CN111235184B - Method for improving porcine embryo gene modified homozygote - Google Patents
Method for improving porcine embryo gene modified homozygote Download PDFInfo
- Publication number
- CN111235184B CN111235184B CN202010100231.5A CN202010100231A CN111235184B CN 111235184 B CN111235184 B CN 111235184B CN 202010100231 A CN202010100231 A CN 202010100231A CN 111235184 B CN111235184 B CN 111235184B
- Authority
- CN
- China
- Prior art keywords
- gene editing
- editing system
- parthenogenetic
- gene
- embryo
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/89—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microinjection
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a microinjection method for improving the obtaining rate of pig homozygote, which comprises the following steps: editing the target gene through a microinjection gene editing system in the single cell period and the second cell period of the pig parthenogenetic embryo respectively to obtain a target gene editing pig parthenogenetic embryo; and then the swine parthenogenetic embryo is cultured in vitro, and the high-efficiency target gene modified homozygous daughter swine parthenogenetic blastocyst is obtained after 5 to 6 days. According to the invention, on the basis of one single-cell injection, one secondary-cell injection is added, so that the editing efficiency of the injected parthenogenetic embryo of the pig can be obviously improved, and the obtaining rate of the homozygote is also obviously improved.
Description
Technical Field
The invention belongs to the technical field of gene editing, and particularly relates to a method for improving porcine embryo gene modification homozygote.
Background
At present, the gene modification method of the pig embryo is basically based on single cell microinjection, and when the pig embryo is in a single cell stage, the microinjection of plasmid, RNA or protein is carried out, so that the gene modification effect is achieved by modifying a target gene. The existing traditional pig embryo injection mode is generally to inject a gene editing system at the single cell stage of the embryo to edit genes of the embryo, but the method is easy to cause a large amount of chimeras in the later gene modification result. Also, obtaining homozygotes only once injection is inefficient.
Therefore, the technical problem to be solved in the field is to improve the efficiency of a microinjection gene editing system and obtain more porcine embryo homozygotes.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provide a microinjection method which can reduce the probability of chimera occurrence after microinjection of pig embryos and improve the obtaining rate of homozygotes.
In order to achieve the purpose, the invention adopts the technical scheme that: a microinjection method for improving the obtaining rate of pig homozygote comprises the following steps: editing the target gene through a microinjection gene editing system at the single cell stage and the second cell stage of the swine parthenogenetic embryo respectively to obtain a target gene editing swine parthenogenetic embryo; and then the swine parthenogenetic embryo is cultured in vitro, and the high-efficiency homozygous daughter swine parthenogenetic blastocyst modified by the target gene is obtained after 5 to 6 days.
As a preferred scheme of the invention, the microinjection method for improving the obtaining rate of the pig homozygote comprises the following steps:
(1) Constructing a gene editing system of a target gene;
(2) Obtaining and culturing parthenogenetic embryos;
(3) Injecting the gene editing system in the step (1) into the parthenogenetic embryo for two times through a microinjection gene editing system;
(4) The swine parthenogenetic embryo is cultured in vitro, and the high-efficiency target gene modified homozygous daughter swine parthenogenetic blastocyst is obtained after 5 to 6 days.
As a preferred embodiment of the present invention, the method for microinjecting the gene editing system in step (3) specifically comprises: the first gene editing system injection period is the single cell period of the parthenogenetic embryo, and the second gene editing system injection period is the secondary cell period of the parthenogenetic embryo.
In a preferred embodiment of the present invention, the target genes are CFTR and RAG2 genes.
As a preferred embodiment of the present invention, the sgRNA nucleotide sequence designed for the CFTR gene in the gene editing system is as shown in SEQ ID NO:1 is shown.
As a preferred embodiment of the present invention, the sgRNA nucleotide sequence designed for RAG2 gene in the gene editing system is as shown in SEQ ID NO:2, respectively.
As a preferred embodiment of the present invention, in the microinjection gene editing system, the concentration ratio of the Cas9 protein to the sgRNA is 2.
As a preferable scheme of the invention, in the microinjection gene editing system, the concentration of the Cas9 protein is 100ng/ul, and the concentration of the sgRNA is 50ng/ul.
The invention has the beneficial effects that: according to the invention, on the basis of one injection of the parthenogenetic embryo in a single cell period, one injection in a two-cell period is added, so that the editing efficiency after the injection of the pig embryo can be obviously improved, and the obtaining rate of homozygotes is also obviously improved. Since the cell volume of the ovum is smaller and smaller after the ovum is divided for a plurality of times, the difficulty of three or four injections is higher, and the ovum is easy to be damaged.
Drawings
FIG. 1 is a schematic diagram of the technical scheme of the present invention.
FIG. 2 is a schematic illustration of the RAG2 genotype.
FIG. 3 is a schematic representation of the CFTR genotype.
Figure 4 is a graph showing the success of editing after re-injection at the two-cell stage.
FIG. 5 is a graph showing the probability of homozygote after reinjection at the two-cell stage.
Detailed Description
In order to more concisely and clearly demonstrate technical solutions, objects and advantages of the present invention, the present invention will be further described in detail with reference to specific embodiments.
The embodiment provides a microinjection method for improving the obtaining rate of pig homozygote, which comprises the following steps:
1. constructing a gene editing system of a target pig target gene;
1) Cas9 protein: trueCut Cas9 Protein v2, purchased from Thermo Fisher under the cat number A36497 at an initial concentration of 1mg/ul.
2) Preparing gRNA: two sgRNAs with different sites are designed aiming at CFTR and RAG2 genes respectively, the targeting sequence of the CFTR-sgRNA is ggagaactggagccttcaga (SEQ ID NO: 1), and the targeting sequence of the RAG2-sgRNA is gtgatgtggatatcaacaact (SEQ ID NO: 2). Synthesizing the DNA sequences of the two segments of sgRNAs, respectively connecting the two segments of sgRNAs to U6-gRNA-BbsI vectors, and respectively constructing in vitro transcription vectors pU 6-CFTR-sgRNAs and pU6-RAG 2-sgRNAs of the gRNAs. Then, a template for in vitro transcription of gRNA was obtained by high fidelity enzymatic PCR using a T7-cr fwd and tracr rev primer pair (T7-cr fwd sequence 5'-GAAATTAATACGACTCACTATA-3'; tracr rev sequence 5 '-AAAAAAAGCACCGACTCGGTGCCAC-3') and using constructed in vitro transcription vectors pU6-CFTR-sgRNA and pU6-RAG2-sgRNA as templates (annealing at 58 ℃ and extension for 30 sec,35 cycle,100 ul system). 1 ul of PCR product was electrophoresed and the PCR product was directly recovered after confirming a single band (125 bp). The PCR product is transcribed in vitro by using Ambion's MAXiScript T7 Kit, then the target gRNA is purified and recovered by using mirVana-miRNA Isolation Kit, finally the target gRNA is dissolved and collected by using RNase-Free water, and the concentration of the gRNA is determined by using NanoDrop-1000.
3) Mixing of Cas9 protein and gRNA: cas9 protein and gRNA were mixed at a specific concentration of 2:1, the final Cas9 protein concentration was 100ng/ul and the sgRNA concentration was 50ng/ul. The mixture is the final editing system.
2. Obtaining or preparing parthenogenetic embryos
Ovaries were purchased from a slaughterhouse, placed in 35 ℃ saline containing penicillin and streptomycin and transported back to the laboratory within 2 hours. The follicular fluid is extracted from the follicle by a 10ml syringe and placed in a 50ml centrifuge tube, and the mixture is kept still in a water bath at 37 ℃ for half an hour, then the supernatant is removed, TL-HEPES is added for re-suspension and precipitation, and the rest is carried out for 15 minutes again and repeated once. Placing the heavy suspension into a 60mm flat dish, selecting a cumulus with a hand pipette under a stereoscope to wrap more than 2 layers of compact and uniform cumulus cells-oocyte complexes, washing the cumulus cells-oocyte complexes for 3 times by using a mature culture medium, transferring the cumulus cells-oocyte complexes into culture liquid drops (50 cells are placed into every 500 mu l of liquid drops) which are balanced in an incubator for 4 hours in advance, covering the cumulus cells-oocyte complexes with embryo-grade mineral oil, and culturing the cumulus cells-oocyte complexes for 42 hours. After maturation, the cumulus is enucleated by DPBS containing 0.5% hyaluronidase, placed on a vortex oscillator to shake for 3-4 minutes, poured into operating fluid, quickly picked out the oocyte to stop digestion, picked out the oocyte containing the first polar body under a microscope, and placed into a culture medium to be cultured for later use.
3. Microinjection of the Gene editing System
The Cas9 protein and CFTR-sgRNA, RAG2-sgRNA, respectively, were mixed at a concentration of 100 (Cas 9): 50 (sgRNA) ng/. Mu.l was mixed and injected once at the unicellular stage after the in vitro maturation of the parthenogenetic pig embryo, and then injected again at the secondary cell stage, at an injection amount of about 20pl. Both injections were performed using a micro-quantitative injector (FemtoJet 4i, eppendorf) with parameters set to an injection pressure of 40 and a maintenance pressure of 20. After the injection is finished, the swine parthenogenetic embryo is cultured in vitro, and the targeted gene modified swine embryo is cultured.
4. Performing genotype identification
After the pig parthenogenetic embryo develops for 5-6 days to form a blastocyst, the blastocyst is collected for PCR and gene sequencing identification, and a PCR primer pair of a CFTR gene targeting sequence is a forward primer CFTR-F:5 '-agagctttttggcaaagcacc-3' and a reverse primer CFTR-R: 5 '-agagctatgttggcgcgctttgatga-3', the PCR product sequence is (wherein the underlined part is the targeting sequence and the bold italic part is the PAM region): gtagctttgtgcaaagcagcagcagcagcagcagcacgaacaggtgcttaatattatatttgcataaattaaattaaattaaattagaaattagaaataacatccttgcttgtaggatgaggatgacagtggatgtgcatccctgagagagagagagagagagttgatttgaatttgaacgttaactataacaatggtttttccagtttgattgattgatgattgattgattgattgattgattgattgattgattgattgattgaggtgcatctgattgattgattgagtgattgattgagtgattgattgattgattgattgattgattgattgattgattgattgattgattgattgagtgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgtttgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgattgggagaactggagccttcaga ggg<xnotran> taaaattaagcacagtggaagaatttcattctgctctcagttttcctggatcatgccgggcaccattaaagaaaacatcatctttggtgtttcctatgatgagtatagatacaggagtgtcatcaaagcgtgccaactaga. </xnotran> The PCR primer pair of the RAG2 gene targeting sequence is a forward primer RAG2-F:5 'cat caacagaagaatccagggga-3' and a reverse primer RAG2-R:5 'cat cagtgctccttgctatcacatg-3', the PCR product sequence is (wherein the underlined part is the targeting sequence and the bold italic part is the PAM region): catcaacagaagatccaggggactcccactcccttgaagactcagagagaaaattttgtttcagtgcaagaagcaaaattttttgatgatggtgatgatgaatcgaaccgaaccgaaccgaaggatgaaggtgaaggttctgagaccgggcttatgactgcttatgactgccttg tgatatggatatcaacact tgg<xnotran> gtaccattttattcaactgagctcaacaaacctgccatgatctactgctctcatggagatgggcattgggtccatgcccagtgcatggatctggcagaacacacactcatccatctgtcagaaggaagcagcaagtattactgcaaggagcatgtggagatagcaagagcactg. </xnotran> The PCR program was performed under 60 ℃ annealing conditions, and the extension was performed at 20sec,35 cycles, and 30 ul. This PCR product was sent to sequencing, resulting in the sequencing results of fig. 2 and 3. The results of statistics are shown in table 1, the gene editing rate of the Cas9 protein and CFTR-sgRNA injected embryos is 42.9%, and the pure gene editing rate is pureThe zygotic efficiency was 14.3%, while the gene editing rate of the two (two-cell stage) injected embryos was 50%, and the homozygotic efficiency was 16.7%; the gene editing rate of the Cas9 protein and RAG2-sgRNA for one embryo injection was 90.9%, the homozygote efficiency was 54.5%, while the gene editing rate for two embryos injections was 100%, and the homozygote efficiency was 77.8%. It was found that the embryos injected again at the two-cell stage had significantly higher success rates of editing (FIG. 4 and Table 1) and also significantly increased homozygote probabilities (FIG. 5 and Table 1) compared to the embryos injected once at the single-cell stage. And the embryo edited homozygote genotypes of both Cas9 protein and CFTR-sgRNA, or Cas9 protein and RAG2-sgRNA were significantly improved after two injections (fig. 4 and 5).
Table 1: comparison of the results of one injection at the single cell stage with two injections at the single cell and two cell stages, respectively
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that various changes and modifications can be made by those skilled in the art without departing from the spirit of the invention, and these changes and modifications are all within the scope of the invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Claims (2)
1. A microinjection method for improving the obtaining rate of porcine homozygote is characterized in that target genes are edited by a microinjection gene editing system respectively in the single cell period and the two cell period of a porcine parthenogenetic embryo to obtain a target gene editing porcine parthenogenetic embryo; further carrying out in-vitro culture on the pig parthenogenetic embryo to obtain a high-efficiency target gene modified homozygous pig parthenogenetic embryo;
wherein, the microinjection method comprises the following steps:
(1) Constructing a gene editing system of a target gene;
(2) Obtaining and culturing parthenogenetic embryos;
(3) Injecting the gene editing system in the step (1) into the parthenogenetic embryo through a microinjection gene editing system for two times respectively, wherein the period of injecting the gene editing system for the first time is the single cell period of the parthenogenetic embryo, and the period of injecting the gene editing system for the second time is the secondary cell period of the parthenogenetic embryo;
(4) In-vitro culturing the swine parthenogenetic embryo to obtain a high-efficiency target gene modified homozygous daughter swine parthenogenetic blastocyst after 5-6 days;
the target genes are CFTR and RAG2 genes; the sgRNA nucleotide sequence designed aiming at the CFTR gene in the gene editing system is shown as SEQ ID NO:1 is shown in the specification; the sgRNA nucleotide sequence designed for RAG2 gene in the gene editing system is shown as SEQ ID NO:2 is shown in the specification; in the microinjection gene editing system, the concentration ratio of the Cas9 protein to the sgRNA is 2.
2. The microinjection method of claim 1, wherein in the microinjection gene editing system, the concentration of Cas9 protein is 100ng/ul, and the concentration of sgRNA is 50ng/ul.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010100231.5A CN111235184B (en) | 2020-02-18 | 2020-02-18 | Method for improving porcine embryo gene modified homozygote |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010100231.5A CN111235184B (en) | 2020-02-18 | 2020-02-18 | Method for improving porcine embryo gene modified homozygote |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111235184A CN111235184A (en) | 2020-06-05 |
| CN111235184B true CN111235184B (en) | 2023-03-14 |
Family
ID=70866964
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010100231.5A Active CN111235184B (en) | 2020-02-18 | 2020-02-18 | Method for improving porcine embryo gene modified homozygote |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111235184B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101914491A (en) * | 2010-08-31 | 2010-12-15 | 湖南光琇高新生命科技有限公司 | Method for obtaining parthenogenetic embryonic stem cells |
| CN104651399A (en) * | 2014-12-31 | 2015-05-27 | 广西大学 | Method for realizing gene knockout in porcine embryonic cells by using CRISPR/Cas system |
| CN107267516A (en) * | 2017-07-28 | 2017-10-20 | 佛山科学技术学院 | The accurate method of modifying of gene of double sgRNA mediations and application |
| CN107699571A (en) * | 2017-09-06 | 2018-02-16 | 湖北省农业科学院畜牧兽医研究所 | A kind of porcine somatostatin gene editing site and its application |
| WO2018132936A1 (en) * | 2017-01-17 | 2018-07-26 | Guangzhou Institutes Of Biomedicine And Health, Chinese Academy Of Sciences | Genetical alternation and disease modelling using cre-dependent cas9 expressing mammals |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2861394T3 (en) * | 2015-07-29 | 2021-10-06 | New York Stem Cell Found Inc | Haploid human embryonic stem cell lines and somatic cell lines and methods for obtaining the same |
-
2020
- 2020-02-18 CN CN202010100231.5A patent/CN111235184B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101914491A (en) * | 2010-08-31 | 2010-12-15 | 湖南光琇高新生命科技有限公司 | Method for obtaining parthenogenetic embryonic stem cells |
| CN104651399A (en) * | 2014-12-31 | 2015-05-27 | 广西大学 | Method for realizing gene knockout in porcine embryonic cells by using CRISPR/Cas system |
| WO2018132936A1 (en) * | 2017-01-17 | 2018-07-26 | Guangzhou Institutes Of Biomedicine And Health, Chinese Academy Of Sciences | Genetical alternation and disease modelling using cre-dependent cas9 expressing mammals |
| CN107267516A (en) * | 2017-07-28 | 2017-10-20 | 佛山科学技术学院 | The accurate method of modifying of gene of double sgRNA mediations and application |
| CN107699571A (en) * | 2017-09-06 | 2018-02-16 | 湖北省农业科学院畜牧兽医研究所 | A kind of porcine somatostatin gene editing site and its application |
Non-Patent Citations (1)
| Title |
|---|
| 利用猪单个胚胎建立高效快速的CRISPR/Cas9打靶位点检测方法;康难难等;《中国科学:生命科学》;20160320(第03期);54-63 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111235184A (en) | 2020-06-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105039339B (en) | A kind of method of specific knockdown sheep FecB genes with RNA mediations and its special sgRNA | |
| CN110551759B (en) | Composition and method for improving recombination efficiency of transgenic cells | |
| CN104531705A (en) | Method for knocking off animal myostatin gene by using CRISPR-Cas9 system | |
| CN108642055A (en) | The sgRNA of pig miR-17-92 gene clusters can effectively be edited | |
| CN104531704A (en) | Method for knocking off animal FGF5 gene by using CRISPR-Cas9 system | |
| CN109385451B (en) | Oyster CRISPR/Cas9 gene editing method | |
| CN109055434B (en) | Method for correcting pig KIT gene structure mutation by CRISPRCs 9 technology | |
| CN105505879A (en) | Method and culture medium for culturing transgenic animal embryonic cells or transgenic animals | |
| CN111718933B (en) | Preparation method and application of rrbp1 gene knockout hot claw frog model | |
| CN117587025A (en) | Medaka parent source effector org and sgRNA fragment thereof | |
| CN110684769A (en) | Ostrea gigas EF-1 alpha promoter, recombinant vector and application thereof | |
| CN111893119B (en) | Method for obtaining SCD1 gene editing goat embryo by using CRISPR/Cas9 system and microinjection | |
| CN111235184B (en) | Method for improving porcine embryo gene modified homozygote | |
| CN113234756A (en) | Construction method of LAMA3 gene knockout animal model based on CRISPR/Cas9 technology | |
| CN115279900A (en) | Optimized methods for cleaving a target sequence | |
| CN112831498A (en) | Method for site-directed mutagenesis or insertion of oyster genome mediated by ssODN | |
| CN112779259B (en) | sgRNA for precisely editing sheep OCT4 gene, primer for amplification and application | |
| CN115807038A (en) | Retina differentiation potential cell line CRX-Shen001 and construction method thereof | |
| CN113493786B (en) | Method for blocking or weakening expression of OsMIR3979 in rice to improve rice seed shape | |
| Su et al. | Effective generation of maternal genome point mutated porcine embryos by injection of cytosine base editor into germinal vesicle oocytes | |
| CN113249409A (en) | BMI1 gene-deleted zebra fish | |
| CN112695034A (en) | Preparation method of zebra fish with ApoE gene deletion | |
| CN105132426A (en) | Method for acquiring gene editing sheep by RNA-mediated specific FGF5 gene knockout and special sgRNA for method | |
| CN114592011B (en) | Construction method of PTDSS2 conditional gene knockout mouse model | |
| CN114891791B (en) | sgRNA of specific targeting canine Rosa26 gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |