CN109385451B

CN109385451B - Oyster CRISPR/Cas9 gene editing method

Info

Publication number: CN109385451B
Application number: CN201811316315.1A
Authority: CN
Inventors: 于红; 李琪; 李绘娟; 许瑞; 岳晨阳
Original assignee: Ocean University of China
Current assignee: Ocean University of China
Priority date: 2018-11-07
Filing date: 2018-11-07
Publication date: 2020-07-07
Anticipated expiration: 2038-11-07
Also published as: CN109385451A

Abstract

The invention discloses an oyster CRISPR/Cas9 gene editing method, which comprises the following steps: screening a sgRNA target site sequence of a gene to be edited, designing a sgRNA sequence of a target sequence, and carrying out in-vitro transcription to obtain a high-concentration target gene sgRNA; and (3) mixing the sgRNA and the Cas9 protein in equal volume, reacting at 37 ℃ for 15 minutes, mixing with a phenol red solution in equal volume, introducing the mixture into oyster fertilized eggs by adopting a microinjection method, and after incubating for 6 hours, detecting oyster embryos or larvae to obtain corresponding gene mutants. The invention successfully establishes an oyster gene editing technology for the first time, and the technology can be used for researching oyster gene functions, can also be used for accurately modifying oyster endogenous genes, and provides technical support for genetic improvement and breeding of oysters.

Description

Oyster CRISPR/Cas9 gene editing method

Technical Field

The invention relates to the technical field of aquatic animal gene function verification research, in particular to an oyster CRISPR/Cas9 gene editing method.

Background

The oysters are worldwide distributed groups and are economic shellfishes with the highest yield in China and the world. In 2016, the oyster cultivation yield in China reaches 483.5 ten thousand tons, which accounts for 34 percent of the total shellfish cultivation yield in China and 81.5 percent of the total oyster cultivation yield in the world. In recent years, genetic breeding work of oysters in all countries is carried out one after another, and new oyster varieties such as 'Haima No. 1' and 'Haima No. 2' are successively cultivated in China. However, the genetic breeding work of oysters is mainly based on the traditional artificial breeding method, and the technologies such as whole genome selective breeding and molecular assisted selective breeding are not really applied to the genetic breeding of oysters, wherein the main limiting factor is that the function of oyster genes is not clear. At present, the gene function research carried out in oysters is mainly limited to gene cloning and expression pattern analysis.

The gene editing technology is the most direct and effective method for researching gene functions, and has been widely applied to gene function research in higher animals and model animals, from early TALENs and ZFNs gene editing technologies to CRISPR/Cas9 gene editing technologies in recent years. Researchers utilizing gene editing technology have elucidated more and more gene functions, and among them, the generation of CRISPR/Cas9 technology has opened up the wave of gene editing. Compared with TALENs and ZFNs gene editing technologies, the CRISPR/Cas9 has the advantages of simplicity in operation, wide target selection, low cost, high efficiency and the like. In recent five years, researchers have successfully realized the accurate editing of genes in various organisms such as human beings, mice, arabidopsis thaliana, zebrafish, nematodes, drosophila, goats, cattle, pigs, silkworms and the like by utilizing the CRISPR/Cas9 technology, and become a second choice for gene editing of many researchers.

At present, CRISPR/Cas9 gene editing is mainly realized by introducing Cas9 and sgRNA into fertilized eggs by means of microinjection technology or electrotransfer technology, wherein the microinjection method is the only method which can achieve 100 percent of gene editing efficiency by using small dosage of Cas9/gRNA at present. The electrotransformation technology has the advantage of high flux, a large number of fertilized eggs can be operated simultaneously in a short time, but the damage of electric shock to the fertilized eggs is large, the mortality rate of the fertilized eggs after electrotransformation is far higher than that of a microinjection method, and the electrotransformation method needs a large amount of Cas9 and sgRNA, so that the cost of gene editing is greatly increased. Researchers use a plasmid DNA method instead to edit electric transgenes, but the plasmid DNA can only play a role after entering fertilized eggs through processes such as transcription and translation, and the editing efficiency is far lower than that of a Cas9 protein + sgRNA combination, so that at present, CRISPR/Cas9 gene editing by microinjection is the most efficient method.

However, the marine shellfish gene editing technology is developed slowly and only appears in the gastropods with larger fertilized eggs, and the bivalve gene editing is not reported and is difficult to apply. CRISPR/Cas9 gene editing using microinjection requires solving two major problems, firstly, fixation of fertilized eggs, and secondly, injection doses of Cas9 protein and sgRNA. The oosperm size is the main factor that influences these two problems, and the size of oosperm at first is the inverse ratio with fixed difficult and easy degree, and great oosperm (for example zebra fish oosperm diameter 1 mm, sturgeon fish oosperm diameter 2.5-3.9 mm) generally use the draw-in groove of agarose preparation alright fix, and then carry out microinjection, because the oosperm is bulky, can not remove because of the injection needle injection, whole micromanipulation process alright completion under style microscope. Smaller fertilized eggs, such as oysters (the diameter of the fertilized eggs is 47 microns), are difficult to fix by using clamping grooves made of agarose, and the fertilized eggs can move due to the touch of an injection needle in the injection process, so that microinjection is influenced; in addition, due to the small egg diameter, an inverted microscope is required for micromanipulation. Furthermore, the injected doses of the Cas9 protein and the sgRNA of different species are greatly different, and species referential performance among the species is poor, for example, the amount of the sgRNA and the Cas9 protein required by zebra fish gene editing is 70-150 pg and 500 pg, and the amount of the sgRNA and the Cas9 protein required by sturgeon gene editing is 60 pg and 200 pg. The injection volume is typically no more than 1/125 times the volume of the zygote, which would otherwise burst. The smaller the zygote, the smaller and more difficult the volume of sgRNA and Cas9 protein that can be injected. These undoubtedly pose a significant challenge to microinjection gene editing of oysters.

Disclosure of Invention

The invention aims to provide a gene editing method for oysters, which is implemented by combining a CRISPR/Cas9 system with an oyster target gene specific sgRNA and utilizing a microinjection method.

The specific technical scheme of the invention is as follows:

an oyster CRISPR/Cas9 gene editing method comprising: firstly, synthesizing a target gene sgRNA through in vitro transcription; then, the target gene sgRNA is mixed with Cas9 protein and phenol red, and the mixture is introduced into oyster fertilized eggs by a microinjection method.

Further, the in vitro transcription synthesizes high concentration target gene sgRNA, and the concentration after purification is 4000-.

Further, the in vitro transcription synthesizes high-concentration target gene sgRNA, and the concentration after purification is 6500 ng/. mu.L.

Further, the sgRNA of the target gene is mixed with the Cas9 protein, reacted at 37 ℃, and then mixed with phenol red.

Furthermore, the target gene sgRNA and the Cas9 protein are mixed in equal volume, reacted for 15min at 37 ℃, and then mixed with 0.07% phenol red in equal volume, the final concentration of the target gene sgRNA is 375-750 ng/muL, the final concentration of the Cas9 protein is 750 ng/muL, and the ratio of the final concentrations of the sgRNA and the Cas9 protein is 1/1-1/2.

Further, the introduction is performed by fixing the fertilized egg using a holding capillary needle having an outer diameter of 45 to 55 μm, an inner diameter of less than 30 μm, a folding angle of 20 to 40 ° and a tip length of 0.5 to 1 mm, and then injecting using an injection capillary needle having an inner diameter of 1 to 2 μm.

Further, the volume of the mixture injected per fertilized egg was 0.1 nL.

In addition, after microinjection of the mixture into fertilized eggs of oysters, incubation is carried out for 6 hours, 12 hours and 16 hours, and all the embryos, trochophores or D-shaped disc larvae at the protogut stage of the oysters can be collected to obtain gene mutants for verifying the effectiveness of the gene editing method.

The invention has the advantages and beneficial effects that:

at present, no micromanipulation technology and gene precise editing prior art report of oyster zygotes exist, the invention successfully introduces high-concentration sgRNA and Cas9 protein into oyster zygotes by using a microinjection method, finally obtains oyster gene mutation, establishes an oyster gene editing technology for the first time, and provides a powerful technical basis for developing oyster gene function research and genetic improvement in the future.

Drawings

FIG. 1 is a diagram showing the sequencing result of the second exon nucleotide mutation of the Ostrea gigas SMYD5 gene in the example.

FIG. 2 is an analysis alignment chart of the mutant sequence and the wild type sequence in the example.

Detailed Description

The technical solutions of the present invention, if not specifically mentioned, are conventional in the art, and the reagents or materials, if not specifically mentioned, are commercially available.

Example (b):

taking the oyster SET and MYND domain containment 5 (SMYD 5) gene as an example, the oyster gene editing technology is established, and is further elaborated below.

1) Obtaining fertilized eggs of crassostrea gigas

Selecting parent oysters of crassostrea gigas with mature gonads, collecting sperms and ova by adopting an anatomical method, carrying out artificial insemination, and using the obtained fertilized ova for gene editing.

2) sgRNA for constructing crassostrea gigas target gene SMYD5

Aiming at a second exon of a crassostrea gigas target gene SMYD5 (GeneID: 105330417), designing a sgRNA target point which is GGCTGCTGCTTACGAAGAGAGGG on line, wherein a PAM sequence is GGG; the specific steps for adjusting and synthesizing the sgRNA are as follows: designing a forward primer Sg-smyd1F, wherein the primer sequence is 5'-GATCACTAATACGACTCACTATA GGCTGCTGCTTACGAAGAGAGTTTTAGAGCTAGAAAT-3' (containing a T7 promoter sequence), taking a DR274 plasmid (Addge plasmid 42250) as a template, and carrying out PCR amplification by using the forward primer Sg-smyd1F and a universal primer Sg-R (5'-AAAAGCACCGACTCGGTGCC-3'), wherein the PCR reaction conditions are as follows: 30 seconds at 98 ℃; 35 cycles comprising 98 ℃ for 5 seconds, 60 ℃ for 10 seconds, 72 ℃ for 5 seconds; 5 minutes at 72 ℃. PCR amplification was performed using high fidelity enzyme (Thermo, F530S), and the PCR product was purified by conventional methods. The sgRNA was transcribed using a T7 in vitro transcription kit (Thermo, AM 1354) using the purified PCR product as a template, and purified using a conventional phenol chloroform method. Cas9 protein (Clontech, 632640) was mixed with sgRNA in equal volumes, placed at 37 ℃ for 15 minutes, and mixed with 0.07% phenol red in equal volumes. The final concentration of sgRNA was 375 ng/. mu.L, and the final concentration of Cas9 protein was 750 ng/. mu.L. Aspirate 1 μ L of the mixture and inject into the syringe needle.

3) Fertilized egg of crassostrea gigas by microinjection

Placing the fertilized eggs of the crassostrea gigas prepared in the step 1) in the center of a disposable plastic culture dish with the diameter of 60 mm, dripping 1-2 drops of seawater, and adjusting the fertilized eggs to the visual field by using an inverted microscope. Adjusting the pressure of a suction needle to be negative pressure by using a pneumatic manual microinjection instrument, and sucking and fixing a fertilized egg, wherein the outer diameter range of the suction needle is 45-55 μm, and the inner diameter is less than 30 μm; the folding angle is 20-40 degrees, and the 30-degree folding angle is optimal; the length of the tip is 0.5-1 mm. 0.1 nL of a mixture of Cas9 protein, sgRNA, and phenol red was injected into crassostrea gigas fertilized eggs using a nitrogen pressurized quantitative microinjection system. After injection, the injected eggs are discharged by adjusting the internal pressure of the holding needle to be positive pressure, the position of the holding needle is changed, and other fertilized eggs are held by the internal pressure of the holding needle, so that the injection is carried out one by one. Culturing the injected embryo in sterile seawater at 23-24 deg.C, with survival rate of more than 80%.

4) Target gene mutation detection

Collecting oyster embryos or larvae at 8 hours, 12 hours and 16 hours after microinjection, mixing and extracting DNA from 4-8 embryos or larvae, and extracting the genomic DNA of the oyster embryos and larvae by using a conventional method. Detection primers F: 5'-TCTTTGAATCCAGCCGACCAC-3' and R: 5'-CCTGTTGAAGAGCCATCGTAAAGC-3' were designed to amplify the genomic fragment containing the target site. The PCR reaction conditions are as follows: 3 minutes at 94 ℃; 45 cycles comprising 94 ℃ for 30 seconds, 60 ℃ for 30 seconds, 72 ℃ for 30 seconds; 5 minutes at 72 ℃. The PCR product was sent to the sequencing company for purification and sequencing. And (3) carrying out conventional TA cloning on a sample with the detected mutation, namely, starting to generate a set peak at 3-8 bases before the PAM locus, as shown in figure 1, randomly picking 10-15 monoclonals, sending to a sequencing company for sequencing, and further verifying the mutation and mutation type at the target locus, as shown in figure 2, detecting 2 bp, 4 bp and 5 bp deletion mutation, namely, generating mutation by utilizing the oyster CRISPR/Cas9 gene editing system mediated target gene, and the method can realize the accurate editing of the target gene.

Claims

1. An oyster CRISPR/Cas9 gene editing method, which comprises the following steps: firstly, synthesizing a target gene sgRNA through in vitro transcription; then mixing the target gene sgRNA with Cas9 protein and phenol red, and introducing the mixture into oyster fertilized eggs by using a microinjection method; the introduction uses a holding capillary needle with an outer diameter of 45-55 μm, an inner diameter of less than 30 μm, a folding angle of 20-40 degrees and a tip length of 0.5-1 mm to fix the fertilized egg, and then uses an injection capillary needle with an inner diameter of 1-2 μm to perform injection.

2. The method for gene editing according to claim 1, wherein the sgRNA is synthesized in high concentration by in vitro transcription, and the concentration after purification is 4000-7500 ng/μ L.

3. The method for gene editing according to claim 2, wherein the sgRNA is synthesized in vitro by transcription at a high concentration and the purified concentration is 6500 ng/μ L.

4. The gene editing method of claim 1, wherein the sgRNA of the target gene is mixed with the Cas9 protein, reacted at 37 ℃, and mixed with phenol red.

5. The gene editing method of claim 4, wherein the sgRNA of the target gene is mixed with the Cas9 protein in equal volume, reacted at 37 ℃ for 15min, and then mixed with phenol red in equal volume of 0.07%, the final concentration of the sgRNA of the target gene is 375 ng/μ L, the final concentration of the Cas9 protein is 750ng/μ L, and the ratio of the final concentrations of the sgRNA and the Cas9 protein is 1/1-1/2.

6. The gene editing method of claim 1, wherein each fertilized egg is injected with the mixture in a volume of 0.1 nL.

7. The gene editing method of claim 1, further comprising a verification step of: after microinjection of the mixture to oyster fertilized eggs, incubation for 6h, 12h and 16h, and monoclonal sequencing, wherein the collected oyster gastral stage embryos, trochophores or D-shaped disc larvae can obtain gene mutants.