 172

<210>16

<211>172

<212>DNA/RNA

<213> nucleotide sequence of promoter mutant (Unknown)

<400>16

gtcttgacaa ggacaagtgt ccatgtcagg gacaaagagc gatgtatccc ggcctcccct 60

agtcccgcaa aagtaacccc cattgacatg gacagctgtc catgtttcaa tagggtgatc 120

actctcttga agacgagaat gctgattgtc ggcagacaaa ggagttggaa at 172

<210>17

<211>328

<212>PRT

<213> mutant irrE (amino acid sequence Unknown encoded by M2 Gene)

<400>17

Val Pro Ser Ala Ala Val Ser Pro Pro Cys Pro Ser Gly Val Ala Gly

1 5 10 15

Gly Gly Met Gly Pro Leu Ala Leu Ala Gly Ala Ser Leu Pro His Pro

20 25 30

Gly Ile Pro Val Leu Leu Pro Pro Val Thr Ala Pro Ala Ala Leu Ala

35 40 45

Ala Ala Leu Ala Ala Met Ala Ala Leu Ala Ala Ala Thr Val Ala Ala

50 55 60

Leu Pro Gly Ala Ala Thr His Ser Leu Met Ala Gly Val Pro Gly Val

65 70 75 80

Ala Leu Leu Pro Met Pro Leu Gly Thr Ala Ala Gly Ala Pro Ala Pro

85 90 95

Gly His Ala Val Ile Leu Ile Ala Ser Ala Ala Ala Pro Gly His Gly

100 105 110

Ala Pro Thr Leu Ala His Gly Ile Gly His Ala Ile Leu Leu Gly Ala

115 120 125

Ala Ala Leu Leu Ser Ala Ile His Ala Ala Thr Gly Gly Gly Ala Leu

130 135 140

Gly Gly Val Ile Gly Thr Leu Cys Ala Val Ala Ala Ala Ala Ile Leu

145 150 155 160

Met Pro Gly Pro Val Ile Ala Gly Met Leu Gly Ala Pro Gly Pro Thr

165 170 175

Gly Ala Ala Leu Ala Gly Leu Ala Leu Ala Ala Gly Val Ser Ala Ser

180 185 190

Ser Ala Leu Thr Ala Leu Thr Gly Gly Thr Pro Val Pro Val Ile Thr

195 200 205

Ala Val Cys Ala Pro Gly Leu Pro Pro Ala Gly Gly Ala Ala Ser Ala

210 215 220

Gly Ala Ala Gly Pro Gly Thr Gly Leu Val Leu Thr Val Ala Ala Ser

225 230 235 240

Ser Ser Thr Ala Gly Val Leu Thr Thr Leu Ala Ser Gly Thr Pro Val

245 250 255

Pro Ala Ala His Pro Ala Ala Leu Ala Leu Ala Thr Gly Met Gly Val

260 265 270

Ala Gly Gly Ser Thr Val Pro Pro Ala Ser Gly Ala Leu Met Leu Ala

275 280 285

Gly Val Ala Ala Thr Pro Ser Ala Gly Ile Val Ala Val Ser Pro Gly

290 295 300

Pro Ala Pro Ala Ala Leu Gly Ala Leu Ala Ser Gly Gly Ala Ala Ala

305 310 315 320

Ala Gly Pro Gly Ala Ala Ala Gly

325

<210>18

<211>16

<212>DNA/RNA

<213>pART2-F(Unknown)

<400>18

cccatggtct tgacaa 16

<210>19

<211>19

<212>DNA/RNA

<213>pART2-R(Unknown)

<400>19

cccatggagc gtcagaccc 19

<210>20

<211>29

<212>DNA/RNA

<213>hdnOp-F(Unknown)

<400>20

aggatatctc ttgacaagga caagtgtcc 29

<210>21

<211>28

<212>DNA/RNA

<213>hdnOp-R(Unknown)

<400>21

cgggatccat ttccaactcc tttgtctg 28

<210>22

<211>20

<212>DNA/RNA

<213>SP6/7/8/9-F(Unknown)

<400>22

cggaattcgc ggcggtcttc 20

<210>23

<211>26

<212>DNA/RNA

<213>SP6-R(Unknown)

<400>23

cgcggatcca ttttccaact cctttg 26

<210>24

<211>26

<212>DNA/RNA

<213>SP7-R(Unknown)

<400>24

cgcggatcca taattccaac tccttt 26

<210>25

<211>27

<212>DNA/RNA

<213>SP8-R(Unknown)

<400>25

cgcggatcca taatttccaa ctccttt 27

<210>26

<211>28

<212>DNA/RNA

<213>SP9-R(Unknown)

<400>26

cgcggatcca taatttacca actccttt 28

<210>27

<211>27

<212>DNA/RNA

<213>-10△C-F(Unknown)

<400>27

tataataggg tgatcactct ctcgaag 27

<210>28

<211>27

<212>DNA/RNA

<213>-10△C-R(Unknown)

<400>28

gatcacccta ttatacatgg acagctg 27

<210>29

<211>26

<212>DNA/RNA

<213>irrE-F(Unknown)

<400>29

cgggatccca gtgccaacgt cagccc 26

<210>30

<211>26

<212>DNA/RNA

<213>irrE-R(Unknown)

<400>30

tgctctagac tgtgcagcgt cctgcg 26

Claims

1. A library of target promoters suitable for arthrobacter simplex, comprising: the target promoter library is a promoter mutant obtained by random mutation and site-directed mutation technologies on the basis of an expression vector pART2 wild type promoter hdnOp, and the sequence of the target promoter library is as follows: SEQ ID NO.3, and/or SEQ ID NO.4, and/or SEQ ID NO.5, and/or SEQ ID NO.6, and/or SEQ ID NO.7, and/or SEQ ID NO.8, and/or SEQ ID NO.9, and/or SEQ ID NO.10, and/or SEQ ID NO.11, and/or SEQ ID NO.12, and/or SEQ ID NO.13, and/or SEQ ID NO.14, and/or SEQ ID NO.15, and/or SEQ ID NO. 16.

2. The method for constructing a library of arthrobacter simplex-applicable target promoters according to claim 1, wherein: the method comprises the following steps:

⑶ designing random mutation primer and site-directed mutation primer according to the sequence of the wild promoter in step ⑴, wherein the random mutation primer is designed to introduce random mutation in the full promoter region by error-prone PCR, and the site-directed mutation primer is designed to delete the base C in the-10 region of the original promoter sequence or increase the base number between the ribosome binding site and the start codon;

3. An engineered strain of Arthrobacter simplex with superior stress tolerance comprising the promoter library of interest of claim 1.

4. The engineered strain of Arthrobacter simplex with excellent stress tolerance according to claim 3, wherein: the Arthrobacter simplex engineering strain also comprises wild type irrE_(W)Or irrE_(W)Mutant gene irrE_(M2)The wild type irrE_(W)The gene codes the amino acid sequence as follows: SEQ ID No. 1; the irrE_(W)Mutant gene irrE_(M2)The encoded amino acid sequence is: SEQ ID NO. 17.

5. The engineered strain of Arthrobacter simplex with excellent stress tolerance according to claim 3, wherein: the irrE_(W)Mutant gene irrE_(M2)The organic solvent tolerance of the Arthrobacter simplex can be obviously improved;

6. The method of claim 3The engineering strain of the simple arthrobacter with excellent stress tolerance is characterized in that: the irrE_(W)Mutant gene irrE_(M2)The construction method comprises the following steps:

7. The engineered strain of Arthrobacter simplex with excellent stress tolerance according to any one of claims 3 to 6, wherein: the Arthrobacter simplex engineering strain has the following characteristics:

the strain shows excellent stress tolerance, and the stress conditions are that the concentration of ethanol is 0-6% and the concentration of methanol is 0-8%. Wherein the maximum OD of the engineered strain is at 6% ethanol and 8% methanol pressure growth conditions compared to control strain I₆₀₀Respectively improved by 10 to 125 percent and 1.9 to 128.1 percent; the high pressure impingement conditions were 16% ethanol, 20% methanol and 2.5mol/L salt. Wherein the strain is subjected to an impact of 16% ethanol, 20% methanol and 2.5mol/L salt compared to control strain IThe maximum viable count is respectively improved by 338.7-524.2%, 103.7-117.3% and 278.0-380.7%; under a conversion system of 45g/L cortisone acetate and 8% ethanol, the viable count of the PM1210-IrrE (M2) engineering strain is respectively 4 times and 25 times that of the control strain II when the strain is fermented for 12 hours and 60 hours;

8. The method for constructing the engineered strain of Arthrobacter simplex having superior stress tolerance according to any one of claims 3 to 6, wherein: the method comprises the following steps:

Electrically transferring the correctly verified recombinant plasmid into a simply arthrobacter competent state, adding a sterile recovery culture medium, uniformly mixing, slowly shaking and culturing at 32 ℃ for 11h, coating the mixture on a resistant plate containing 50ug/mL kanamycin, carrying out inversion culture at 32 ℃ for 3-4 days, re-extracting the plasmid from a positive transformant growing on the plate, and verifying by PCR (polymerase chain reaction), enzyme digestion and sequencing to obtain promoter mutants containing different expression strengths and irrE_(W)Or irrE (M2) recombinant plasmidThe engineering strain is the simple arthrobacter engineering strain with excellent stress tolerance.

9. Use of the engineered strain of Arthrobacter simplex with excellent stress tolerance as claimed in any one of claims 3 to 6 for bioconversion of steroids.

10. Use according to claim 8, characterized in that: the addition amount of ethanol in the converted conversion system is 8%, the feeding concentration of the substrate cortisone acetate is increased to 15-45g/L, and C is_1,2The dehydrogenation yield is increased by 1.1-2.2 times compared with that of the control strain I.