CN111254084A - Agrobacterium-mediated xylaria fungi sj18 transformant strain and preparation method and application thereof - Google Patents

Abstract

The invention relates to the field of biological breeding, in particular to an agrobacterium-mediated xylariaceae fungus (A)Xylaria radix) sj18 transformant strain, preparation method and application thereof. The Agrobacterium infection receptor of the transformant strain of the Agrobacterium-mediated xylariaceae fungus sj18 is xylariaceae fungus ((R))Xylaria radix). The farm poleA preparation method of a strain of a transformant of a fungus in the fungus-mediated xylariaceae family comprises the following steps: 1) preparing a fungal expression vector; 2) preparing agrobacterium infection; 3) preparing fungi to be transformed; 4) agrobacterium-mediated gradient transformation; 5) and (4) multi-level screening of target strains. The invention does not need to prepare complicated protoplast, has simple receptor source and is suitable for the transformation of the fungus without spores. In addition, the vector used by the invention is convenient for subsequent insertion of other genes to obtain a fluorescent protein fusion transformant. The transgenic method is beneficial to functional excavation and application of the fungi.

Description

Agrobacterium-mediated xylaria fungi sj18 transformant strain and preparation method and application thereof

Technical Field

The invention belongs to the technical field of biological control, and relates to an agrobacterium-mediated xylariaceae fungus sj18 transformant strain, and a preparation method and application thereof.

Background

The use of chemical pesticides causes food safety and ecological environment problems to a certain extent, and with the continuous serious problems, the demand of high-safety biological pesticides in sustainable development of agriculture and forestry is more prominent. The biological pesticide mainly comprises agricultural antibiotic, bacterial insecticide, insect virus insecticide, fungus biological pesticide and the like. Fungi are one of the largest groups of microorganisms for killing pests, and certain fungi with biological protection (biocontrol fungi for short) can effectively kill the pests in a specific group by various modes such as infection, destruction, toxic metabolites, nutrition absorption inhibition and the like. The characteristics of the fungus for killing the diseases and insect pests determine that the biocontrol fungus has the advantages of high efficiency (the diseases and insect pests are not easy to cause resistance), safety (no toxicity to people and livestock and less harm to natural enemies), low cost (only conventional fermentation culture) and the like. Therefore, the prevention and control mechanism and application of the biocontrol fungi become one of the important research directions in the field of biological pesticides at home and abroad at present. Especially the endophytic fungi of plants, not only can generate active substances for killing pests and diseases, but also can stimulate the resistance of the plants to the pests and diseases. In addition, some plant endophytic fungi can also promote plant growth, improve plant stress resistance and the like. Because the plant endophytic fungi and the plants are symbiotic, the use and maintenance cost of the plant endophytic fungi is low, and the plant endophytic fungi is suitable for large-area popularization and use. The research team reports a new fungus sj18 (patent application number: 201710795984.0) of the genus arbuscular mycorrhiza of the family xylariaceae, which has the development prospect of biological pesticides in the early period, not only has the effects of expelling parasites and inhibiting the growth of germs, but also can be symbiotic with the roots of plants to promote the growth of the roots of the plants and improve the stress resistance of the plants, and the research team has important significance for the development and utilization of biocontrol fungi in China. The invention further establishes a transgenic system of the sj18 fungus on the basis of the separation and function excavation of the fungus. On one hand, the technology can be used for excavation and genetic control of sj18 fungus functional genes, particularly under the conditions that the fungus has no spores and transgenic screening is difficult, the technology provides an insertion site which is easy to identify for subsequent genetic transformation by using a fluorescent label, and the efficiency of transgenic screening is greatly improved. On the other hand, after the marker genes such as fluorescent protein are transferred, the external tracing of the fungus infecting plant roots is facilitated, so that the optimization of the sj18 microbial inoculum in the application of various plant pest control is facilitated.

Disclosure of Invention

The first purpose of the invention is to provide an agrobacterium-mediated sj18 transformant strain, the second purpose of the invention is to provide a preparation method of the sj18 transformant strain, and the third purpose of the invention is to provide application of the sj18 transformant strain.

In order to achieve the first object, the invention adopts the following technical scheme:

agrobacterium mediated fluorescent protein gene transformation of sj18 strain.

Preferably, the agrobacterium is agrobacterium strain AGL-1, agrobacterium strain GV3101 or agrobacterium strain EHA 105. Most preferably, the agrobacterium is agrobacterium strain EHA 105.

Preferably, the agrobacterium gene expression vector adopts pPK2 vector as a framework, various target fragments are inserted by an Infusion homologous recombination method to construct a required expression vector, and a gpda (glyceraldehyde triphosphate dehydrogenase gene) promoter and an hsp70(heat-shock protein 70-encoding gene) promoter from aspergillus nidulans are used as promoters for constitutive expression of genes in fungi. Other modifications can also be made, such as modifying the plant expression vector pCAMBIA1301 to a fungal expression vector, primarily replacing the promoter.

Preferably, an eGFP (enhanced green fluorescent protein) reporter gene, or sGFP (artificially synthesized encoded green fluorescent protein), or a hygromycin resistance gene suitable for fungal systems and convenient for screening procedures is inserted into the pPK2 expression vector. This reporter gene can also be other fluorescent reporter genes, such as RFP (red fluorescent protein); or other resistance genes such as neomycin phosphotransferase II site or G418 (geneticin), etc.

In order to achieve the second object, the invention adopts the following technical scheme:

the preparation method of the agrobacterium-mediated fluorescent protein gene transformation sj18 strain comprises the following steps:

(1) preparing a fungal expression vector;

(2) preparing agrobacterium infection;

(3) preparing fungi to be transformed;

(4) agrobacterium-mediated gradient transformation;

(5) and (4) multi-level screening of target strains.

Preferably, the step (1) includes the steps of:

① obtaining gpdA with enzyme cutting sites, hsp70 promoter sequences, eGFP, sGFP genes and terminator trpc fragments from other plasmids by a PCR method with high fidelity enzyme, carrying out enzyme cutting and inoculating into a T vector;

② the pPK2 vector is used as a framework, and various target segments are inserted by an Infusion homologous recombination method to construct the required expression vector.

Preferably, the step (2) includes the steps of:

① the glycerol strain preserved at-80 ℃ is streaked on an LB plate and cultured and activated at 28 ℃ overnight;

② selecting single clone on the plate, transferring to 5ml LB tube, shaking and culturing overnight;

③ transferring 5ml of small shake bacteria liquid to 100ml LB shake bacteria bottle, shaking culturing at 28 deg.C and 250rpm for 4-5 hr, and timing measuring bacteria liquid OD₆₀₀Value, OD, measured every 30min after 2 hours of culture₆₀₀When the value reaches 0.3-0.4, taking out the shake flask from the shaking table, and fully cooling on ice;

④ transferring the bacterial liquid into a pre-cooled 50ml centrifuge tube, centrifuging for 15 minutes at the temperature of 4 ℃ below 4000g, carefully pouring out the supernatant, washing the resuspended thalli with 20ml of pre-cooled sterile water, and repeating the step sometimes;

⑤ 4 deg.C, centrifuging at 4000g below for 20 min, and resuspending the thallus with 10ml of precooled 10% glycerol;

⑥ 4 deg.C, centrifuging at 4000g below for 20 min, and resuspending the thallus with 2-3ml of precooled 10% glycerol;

⑦ were loaded in 100. mu.l aliquots into pre-cooled 1.5ml centrifuge tubes and stored at-80 ℃.

Preferably, the step (3) includes the steps of:

① sj18 strain was activated on a medium plate (e.g., PDA) at 20-34 ℃ for 3-7 days;

② perforating or scraping strong mycelium block, adding into liquid culture medium (such as PDB), inoculating 100ml of culture medium into a mycelium block of about 0.5cm, adding glass beads (3 beads/100 ml) with diameter of 2-5mm, shake culturing under optimal growth condition (28-34 deg.C) for about 3 days, and observing no-cluster mycelium;

③ gradient dilution and plate coating are carried out on the hyphae, the hyphae are controlled to grow in a conglobation mode and are scattered uniformly according to colony statistics, when the bacterial growth density reaches about 106CFU, the bacterial colonies formed by the hyphae are refrigerated in a refrigerator at 0-4 ℃ for standby, and if the plate coating finds that the bacterial colonies are not fine enough, the hyphae can be further scattered rapidly in a centrifugal tube by glass beads.

Preferably, the step (4) includes the steps of:

① taking out 1000 ul of Agrobacterium and 1000 ul of sj18 strain in a refrigerator at-80 deg.C, thawing in ice bath;

② diluting Agrobacterium with PDB culture medium to about 0.3 (OD600, blank PDB AS control, colorimetric tube value), taking 4ml, adding into colorimetric tube, adding inducer AS (2 ‰), inducing at 30 deg.C and 600rpm, and inducing to OD value of 0.6-0.8;

③ sj18 strain is diluted by 100 times, centrifuged at 4000g at 4 ℃ for 5 minutes, after supernatant is removed, induced agrobacterium suspension is added and mixed evenly, and sj18 is generally divided into several concentrations from 10: 1 to 1: 10 in order to overcome the possible influence of hypha heterogeneity;

④ shaking and culturing the mixed bacterial suspension at 25 deg.C for 2-3h, then uniformly coating the thallus on microporous filter membrane of PDA plate (containing 2 ‰ inducer AS), and standing and culturing in dark in 25 deg.C incubator for 2 days.

Preferably, the step (5) includes the steps of:

① after the culture, the microporous filter membrane is directly transferred to a PDA primary screening culture medium containing 1 ‰ TMT and 2 ‰ Hyg, and is cultured at 32 deg.C for 5-7 days for primary screening;

② scraping the colony grown in the primary screen off the microporous filter membrane, suspending in PDB culture medium (5-10 ml culture medium, 3% hyg, adding 2-3 glass beads of 4-5 mm), shake culturing at 28-32 deg.C for 24 hr, and scattering thoroughly;

③ spreading the bacterial liquid on a PDA (containing 3 ‰ Hyg) rescreened culture medium plate, and culturing at 32 deg.C for 7-14 days;

④ selecting colony growing on the rescreened culture medium plate to perform individual liquid culture, the culture method refers to the mode of ②, then respectively coating plates, and the plate coating culture refers to ③;

⑤ after the colony of each plate grows out, performing fluorescence microscopy, selecting the colony with strong fluorescence signal by using a micromanipulator, scattering the colony in a small amount of sterile water, and absorbing the hypha segment with strong fluorescence signal to a new plate by using the micromanipulator for continuous screening and culture;

⑥, further confirming the hyphal fragments by a fluorescence microscope, basically completing the screening and purifying processes, and then further verifying the target genes by PCR.

In order to achieve the third object, the present invention adopts the following technical solutions:

the strain of the transformant of the fungus sj18 in xylariaceae prepared in the above is used for the research of sj18 functional genes and the research of the infection rule of biocontrol fungus.

By adopting the technical scheme, the invention particularly optimizes the transformation and screening of the filamentous fungi which do not produce spores, does not need to prepare complicated protoplast, has simple receptor source, and can directly use the spores and hyphae of the fungi for transformation; the adopted agrobacterium-mediated method has high transformation efficiency; when the binary vector has no homology with the genome of the recipient, the T-DNA is integrated into the genome by random insertion, and when the binary vector has homology with the genome of the recipient, a considerable amount of the T-DNA is inserted into the genome by homologous integration; in addition, the single copy ratio of the obtained transformant is large, which is beneficial to obtaining a marker gene. This makes the T-DNA tagging method (T-DNA tagging) an effective method for studying fungal gene function and developmental molecular biology. The front end of the transferred fluorescent protein genes (eGFP and sGFP) is provided with an NcoI single enzyme cutting site for subsequent enzyme cutting and access of other functional genes, or the carrier is accessed by an Infusion method after enzyme cutting, and a target gene is expressed in a fusion mode, so that screening and tracking of functional gene expression are facilitated.

After the exogenous gene of the green fluorescent protein is transferred, the infection of the bacteria can be further tracked by directly tracking the green fluorescent protein. That is, the fluorescent protein gene is used as both a successful marker for transgenosis and a marker for bacteria (used in breeding research), because it is very difficult to directly observe hyphae in plants by a microscope, the steps of a staining method are complicated, and problems such as difficulty in repeatability of experiments due to problems of a treatment method are caused.

Drawings

FIGS. 1 and 2 show the construction of pPK2 expression vector and the related enzyme cutting sites.

Detailed Description

Example 1 vector System construction

We inserted various desired fragments by the homologous recombination method of Infusion (i.e., In-Fusion technique of Clontech, which can accomplish cloning and recombination as long as the ends of the inserted DNA fragment and the vector have 15 homologous base sequences) to construct desired expression vectors. As shown in fig. 1 and fig. 2, the specific steps are as follows:

(1) utilizing other expression vectors constructed in the previous stage, amplifying an EcoRI-Pgpda-SacI-GFP-PstI-Ttrpc-HindIII fragment by using high fidelity Taq enzyme (the primer is PgpdaF 02: GAATTCCGGAGAATATGGAGCTTCATCG, TtrpcR: AAGCTTTCGAGTGGAGATGTGGAGTG), wherein the fragment can be combined with pmd-19T simple vector as an intermediate vector, is marked as T-Pgpda-GFP and is used for replacing other promoters;

(2) the In-fusion method is adopted during replacement, and the problem of enzyme cutting sites does not need to be considered. For fungal promoters to be replaced, such as a heat shock protein promoter Phsp70, a carbon source controlled promoter Pcrg1 of a plasmid pMF2-1c, a nitrogen source controlled promoter Pnar1 of a plasmid pMF2-2c and the like, 15bp bases are added at both ends of the promoters by a PCR method, the base sequences are connected with 15bpLB-Phsp70-15bpRB, 15bpLB-Pcrg1F-15bpRB and 15 bpLB-PNar 1-15bpRB which are obtained by homologous outside two enzyme cutting sites of a T-Pgpda-GFP vector EcoRI and SacI, and are connected with a large fragment of the vector T-Pgpda-GFP (after double enzyme cutting of the EcoRI and the SacI) in the step 1), so as to construct intermediate vectors T-Phsp 70-gTtTtTtC, T-Pcrg 1-gTtRpc and T-Pcrp 1-gPpc;

(3) designing primers for resistance genes of common fungal antibiotics carboxin, hygromycin, zeocin and Neomycin by an Infusion method on-line primer designing tool (http:// bioinfo. clintech. com/Infusion /), amplifying fragments of the resistance genes by the primers, and connecting the fragments to the vector of the step 2 of double enzyme digestion of SacI and PstI by an Infusion reaction to finally obtain the following intermediate vector;

(4) connecting the left boundary and the right boundary of the fragments into 15bp homologous sequences of HindIII and KpnI enzyme cutting sites of a PPK2 vector, so that agrobacterium transformation vectors of various promoters and resistance genes can be constructed;

by repeating the step (3) and the step (4), the resistance gene can be changed into a target gene to be expressed, a vector of a T-promoter-target gene-terminator type is constructed, and then the vector is connected between EcoRI enzyme cutting sites and KpnI enzyme cutting sites of the PPK2 vector by an Infusion method, so that an agrobacterium vector which can express the gene and the resistance gene simultaneously can be constructed, the problem of the enzyme cutting sites does not need to be considered in the construction process, and the selection is flexible and convenient.

EXAMPLE 2 preparation of transformation-related Strain systems

1. Preparation of Agrobacterium competence

(1) Glycerol strains (GV 3101 or EHA 105) stored at-80 ℃ were streaked on LB (50 mg/L Rif) plates and activated by overnight culture at 28 ℃;

(2) selecting single clone on the plate, transferring the single clone into a 5ml LB (50 mg/L Rif) tube, shaking the bacteria, and culturing overnight;

(3) transferring 5ml of small shake culture liquid to 100ml of LB shake culture bottle, carrying out shake culture at the temperature of 28 ℃ and the rpm of 250 for 4-5 hours, and measuring the OD of the culture liquid at regular time₆₀₀Value, OD, measured every 30min after 2 hours of culture₆₀₀When the value reaches 0.3-0.4, taking out the shake flask from the shaking table, and fully cooling on ice (usually about 30 minutes);

(4) the bacterial solution was transferred to a pre-cooled 50ml centrifuge tube and centrifuged at 4 ℃ and 4000g for 15 minutes. Carefully pour off the supernatant, resuspend the cells with 20ml of pre-chilled sterile water, which can sometimes be repeated once;

(5) after centrifugation at less than 4000g at 4 ℃ for 20 minutes, the cells were resuspended in 10ml of pre-cooled 10% glycerol;

(6) centrifuging the resuspended thallus obtained in (5) at 4 deg.C below 4000g for 20 min, and resuspending thallus with 2-3ml of precooled 10% glycerol;

(7) 100 μ l aliquots were placed into pre-cooled 1.5ml centrifuge tubes and stored at-80 ℃.

2. Preparation of the fungi to a transformed state

(1) The sj18 strain is activated on a medium plate (such as PDA) at 20-34 ℃ for 3-7 days;

(2) punching or scraping strong mycelium block, adding into liquid culture medium (such as PDB), inoculating into a mycelium block of 0.5cm per 100ml culture medium, adding glass beads (3 beads/100 ml) of 2-5mm diameter for dispersing the mycelium block, shake culturing at 28-34 deg.C for 3 days, and observing no-mass mycelium;

(3) and (3) performing gradient dilution and plate coating on the hyphae, controlling the hyphae to be uniformly scattered according to colony statistics, controlling the growth density of the hyphae to reach about 106CFU, and refrigerating the hyphae in a refrigerator at 0-4 ℃ for later use. If the plate is coated, the colonies formed by the hyphae are not fine enough, and can be further quickly scattered in a centrifugal tube by using glass beads.

Example 3 Agrobacterium mediated transformation and selection of fluorescent protein Gene eGFP transformed sj18 Strain

1. Agrobacterium-mediated gradient transformation

(1) Taking out 1000. mu.l of agrobacterium-induced competent cell suspension and 1000. mu.l of sj18 strain hypha suspension to be transformed from the refrigerator, and carrying out ice bath;

(2) diluting Agrobacterium with PDB culture medium to about 0.3, adding inducer AS (2 ‰), inducing at 30 deg.C and 600rpm to OD value of 0.6-0.8;

(3) after the sj18 strain is diluted by 100 times, the strain is centrifuged at 4000g at 4 ℃ for 5 minutes, supernatant is removed, induced agrobacterium suspension is added and mixed evenly, and in order to overcome the possible influence of nonuniform hyphae, the sj18 bacterial liquid is generally divided into 10: 1 to 1: 10, several concentrations;

(4) the mixed bacterial suspension is shaken for 2-3h at 25 ℃, then the thalli are evenly coated on a microporous filter membrane of a PDA (personal digital assistant) plate (with 2 thousandth of inducer AS), and the mixture is kept standing and cultured for 2 days in a dark incubator at 25 ℃.

2. Multi-level screening of target strains

(1) After the culture is finished, directly transferring the microporous filter membrane to a PDA (1 thousandth TMT, 2 thousandth Hyg) primary screening culture medium, and culturing for 5-7 days at 32 ℃ for primary screening;

(2) scraping the colony growing in the primary screen off a microporous filter membrane, suspending in a PDB culture medium (5-10 ml of the culture medium containing 3% hyg g and 2-3 glass beads with the diameter of 4-5 mm), shaking and culturing at 28-32 ℃ for 24h, and fully scattering;

(3) coating the bacterial liquid on a PDA (3 per mill Hyg) rescreening culture medium flat plate (without a microporous filter membrane), and culturing at 32 ℃ for 7-14 days for rescreening;

(4) picking out the grown colonies, performing liquid culture alone by the method of ②, and performing plate-coating culture by ③;

(5) after the bacterial colony of each flat plate grows out, carrying out fluorescence microscopy, selecting the bacterial colony with stronger fluorescence signal by using a micromanipulator, scattering the bacterial colony in a small amount of sterile water, and absorbing hypha segments with stronger fluorescence signal to a new flat plate by using the micromanipulator for continuous screening and culture;

(6) and (3) confirming the grown hypha fragments through a further fluorescence microscope, basically completing the screening and purifying processes, and then further verifying the target gene through PCR.

Example 4 extraction of transformant nucleic acids by sj18

The invention optimizes the nucleic acid extraction process, can simultaneously extract DNA and RNA of batch samples without liquid nitrogen grinding treatment, the extracted DNA is used for a PCR detection template of gene insertion, and the extracted RNA is mainly used for RT-PCR detection of gene expression. The main steps of nucleic acid extraction are as follows: the colony was centrifuged, 1. mu.l of deposited bacteria was added to 50. mu.l of bacterial lysate, heated at 95 ℃ for 10 minutes in a PCR apparatus, and then cooled on an ice bath for 3 minutes.

Example 5 Gene insertion PCR validation of transformants of sj18

For the identification of transformants, it is usually first checked whether the plasmid fragment in Agrobacterium is inserted into the genome. The scheme selects and detects a fluorescent gene (egfp), and the characteristic amplified fragment length is 246bp, and the region is a primer sequence egfp-f1 used by ppk-gpda-hyg-gpda-egfp (7283-: ACCATGGTGAGCAAGGGCGA, egfp-r 1: CTGCTTCATGTGGTCGGGGTAG are provided.

The PCR system (15. mu.l system) was prepared in accordance with the PCR reagent used. PCR procedure: 3 min at 98 ℃; 35 cycles of 98 ℃ for 10s, 56 ℃ for 30s, 72 ℃ for 40 s; 5min at 72 ℃. The PCR product was detected by electrophoresis.

Example 6 RT-PCR assay of transformants with sj18 insert Gene expression

(1) Taking out an RNA sample from-80 ℃, and removing residual DNA in the RNA sample by using DNase;

(2) the following template RNA/primer mixtures were prepared in 1.5ml tubes, in a total volume of 12. mu.l:

template RNA 3. mu.g

Oligo(dT)12-18 Primer (50μM ) 2μl

RNasefree dH2O upto12μl

(3) Keeping the temperature at 70 ℃ for 10min, and rapidly cooling on ice for more than 2 min;

(4) centrifuging for several seconds to make the template RNA/primer denaturation solution gather at the bottom of the Microtube;

(5) preparing the following reverse transcription reaction liquid in the Microtube;

mu.l of the above template RNA/primer denaturing solution

5×M-MLV Buffer 4μl

dNTP mix (10 mM each) 1. mu.l

RNaseInhibitor（40U/μl） 0.5μl

RTaseM-MLV（RNaseH-）（200U/μl） 0.5μl

RNasefree dH2O upto20μl

(6) Preserving heat for 1h at 42 ℃;

(7) keeping the temperature at 70 ℃ for 15min, cooling the mixture on ice, adding ddH2O with the same volume to dilute the mixture to obtain a cDNA solution

Inoculating for PCR amplification;

(8) 1 mul RT product was taken as template, PCR detection, PCR procedure and detection method were the same as above.

Example 7 determination of the function of sj18 transformants

The scheme can rapidly understand the expression condition of the gene by observing the fluorescent marker because of transferring the GFP gene. The detection mode can be qualitative detection by a fluorescence microscope or quantitative detection by a fluorescence analyzer.

(1) Selecting transformants, and culturing the transformants in 5ml of liquid PDB medium at 28 ℃ overnight;

(2) and (3) placing 5 mu l of bacterial liquid on a glass slide, observing sj18 fungi in a common 1000-time optical microscope, then transferring the glass slide into a fluorescence mode, exciting sj18 fungi by using blue wavelength, and observing the green fluorescence intensity of the transformed J18 fungi. The different transformants have different expression intensities of the transferred foreign genes, and under the same microscopic fluorescence shooting parameters, the stronger the green light of the cells is, which indicates that the gene expression is stronger.

The PDA culture medium and the antibiotic formula are as follows:

PDA Medium：

Potato extract 200g

Dextrose 20g

Agar 15g；

hyg (hygromycin) 50mg/ml:

Hyg 1g

ddH₂O 20ml；

TMT (timentin) 160mg/ml:

TMT 160mg

ddH₂O 1ml；

as (acetosyringone) 100mmol/ml (suction filtration treatment, -20 ℃ cryopreservation):

As 196mg

10ml of dimethyl sulfoxide.

Claims (10)

1. Agrobacterium-mediated Xylaceae fungus sj18 transformant strain characterized in that: when the transformant strain is prepared, the agrobacterium infection acceptor is sj18 strain with the preservation number of CGMCC No. 12780.

2. The agrobacterium-mediated xylariaceae fungus sj18 transformant strain according to claim 1, characterized in that: the Agrobacterium is selected from Agrobacterium strain AGL-1, Agrobacterium strain GV3101 or Agrobacterium strain EHA 105.

3. The pPK2 expression vector is adopted, one or two of a gpda promoter from aspergillus nidulans and an hsp70 promoter are adopted as the promoter, and an eGFP or sGFP reporter gene is used as a functional gene.

4. The Agrobacterium-mediated Xylaceae fungus sj18 transformant strain according to claim 3, characterized in that: a single enzyme cutting site is reserved at the front end of the pPK2 expression vector eGFP or sGFP reporter gene for subsequent access of other functional genes to form a fusion protein after access, thereby facilitating transformant screening and function research.

5. A method for preparing the Agrobacterium-mediated strain of the transformant of Xylaceae fungus sj18 according to claim 1, characterized in that it comprises the following main steps:

(1) preparing a fungal expression vector;

(2) preparing agrobacterium infection;

(3) preparing fungi to be transformed;

(4) agrobacterium-mediated gradient transformation;

(5) and (4) multi-level screening of target strains.

The method for producing the strain of the transformant of xylariaceae fungus sj18 according to claim 5, wherein step (1) comprises the following two main steps:

① obtaining a gpdA or hsp70 promoter sequence with enzyme cutting sites, an eGFP or sGFP gene and a terminator trpc fragment from other plasmids by a PCR method by using high-fidelity enzyme, cutting enzyme and inoculating into a T vector;

② the pPK2 vector is used as a framework, and various target fragments are inserted by an Infusion homologous recombination method to construct the required expression vector.

7. The method for producing the strain of the transformant of xylariaceae fungus sj18 according to claim 5, wherein the step (3) comprises the steps of:

① sj18 strain was activated on PDA medium plate at 20-34 deg.C for 3-7 days;

after activation, punching or scraping robust mycelium blocks, adding the robust mycelium blocks into a PDB liquid culture medium, inoculating 3-5 glass beads with the diameter of 2-5mm into a mycelium block according to the proportion that 100ml of the culture medium is inoculated to the mycelium block with the diameter of about 0.5cm, carrying out shaking culture at the temperature of 32 ℃ and the speed of 150rpm for 3-4 days, scattering clustered mycelium, and facilitating subsequent coating;

③ performing gradient dilution plating culture on the obtained scattered sj18 bacteria, controlling the growth density of the diluted bacteria to be about 106CFU according to colony statistics, and refrigerating in a refrigerator at 0-4 ℃ for later use.

8. The method for producing the strain of the transformant of xylariaceae fungus sj18 according to claim 5, wherein the step (4) comprises the steps of:

taking 1000 mu l of agrobacterium-induced cell suspension and sJ18 strain suspension to be transformed from the refrigerator1000 μ l, ice bath;

diluting Agrobacterium with PDB culture medium to OD600 value of 0.3, adding AS inducer to final concentration of 200-;

③ sj18 strain is diluted by 100 times, centrifuged for 5 minutes at 4 ℃ and 4000g, the supernatant is removed, and induced agrobacterium suspension is added and mixed evenly, so as to overcome the influence of heterogeneity of sj18 bacterial liquid, the sj18 bacterial liquid is divided into 4 concentration ratios from 10: 1 to 1: 10;

the mixed bacterial suspension is firstly cultured for 2-3h at 25 ℃ in a shaking way, a PDA plate added with 200-300 mu M inducer AS is prepared at the same time, a 0.45 mu M microporous filter membrane is paved on the PDA plate, then the thalli are evenly smeared on the microporous filter membrane, and the thalli are cultured for 2 days in a dark way in an incubator at 25 ℃.

9. The method for producing the strain of the transformant of xylariaceae fungus sj18 according to claim 5, wherein the step (5) comprises the steps of:

after the ① -mesh strain is cultured, the microporous filter membrane is directly transferred to a PDA primary screening culture medium which contains TMT with the concentration of 200 mug/ml and Hyg with the concentration of 200 mug/ml, and the PDA primary screening culture medium is cultured for 5 to 7 days at the temperature of 32 ℃ for primary screening;

② scraping the colony grown from the primary screen off the microporous filter membrane, suspending in 5-10ml PDB culture medium containing 300ug/ml hyg and 2-3 glass beads with diameter of 2-5mm, shake culturing at 32 deg.C for 24 hr, and scattering completely;

③ spreading the bacterial liquid on a PDA rescreened culture medium plate containing 300 μ g/ml Hyg, and culturing at 32 deg.C for 7-14 days;

④ selecting single colony, liquid culturing, and plating according to ② method, and ③;

⑤ this step

After the bacterial colony of each flat plate grows out, carrying out fluorescence microscope microscopic examination, selecting the bacterial colony with stronger fluorescence signal by using a micromanipulator, scattering the bacterial colony in a small amount of liquid, and absorbing hypha segments with stronger fluorescence signal to a new flat plate by using the micromanipulator for continuous screening and culture;

⑥, further confirming the hyphal fragments by a fluorescence microscope, basically completing the screening and purifying processes, and then further verifying the target genes by PCR.

10. Use of an agrobacterium mediated sj18 strain transformant strain according to any of claims 1 to 4 for plant infestation.

Images