CN111206010A - Recombinant bacillus amyloliquefaciens secreting extracellular alginate lyase and cellulase and application thereof - Google Patents
Recombinant bacillus amyloliquefaciens secreting extracellular alginate lyase and cellulase and application thereof Download PDFInfo
- Publication number
- CN111206010A CN111206010A CN202010139302.2A CN202010139302A CN111206010A CN 111206010 A CN111206010 A CN 111206010A CN 202010139302 A CN202010139302 A CN 202010139302A CN 111206010 A CN111206010 A CN 111206010A
- Authority
- CN
- China
- Prior art keywords
- bacillus amyloliquefaciens
- cellulase
- alginate lyase
- kelp
- recombinant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2437—Cellulases (3.2.1.4; 3.2.1.74; 3.2.1.91; 3.2.1.150)
-
- C—CHEMISTRY; METALLURGY
- C05—FERTILISERS; MANUFACTURE THEREOF
- C05B—PHOSPHATIC FERTILISERS
- C05B7/00—Fertilisers based essentially on alkali or ammonium orthophosphates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01004—Cellulase (3.2.1.4), i.e. endo-1,4-beta-glucanase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y402/00—Carbon-oxygen lyases (4.2)
- C12Y402/02—Carbon-oxygen lyases (4.2) acting on polysaccharides (4.2.2)
- C12Y402/02011—Poly(alpha-L-guluronate) lyase (4.2.2.11), i.e. alginase II
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02W—CLIMATE CHANGE MITIGATION TECHNOLOGIES RELATED TO WASTEWATER TREATMENT OR WASTE MANAGEMENT
- Y02W30/00—Technologies for solid waste management
- Y02W30/40—Bio-organic fraction processing; Production of fertilisers from the organic fraction of waste or refuse
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a recombinant bacillus amyloliquefaciens secreting algin lyase and cellulase outside cells and an application thereof, belonging to the technical field of genetic engineering.A algin lyase and a cellulase coding gene are connected with an expression plasmid and are electrically transformed into the bacillus amyloliquefaciens to obtain the recombinant bacillus amyloliquefaciens; culturing and recombining the bacillus amyloliquefaciens seed liquid, directly inoculating the seed liquid to a kelp residue culture medium, adding ammonium sulfate serving as a nitrogen source, fermenting for 96 hours, and converting kelp residue to produce the bacterial fertilizer rich in algal oligosaccharides and bacillus amyloliquefaciens. The kelp residues are fermented by utilizing the recombinant bacillus amyloliquefaciens, and are simply, conveniently and quickly converted into the compound bacterial fertilizer rich in oligosaccharide and active bacillus amyloliquefaciens. The composite bacterial fertilizer provided by the invention has high proportion of active bacteria, is rich in novel biological stimulin, namely algal oligosaccharide, and can better promote plant growth and rooting. The invention provides a new idea for kelp residue in the field of agricultural comprehensive utilization.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a recombinant bacillus amyloliquefaciens secreting extracellular algin lyase and cellulase and application thereof.
Background
The kelp is a marine brown algae product with important value, and contains a plurality of active substances such as algin, fucoxanthin, mannitol, iodine and the like. China is the first large kelp planting country in the world, the annual yield of dried kelp is 200 ten thousand tons, and the annual yield of alginate extracted from kelp accounts for more than 60% of the world. The polysaccharide macromolecules derived from brown algae such as alginate, fucoidan and the like have various biological activities and have great application values in the fields of medicine, agriculture and food. A series of oligosaccharide molecules with different molecular weights, which are generated after alginate polysaccharide is hydrolyzed by special enzyme, have special biological activity which the polysaccharide does not have, and have great application potential in the fields of medicine, food and agriculture.
The kelp residue is residue after processing of algin extracted from kelp, and similar to kelp components, the kelp residue also contains many active substances such as fucoidan, fucoxanthin, kelp starch and the like, and different from the kelp residue, the kelp residue also contains a plurality of insoluble crude fibers. The protein content of the kelp residue is 16.0 percent, the crude fiber content is 30.0 percent and the amino nitrogen content is 0.2 percent through determination. The disposal of kelp residue can be done in several ways, the first being treated as production waste which is discharged directly into the environment without being disposed of, causing a great pollution to the environment, and this method has been abandoned for a long time. And secondly, the kelp residue is subjected to harmless treatment by a biological sludge method according to organic wastes, so that the problems can be solved, the treatment cost is increased, and simultaneously, the resource waste is caused and basically abandoned. Thirdly, the kelp residue is added into the feed of the cultured animals after being dried and purified, and the health level of the cultured animals can be improved by using the reported kelp residue as the feed additive, so that certain economic benefit is obtained. However, macromolecules such as alginate and crude fibers contained in the kelp residues are compounds which are difficult to utilize by intestinal microorganisms. Therefore, the degree of the kelp residue added into the feed is unknown, and the problem of low absorptivity exists, which is questionable. Therefore, the development of a technical route for more efficiently and reasonably utilizing the kelp residues and the improvement of the comprehensive utilization efficiency of the kelp are important subjects worth of research and solution.
The kelp residue contains high content of alginate polysaccharide and high content of crude fiber. Both of these are relatively difficult components to utilize by common microorganisms, especially intestinal microorganisms. Therefore, pretreatment and degradation of the kelp residues are necessary links for reasonable development and utilization of the kelp residues. The invention integrates enzymolysis and fermentation methods, constructs Bacillus amyloliquefaciens (Bacillus amyloliquefaciens) engineering bacteria secreting and expressing alginase for specifically hydrolyzing algin and cellulase for hydrolyzing crude cellulose, fully performs enzymolysis on kelp residue by a microbial fermentation technology, and finally obtains a microecological bactericide containing active molecules such as alginate oligosaccharide, fucoxanthin, gluco-oligosaccharide and the like and active Bacillus amyloliquefaciens by flash evaporation. The microbial inoculum can be used for the planting industry and the breeding industry, is a novel microecological microbial inoculum, and has important application value and significance.
Disclosure of Invention
An object of the present invention is to develop a more efficient and rational utilization of kelp residue and to elucidate the advantages of the technical route.
The invention also aims to provide a recombinant bacillus amyloliquefaciens secreting the algin lyase and the cellulase outside cells, the coding genes of the two enzymes are connected with an expression vector for recombination and then transferred into the bacillus amyloliquefaciens, and the recombinant engineering bacteria are successfully constructed by utilizing the gene engineering technology.
The invention also aims to provide a production method for producing the microecological bactericide by fermenting the kelp residue with the recombinant bacillus amyloliquefaciens engineering bacteria which secrete the alginate lyase and the cellulase extracellularly.
The invention also aims to provide the kelp residue fermented by the recombinant bacillus amyloliquefaciens engineering bacteria and the application of the produced microecological bactericide in the plant root growth promotion experiment.
In order to achieve the above objects and other advantages, the present invention provides a recombinant bacillus amyloliquefaciens secreting extracellular alginate lyase and cellulase, wherein the alginate lyase and cellulase encoding genes are linked with an expression plasmid to construct a recombinant expression plasmid, and the recombinant expression plasmid is transferred into the bacillus amyloliquefaciens to obtain the recombinant bacillus amyloliquefaciens.
Further, the alginate lyase synthetase encoding gene is derived from the bacterium Pseudomonas aeruginosa ATCC27853, and the cellulase encoding gene is derived from Trichoderma reesei c30ATCC 56756; the nucleic acid sequences of both genes were optimized globally according to the codon preference of Bacillus amyloliquefaciens. The bacillus amyloliquefaciens strain is ATCC 23350.
Furthermore, the nucleotide sequence of the coding gene of the alginate lyase is shown as SEQ ID NO.1, and the nucleotide sequence of the coding gene of the cellulase is shown as SEQ ID NO. 2.
The invention also provides a construction method of the recombinant bacillus amyloliquefaciens for extracellularly secreting the alginate lyase and the cellulase, which comprises the following steps:
step 1: connecting the alginate lyase and cellulase coding genes to an expression plasmid by a cloning method to construct a recombinant expression plasmid;
step 2: and (3) electrically transforming the constructed recombinant expression plasmid into bacillus amyloliquefaciens to obtain the recombinant bacillus amyloliquefaciens for producing the alginate lyase and the cellulase.
Further, the expression plasmid was pht43HpaII duet enzyme.
Plasmid mapping and construction procedure see FIG. 1
Further, the alginate lyase coding gene expresses alginate lyase, the amino acid sequence of the alginate lyase is shown as SEQ ID NO.3, the cellulase coding gene expresses cellulase, and the amino acid sequence of the cellulase is shown as SEQ ID NO. 4.
The invention also provides application of the recombinant bacillus amyloliquefaciens for extracellularly secreting the alginate lyase and the cellulase in preparation of the composite bacterial fertilizer containing the alginate oligosaccharides by fermenting the kelp residues.
Further, the inoculum size was: inoculating the recombinant bacillus amyloliquefaciens seed liquid into the fermentation culture medium according to the volume ratio of 3-5%; the fermentation conditions were: fermenting at 35-37 deg.C for 96 hr.
Further, the fermentation medium comprises the following components in mass concentration: kelp residue 400g/L and ammonium sulfate 10.0g/L, K2HPO4·3H2O 10.0g/L、KH2PO42.0g/L and MgSO4·7H2O 1.2g/L。
The invention at least comprises the following beneficial effects:
the invention discloses a recombinant bacillus amyloliquefaciens, which is obtained by connecting an alginate lyase coding gene, a cellulase coding gene and an expression vector and introducing the alginate lyase coding gene, the cellulase coding gene and the expression vector into a bacillus amyloliquefaciens host cell. Bacillus amyloliquefaciens is an important micro-ecological strain and is an industrial production strain with food safety level certified by the FDA in the United states. The bacillus amyloliquefaciens can secrete protease, amylase and various antibacterial peptides and antifungal peptides and is widely applied to agriculture and feed industry. As a microecological strain with rapid growth and simple culture conditions, the bacillus amyloliquefaciens has mature large-scale fermentation process and low production cost. The invention provides a recombinant bacillus amyloliquefaciens strain which can be used for producing a novel microecological compound bacterial fertilizer rich in oligosaccharide by converting kelp residues and has a good application prospect.
The invention also discloses a production mode for producing the microecological bacterial fertilizer by fermenting the kelp residue through the recombinant bacillus amyloliquefaciens, which is a mode of inoculating the kelp residue culture medium through the recombinant bacillus amyloliquefaciens seed liquid, and stirring and fermenting at constant temperature. The method lays a foundation for further producing the compound bacterial fertilizer by converting the kelp residue by the bacillus amyloliquefaciens in a large scale in a factory.
The invention discloses a production method for producing a microecological compound bacterial fertilizer by directly converting kelp residues through fermentation of recombinant bacillus amyloliquefaciens, which provides a method for adding inoculated recombinant bacillus amyloliquefaciens seed liquid into the kelp residues and fermenting for 96 hours at about 35 ℃ to obtain recombinant bacillus amyloliquefaciens fermentation liquid. Calculating fermentation by plate countingThe liquid contains high concentration of recombinant Bacillus amyloliquefaciens with cell number of 1011More than CFU/ml, and through TLC (thin layer chromatography) determination, the fermentation broth also contains a large amount of reducing oligosaccharides with different molecular polymerization degrees, the concentration content reaches more than 20mg/ml, and the brown algae oligosaccharides are mainly contained.
Additional advantages, objects, and features of the invention will be set forth in part in the description which follows and in part will become apparent to those having ordinary skill in the art upon examination of the following or may be learned from practice of the invention.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.
FIG. 1 is a schematic diagram of construction of a two-enzyme expression plasmid according to example 1;
FIG. 2 is the PCR screening electrophoretogram of the colonies of the positive clones of example 2;
FIG. 3 is a TLC analysis chart of oligosaccharide products in the residue product of fermentation of kelp in example 5.
Detailed Description
Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.
It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The specification and examples are exemplary only.
As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.
The invention provides a recombinant bacillus amyloliquefaciens secreting algin lyase and cellulase outside cells, which is characterized in that the coding genes of the algin lyase and the cellulase synthetase are connected with an expression plasmid to construct a recombinant expression plasmid, and then the recombinant expression plasmid is electrically transformed into the bacillus amyloliquefaciens to obtain the recombinant bacillus amyloliquefaciens.
In the scheme, the bacillus amyloliquefaciens has a microecological strain with multiple purposes and has stronger ability of extracellularly secreting protein. Therefore, the molecular cloning technology is adopted to introduce the alginate lyase gene into the bacillus amyloliquefaciens, so as to successfully construct a large amount of recombinant engineering bacteria secreting recombinant alginate lyase and cellulase; the recombinant bacillus amyloliquefaciens is used for direct fermentation and transformation of kelp residues to produce the microecological bactericide containing various active oligosaccharide molecules. The bacillus amyloliquefaciens can secrete various antibacterial peptides and can suppress and kill other mixed bacteria in a fermentation system in the fermentation process. Therefore, when the kelp residue substrate is converted, the seed liquid can be directly inoculated with the unsterilized kelp residue, so that the high-temperature and high-pressure sterilization step is omitted, and the energy consumption and the cost are saved. The technical scheme provides an economical and effective new way for reasonable development and utilization of the kelp residue, and also provides a novel microecological bactericide rich in functional oligosaccharides.
In a preferred embodiment, the alginate lyase-encoding gene is derived from the bacterium Pseudomonas aeruginosa ATCC27853, and the cellulase-encoding gene is derived from Trichoderma reesei 30ATCC 56756; the Bacillus amyloliquefaciens strain is ATCC 23350.
In a preferred scheme, the nucleotide sequence of the alginate lyase coding gene is shown as SEQ ID NO. 1.
In a preferred embodiment, the nucleotide sequence of the cellulase coding gene is shown in SEQ ID NO. 2.
In a preferred embodiment, the Bacillus amyloliquefaciens expression plasmid is pht43HpaII duet enzyme.
In a preferred scheme, the alginate lyase coding gene expresses alginate lyase, and the amino acid sequence of the alginate lyase is shown as SEQ ID No. 3.
In a preferred scheme, the cellulase coding gene expresses cellulase, and the amino acid sequence of the cellulase is shown in SEQ ID NO. 4.
The invention also provides a method for producing bacterial manure by fermenting the kelp residue with the recombinant bacillus amyloliquefaciens which secretes the alginate lyase and the cellulase from the extracellular space, which comprises the following steps:
step 1: inoculating the recombinant bacillus amyloliquefaciens into a seed liquid culture medium, and shaking the culture medium by a shaking table overnight to prepare seed liquid;
step 2: 3000kg of tap water, 1000kg of solid kelp residue and ammonium sulfate and inorganic salt are added into a 5-ton fermentation tank, and after the mixture is stirred uniformly, the mixture does not need to be sterilized. Inoculating the seed liquid into a fermentation tank according to a certain proportion, fermenting for 96 hours under the condition of heat preservation, and keeping stirring.
And 4, measuring the number of viable bacillus amyloliquefaciens in the kelp residue conversion product by adopting a flat plate coating method.
And 5, after the fermentation is finished, directly feeding the fermentation liquor into drying equipment after large particles are removed from the fermentation liquor through a 5-micron filter, and obtaining the bacterial powder through a spray drying method.
In a preferred embodiment, the inoculation amount is: inoculating the recombinant bacillus amyloliquefaciens seed liquid into the fermentation transformation system according to the volume ratio of 3-5%; the fermentation conditions were: fermenting at 35-37 deg.C for 96-120 h.
In the scheme, before the recombinant bacillus amyloliquefaciens is inoculated to a fermentation culture medium, the recombinant bacillus amyloliquefaciens is firstly inoculated to a seed culture medium and cultured for 10-16h (preferably 10h) at 37 ℃ and 220rpm to obtain a seed solution; inoculating the seed solution 3-5% (preferably 5%) by volume into fermentation medium, and culturing at 35-37 deg.C under stirring at 100rpm for 96 hr.
The seed culture medium comprises the following components in mass concentration: 10g/L of peptone, 5g/L of yeast powder and 5g/L of sodium chloride.
In a preferred scheme, the kelp residue fermentation medium comprises the following components (taking a 5-ton reaction kettle as an example) in mass concentration: 3000kg of tap water, 1000kg of kelp residue dry powder, 40kg of ammonium sulfate and K2HPO4·3H2O 60kg、KH2PO412.5kg and MgSO4·7H2O 7.5kg。
In a preferred embodiment, the fermented product is spray-dried. The conditions are as follows, the air inlet temperature is 110 plus or minus 2 ℃, the tower wall temperature is 50 plus or minus 3 ℃, the air outlet temperature is 60 plus or minus 3 ℃, and the rotation speed of the atomizer is 18000 r/min.
In the scheme, the number of the viable bacteria of the recombinant bacillus amyloliquefaciens can reach 10 at the end of the fermentation by the open fermentation mode11cfu/ml, the content of reducing sugar and total sugar in the fermentation conversion system reaches 23.55 and 44.3mg/L (calculated by glucose). And (3) spray drying the fermented clear liquid to obtain bacterial powder, wherein the survival rate of viable bacteria of the recombinant bacillus amyloliquefaciens is more than 93%.
In order to more clearly illustrate the technical solution of the present invention, the following specific examples are further illustrated.
Example 1
Construction of recombinant expression plasmids
The cellulase coding gene derived from trichoderma reesei is optimized by bacillus amyloliquefaciens preference codon, and the gene is synthesized into a sequence shown as SEQ ID NO. 1.
An alginase coding gene (Genbank MG792316) from pseudomonas aeruginosa is subjected to codon preference optimization by bacillus amyloliquefaciens, and a sequence shown as SEQ ID NO.2 is synthesized.
According to the enzyme cutting site of pht43HpaII vector, the two genes are loaded into two multiple cloning sites of the vector by utilizing seamless cloning technology. The specific plasmid construction procedure is schematically shown in FIG. 1.
Example 2
Construction of recombinant Bacillus amyloliquefaciens Strain
1. The constructed recombinant expression plasmid pht43HpaII duet enzyme is transferred into the bacillus amyloliquefaciens by adopting a method of electrically converting protoplasts. The electrotransformation operation is specifically as follows:
1) inoculating bacillus amyloliquefaciens into 3ml of LB culture medium, and culturing overnight.
2) 2.6ml of the overnight culture was inoculated into 40ml (LB +0.5M sorbitol) and cultured at 37 ℃ and 200rpm until OD600 became 0.85-0.95.
3) And (3) carrying out ice-water bath on the bacterial liquid for 10min, and then centrifuging at 5000g and 5min at 4 ℃ to collect thalli.
4) Resuspend the cells in 50ml of pre-chilled electroporation medium (0.5M sorbitol, 0.5M mannitol, 10% glucose), centrifuge at 4 ℃ for 5min at 5000g, remove the supernatant and rinse 4 times.
5) The washed cells were suspended in 1ml of an electroporation medium and dispensed 120 portions per EP tube.
6) 50ng of pht43HpaII duet enzyme plasmid DNA (1-8. mu.l) was added to 60. mu.l of competent cells, incubated on ice for 2min, added to a pre-cooled electric rotor (1mm) and shocked once. The electrotransformation instrument sets up: 2.0kv,1mm, 1 time of electric shock. (as a result of electric shock, time constant is 4.5-5.0ms, and if time constant is <4.2, it is necessary to increase the number of times of rinsing the electroporation medium or increase the dilution factor of competence to obtain higher transformation efficiency)
7) After the electric shock, the cup was taken out and 1ml of RM (LB +0.5M sorbitol +0.38 mannitol) was immediately added thereto, and after resuscitating at 37 ℃ and 200rpm for 3 hours, the plate was smeared. The cells were cultured at 37 ℃ overnight.
2. Colony PCR was performed using pht43-F and pht43-R primers to screen for positive transformants.
Colony PCR amplification conditions were as follows:
TABLE 1 colony PCR amplification conditions
The reaction conditions of PCR were: pre-denaturation at 95 ℃ for 4 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 3min, and cycle number of 30; extension at 72 ℃ for 10 min. The primer sequences used were as follows:
pht43-F：cgatctttcagccgactcaaacat
pht43-R：CAAAATATACTGATCAACTGA
(3) the PCR products were detected by agarose gel electrophoresis and the results are shown in FIG. 2. The results show that the clones No. 1-5 all detect the existence of a 2800bp target band, and the recombinant Bacillus amyloliquefaciens is verified to be constructed successfully.
Example 3
Recombinant bacillus amyloliquefaciens fermentation enzymolysis kelp residue
(1) The recombinant Bacillus amyloliquefaciens single colony successfully constructed in the example 2 is inoculated in a seed culture medium and cultured for 10 hours at 37 ℃ and 220rpm for later use. Seed culture medium: the composition comprises the following components in mass concentration: 10g/L of peptone, 5g/L of yeast powder and 5g/L of sodium chloride.
(2) Inoculating the cultured recombinant bacillus amyloliquefaciens seed solution into a kelp residue fermentation culture medium according to the volume of 5%, fermenting for 96h at the temperature of 37 ℃, and stirring at the rotating speed of 120 rpm. The kelp residue fermentation medium comprises the following components in mass concentration:
(taking a 5-ton reaction kettle as an example): 3000kg of tap water, 1000kg of kelp residue dry powder, 40kg of ammonium sulfate and K2HPO4·3H2O 60kg、KH2PO412.5kg and MgSO4·7H2O 7.5kg。
Before seed inoculation, a portion of the fermentation medium was sampled and used as a control for subsequent analysis.
Example 4
Determination of oligosaccharide content in fermentation liquor
Oligosaccharide contains reducing sugar and total sugar, the content of reducing sugar is determined by DNS method, and the content of total sugar is determined by anthrone method
1.) taking part of the fermented product, filtering with a 5-micron filter bag to remove insoluble large particles, and collecting the filtrate.
2.) the supernatant was diluted with deionized water in four 5,10,100, 200-fold gradients.
3.) 1ml of each gradient dilution was taken, 2ml of DNS reagent was added, and a boiling water bath was carried out at 100 ℃ for 10 min.
4.) 7ml of deionized water are added and mixed, and after mixing, the OD value is measured at 540nm wavelength. And (4) converting the content of reducing sugar in the fermentation liquor by using a DNS glucose standard curve.
5.) taking 2ml of each gradient diluent, adding 6ml of anthrone reagent, uniformly mixing, carrying out boiling water bath at 100 ℃ for 10min, cooling with ice water for 15min, and measuring the OD value at the wavelength of 620 nm. Selecting OD values (0.2-0.4) of four diluted samples in a proper range, and converting the content of total sugar in the fermentation liquor by using an anthrone sulfate glucose standard curve
The preparation method of the anthrone reagent comprises the following steps: accurately weighing 0.1g anthrone, adding 80% concentrated H2SO4Dissolve 100mL of the solution, shake the solution evenly, and use the solution as it is.
The control samples taken before fermentation were also run according to the same procedure to determine reducing sugars and total sugar content.
The results are shown in Table 2
TABLE 2 reducing sugars and Total sugar content
EXAMPLE 5 determination of oligosaccharide products in fermentation broths
Determination of oligosaccharides by Thin Layer Chromatography (TLC)
(1) Collecting 1 μ l supernatant of fermentation product, spreading with TLC thin silica gel plate (product of Qingdao Huanghai corporation), spraying appropriate amount of developer, and oven drying at 130 deg.C for color development. Brown algae oligodisaccharide, oligotrisaccharide and oligotetrasaccharide (product of bos boy-wishful, Qingdao) were used as standards.
Developing agent: methanol and water (8: 2)
Color developing agent: aniline-diphenylamine-phosphoric acid
The preparation method comprises the following steps: mixing a 2% aniline acetone solution, a 2% diphenylamine acetone solution and 85% phosphoric acid according to a volume ratio of 5:5:11, and standing for later use.
(3) The TLC results are shown in FIG. 3.
From the results of TLC, it was found that the fermentation product of the kelp residue was mainly oligosaccharides having a degree of polymerization of 2,3, 4.
Example 6
Spray drying the fermented product to obtain bacterial powder
And filtering the fermented product by a 5-micron filter bag to remove insoluble large particles, collecting the filtered clear liquid, and introducing the clear liquid into a spray dryer for spray drying. The conditions are as follows, the air inlet temperature is 110 plus or minus 2 ℃, the tower wall temperature is 50 plus or minus 3 ℃, the air outlet temperature is 60 plus or minus 3 ℃, and the rotation speed of the atomizer is 18000 r/min. And uniformly collecting dried bacterial manure powder after drying, weighing and bagging, reserving a small amount of bacterial powder, and measuring the number of viable bacteria.
The experimental result shows that 4000 liters of fermentation liquor is totally filtered by a 5-micron filter bag to remove insoluble large particles, about 3800 liters of clear filtrate is filtered, and 202kg of bacterial powder is obtained after spray drying. The conversion ratio is that 50.5kg of bacterial powder can be obtained per 1000L of fermentation liquid sample.
Example 7
Determination of viable count in fermentation liquor and microbial inoculum dry powder
1) And (3) taking a part of fermented product, filtering by using a 5-micron filter bag to remove insoluble large particles, and collecting filtered clear liquid.
2) Diluting the clear filtrate with sterile deionized water 10-4,10-6,10-8Three gradients, each 100 μ l dilution is coated on LB plate, cultured overnight at 37 deg.C, the plate colony number is calculated, and the viable bacteria number in the initial fermentation liquid is calculated. The control sample before fermentation was also subjected to the same procedure to determine the number of viable bacteria therein.
3) 1g of the bacterial powder obtained in example 6 was precisely weighed, and 1ml of sterile deionized water was added to prepare a 1g/ml bacterial suspension.
4) Diluting the bacterial suspension obtained in the above step with sterile deionized water 10-4,10-6,10-8Three gradients, 100. mu.L each of the dilutions were spread on LB plates and incubated overnight at 37 ℃. The dilution (200- & ltSUB & gt 1000- & ltSUB & gt colonies/plate) with the number of colonies reasonably calculated is selected, the number of the colonies on the plate is calculated, and the number of viable bacteria in the initial bacterial powder (CFU/mg bacterial powder) is converted.
The results of viable cell number determination are shown in Table 3
TABLE 3 viable cell count determination
| Pre-fermentation control sample (CFU/ml) | Fermentation broth sample (CFU/ml) | Fungus powder sample (CFU/mg) |
| 102 | 1011 | 1.85×109 |
(5) Survival rate of recombinant bacillus amyloliquefaciens in spray drying.
According to the data in example 6, 50.5kg of bacterial powder can be obtained for every 1000L of fermentation liquid sample, namely 50.5mg of bacterial powder can be obtained for 1ml of fermentation liquid (weight is about 1 g). Therefore, the viable bacteria number in the bacteria powder of 1ml fermentation liquor after spray drying is 1.85 multiplied by 109×50.5＝0.934×1011Therefore, the survival rate (su) of the recombinant Bacillus amyloliquefaciens after the fermentation liquor is spray-dried can be calculatedrvival rate)＝0.934×1011/1011×100％＝93.4％
The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.
Sequence listing
<110> Hangzhou Fenghai Biotechnology Ltd
<120> recombinant bacillus amyloliquefaciens secreting extracellular algin lyase and cellulase and application thereof
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>1254
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atgaacaaat ctgttgctcc tcttcttctt gctgcttcta tcctttacgg cggcgctgtt 60
gctcaacaaa cagtttgggg ccaatgcggc ggcatcggct ggtctggccc tacaaactgc 120
gctcctggct ctgcttgctc tacacttaac ccttactacg ctcaatgcat ccctggcgct 180
acaacaatca caacatctac acgtcctcct tctggcccta caacaacaac acgtgctaca 240
tctacatctt cttctacacc tcctacatct tctggcgttc gtttcgctgg cgttaacatc 300
gctggcttcg atttcggctg cacaacagat ggcacatgcg ttacatctaa agtttaccct 360
cctcttaaaa acttcacagg ctctaacaac taccctgatg gcatcggcca aatgcaacat 420
ttcgttaacg aagatggcat gacaatcttc cgtcttcctg ttggctggca ataccttgtt 480
aacaacaacc ttggcggcaa ccttgattct acatctatct ctaaatacga tcaacttgtt 540
caaggctgcc tttctcttgg cgcttactgc atcgttgata tccataacta cgctcgttgg 600
aacggcggca tcatcggcca aggcggccct acaaacgctc aattcacatc tctttggtct 660
caacttgctt ctaaatacgc ttctcaatct cgtgtttggt tcggcatcat gaacgaacct 720
catgatgtta acatcaacac atgggctgct acagttcaag aagttgttac agctatccgt 780
aacgctggcg ctacatctca attcatctct cttcctggca acgattggca atctgctggc 840
gctttcatct ctgatggctc tgctgctgct ctttctcaag ttacaaaccc tgatggctct 900
acaacaaacc ttatcttcga tgttcataaa taccttgatt ctgataactc tggcacacat 960
gctgaatgca caacaaacaa catcgatggc gctttctctc ctcttgctac atggcttcgt 1020
caaaacaacc gtcaagctat ccttacagaa acaggcggcg gcaacgttca atcttgcatc 1080
caagatatgt gccaacaaat ccaatacctt aaccaaaact ctgatgttta ccttggctac 1140
gttggctggg gcgcgggcag cttcgattct acatacgttc ttacagaaac acctacaggc 1200
tctggcaact cttggacaga tacatctctt gtttcttctt gccttgctcg taaa 1254
<210>2
<211>1101
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
atgaaaacat ctcatcttat ccgtatcgct cttcctggcg ctcttgctgc tgctcttctc 60
gcttcgcaag taagccaagc tgctgatctt gttcctcctc ctggctacta cgctgctgtt 120
ggcgaacgta aaggctctgc tggctcttgc cctgctgttc ctcctcctta cacaggctct 180
cttgttttca catctaaata cgaaggctct gattctgctc gtgctacact taacgttaaa 240
gctgaaaaaa cattccgttc tcaaatcaaa gatatcacag atatggaacg tggcgctaca 300
aaacttgtta cacaatacat gcgttctggc cgtgatggcg atcttgcttg cgctcttaac 360
tggatgtctg cttgggctcg tgctggcgct cttcaatctg atgatttcaa ccatacaggc 420
aaatctatgc gtaaatgggc tctcgggtct ctcagcggcg cttacatgcg tcttaaattc 480
tcttcttctc gtcctcttgc tgctcatgct gaacaatctc gtgaaatcga agattggttc 540
gctcgtcttg gcacacaagt tgttcgtgat tggtctggcc ttcctcttaa aaaaatcaac 600
aaccattctt actgggctgc ttggtctgtt atgtctacag ctgttgttac aaaccgtcgt 660
gatcttttcg attgggctgt ttctgaattc aaagttgctg ctaaccaagt tgatgaacaa 720
ggcttccttc ctaacgaact taaacgtcgt caacgtgctc ttgcttacca taactacgct 780
cttcctcctc ttgctatgat cgctgctttc gctcaagtta acggcgttga tcttcgtcaa 840
gaaaaccatg gcgctcttca acgtcttgct gaacgtgtta tgaaaggcgt tgatgatgaa 900
gaaacattcg aagaaaaaac aggcgaagat caagatatga cagatcttaa agttgataac 960
aaatacgctt ggcttgaacc ttactgcgct ctttaccgtt gcgaacctaa aatgcttgaa 1020
gctaaaaaag atcgtgaacc tttcaactct ttccgtcttg gcggcgaagt tacacgtgtt 1080
ttctctcgtg aaggcggctc t 1101
<210>3
<211>418
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>3
Met Asn Lys Ser Val Ala Pro Leu Leu Leu Ala Ala Ser Ile Leu Tyr
1 5 10 15
Gly Gly Ala Val Ala Gln Gln Thr Val Trp Gly Gln Cys Gly Gly Ile
20 25 30
Gly Trp Ser Gly Pro Thr Asn Cys Ala Pro Gly Ser Ala Cys Ser Thr
35 40 45
Leu Asn Pro Tyr Tyr Ala Gln Cys Ile Pro Gly Ala Thr Thr Ile Thr
50 55 60
Thr Ser Thr Arg Pro Pro Ser Gly Pro Thr Thr Thr Thr Arg Ala Thr
65 70 75 80
Ser Thr Ser Ser Ser Thr Pro Pro Thr Ser Ser Gly Val Arg Phe Ala
85 90 95
Gly Val Asn Ile Ala Gly Phe Asp Phe Gly Cys Thr Thr Asp Gly Thr
100 105 110
Cys Val Thr Ser Lys Val Tyr Pro Pro Leu Lys Asn Phe Thr Gly Ser
115 120 125
Asn Asn Tyr Pro Asp Gly Ile Gly Gln Met Gln His Phe Val Asn Glu
130 135 140
Asp Gly Met Thr Ile Phe Arg Leu Pro Val Gly Trp Gln Tyr Leu Val
145 150 155 160
Asn Asn Asn Leu Gly Gly Asn Leu Asp Ser Thr Ser Ile Ser Lys Tyr
165 170 175
Asp Gln Leu Val Gln Gly Cys Leu Ser Leu Gly Ala Tyr Cys Ile Val
180 185 190
Asp Ile His Asn Tyr Ala Arg Trp Asn Gly Gly Ile Ile Gly Gln Gly
195 200 205
Gly Pro Thr Asn Ala Gln Phe Thr Ser Leu Trp Ser Gln Leu Ala Ser
210 215 220
Lys Tyr Ala Ser Gln Ser Arg Val Trp Phe Gly Ile Met Asn Glu Pro
225 230 235 240
His Asp Val Asn Ile Asn Thr Trp Ala Ala Thr Val Gln Glu Val Val
245 250 255
Thr Ala Ile Arg Asn Ala Gly Ala Thr Ser Gln Phe Ile Ser Leu Pro
260 265 270
Gly Asn Asp Trp Gln Ser Ala Gly Ala Phe Ile Ser Asp Gly Ser Ala
275 280 285
Ala Ala Leu Ser Gln Val Thr Asn Pro Asp Gly Ser Thr Thr Asn Leu
290 295 300
Ile Phe Asp Val His Lys Tyr Leu Asp Ser Asp Asn Ser Gly Thr His
305 310 315 320
Ala Glu Cys Thr Thr Asn Asn Ile Asp Gly Ala Phe Ser Pro Leu Ala
325 330 335
Thr Trp Leu Arg Gln Asn Asn Arg Gln Ala Ile Leu Thr Glu Thr Gly
340 345 350
Gly Gly Asn Val Gln Ser Cys Ile Gln Asp Met Cys Gln Gln Ile Gln
355 360 365
Tyr Leu Asn Gln Asn Ser Asp Val Tyr Leu Gly Tyr Val Gly Trp Gly
370 375 380
Ala Gly Ser Phe Asp Ser Thr Tyr Val Leu Thr Glu Thr Pro Thr Gly
385 390 395 400
Ser Gly Asn Ser Trp Thr Asp Thr Ser Leu Val Ser Ser Cys Leu Ala
405 410 415
Arg Lys
<210>4
<211>367
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>4
Met Lys Thr Ser His Leu Ile Arg Ile Ala Leu Pro Gly Ala Leu Ala
1 5 10 15
AlaAla Leu Leu Ala Ser Gln Val Ser Gln Ala Ala Asp Leu Val Pro
20 25 30
Pro Pro Gly Tyr Tyr Ala Ala Val Gly Glu Arg Lys Gly Ser Ala Gly
35 40 45
Ser Cys Pro Ala Val Pro Pro Pro Tyr Thr Gly Ser Leu Val Phe Thr
50 55 60
Ser Lys Tyr Glu Gly Ser Asp Ser Ala Arg Ala Thr Leu Asn Val Lys
65 70 75 80
Ala Glu Lys Thr Phe Arg Ser Gln Ile Lys Asp Ile Thr Asp Met Glu
85 90 95
Arg Gly Ala Thr Lys Leu Val Thr Gln Tyr Met Arg Ser Gly Arg Asp
100 105 110
Gly Asp Leu Ala Cys Ala Leu Asn Trp Met Ser Ala Trp Ala Arg Ala
115 120 125
Gly Ala Leu Gln Ser Asp Asp Phe Asn His Thr Gly Lys Ser Met Arg
130 135 140
Lys Trp Ala Leu Gly Ser Leu Ser Gly Ala Tyr Met Arg Leu Lys Phe
145 150 155 160
Ser Ser Ser Arg Pro Leu Ala Ala His Ala Glu Gln Ser Arg Glu Ile
165 170 175
Glu Asp Trp Phe Ala Arg Leu Gly Thr Gln Val Val Arg Asp Trp Ser
180 185 190
Gly Leu Pro Leu Lys Lys Ile Asn Asn His Ser Tyr Trp Ala Ala Trp
195 200 205
Ser Val Met Ser Thr Ala Val Val Thr Asn Arg Arg Asp Leu Phe Asp
210 215 220
Trp Ala Val Ser Glu Phe Lys Val Ala Ala Asn Gln Val Asp Glu Gln
225 230 235 240
Gly Phe Leu Pro Asn Glu Leu Lys Arg Arg Gln Arg Ala Leu Ala Tyr
245 250 255
His Asn Tyr Ala Leu Pro Pro Leu Ala Met Ile Ala Ala Phe Ala Gln
260 265 270
Val Asn Gly Val Asp Leu Arg Gln Glu Asn His Gly Ala Leu Gln Arg
275 280 285
Leu Ala Glu Arg Val Met Lys Gly Val Asp Asp Glu Glu Thr Phe Glu
290 295 300
Glu Lys Thr Gly Glu Asp Gln Asp Met Thr Asp Leu Lys Val Asp Asn
305 310 315 320
Lys Tyr Ala Trp Leu Glu Pro Tyr Cys Ala Leu Tyr Arg Cys Glu Pro
325 330 335
Lys Met Leu Glu Ala Lys Lys Asp Arg Glu Pro Phe Asn Ser Phe Arg
340 345 350
Leu Gly Gly Glu Val Thr Arg Val Phe Ser Arg Glu Gly Gly Ser
355 360 365
Claims (10)
1. A recombinant bacillus amyloliquefaciens secreting extracellular alginate lyase and cellulase is characterized in that alginate lyase genes and cellulase genes are respectively connected with bacillus amyloliquefaciens expression plasmids to construct recombinant expression plasmids, and then the recombinant expression plasmids are transferred into the bacillus amyloliquefaciens to obtain the recombinant bacillus amyloliquefaciens.
2. The recombinant bacillus amyloliquefaciens secreting extracellular alginate lyase and cellulase according to claim 1, wherein the alginate lyase encoding gene is derived from Pseudomonas aeruginosa atcc 27853; the cellulase gene is derived from Trichoderma reesei 30, and the Bacillus amyloliquefaciens strain is Bacillus amyloliquefaciens ATCC 23350.
3. The recombinant bacillus amyloliquefaciens secreting extracellular alginate lyase and cellulase according to claim 1, wherein the nucleotide sequence of the coding gene of the alginate lyase is shown as SEQ ID No.1, and the nucleotide sequence of the cellulase gene is shown as SEQ ID No. 2.
4. The method for constructing recombinant Bacillus amyloliquefaciens secreting extracellular alginate lyase and cellulase according to any one of claims 1 to 3, comprising the steps of:
step 1: connecting alginate lyase and cellulase coding genes to a polyclonal site of an expression plasmid by a seamless cloning method to construct a recombinant expression plasmid;
step 2: and (3) electrically transforming the constructed recombinant expression plasmid into the bacillus amyloliquefaciens to obtain the recombinant bacillus amyloliquefaciens secreting and expressing the alginate lyase and the cellulase.
5. The method for constructing recombinant Bacillus amyloliquefaciens secreting algin lyase and cellulase outside cells according to claim 4, wherein the expression plasmid is pht43HpaII duet enzyme.
6. The method for constructing the recombinant bacillus amyloliquefaciens secreting the alginate lyase and the cellulase outside the cells as claimed in claim 5, wherein the alginate lyase coding gene expresses the alginate lyase, and the amino acid sequence of the alginate lyase is shown as SEQ ID No. 3; the cellulase coding gene expresses cellulase, and the amino acid sequence of the cellulase is shown in SEQ ID NO. 4.
7. A fermentation production method of kelp bacterial manure is characterized in that the recombinant bacillus amyloliquefaciens seed liquid as defined in any one of claims 1-6 is directly inoculated into a kelp residue mixing system (with water content of 60%) without autoclaving according to the volume ratio of 1:100, certain content of ammonium sulfate and inorganic salt are added, and the kelp bacterial manure is stirred and fermented for 96 hours at 37 ℃ in a fermentation tank.
8. The method for producing the bacterial manure of kelp as claimed in claim 7, wherein the seed culture medium is LB culture medium, comprising the following components by mass:
10g/L of tryptone, 5g/L of yeast powder and 10g/L of sodium chloride.
9. The method for producing the bacterial manure of kelp by fermentation according to claim 7, wherein the fermentation system comprises the following components by mass concentration:
40g/L of dry kelp residue powder, 10g/L of ammonium sulfate and K2HPO4·3H2O 10g/L，KH2PO42g/L and MgSO4·7H2O1.2g/L。
10. The use of the recombinant bacillus amyloliquefaciens secreting extracellular alginate lyase and cellulase according to any one of claims 1 to 6 in the preparation of a kelp bacterial manure product containing alginate oligosaccharides or brown algae extracts by fermenting kelp residues.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010139302.2A CN111206010B (en) | 2020-03-03 | 2020-03-03 | Recombinant bacillus amyloliquefaciens secreting extracellular alginate lyase and cellulase and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010139302.2A CN111206010B (en) | 2020-03-03 | 2020-03-03 | Recombinant bacillus amyloliquefaciens secreting extracellular alginate lyase and cellulase and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111206010A true CN111206010A (en) | 2020-05-29 |
| CN111206010B CN111206010B (en) | 2022-11-04 |
Family
ID=70783251
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010139302.2A Active CN111206010B (en) | 2020-03-03 | 2020-03-03 | Recombinant bacillus amyloliquefaciens secreting extracellular alginate lyase and cellulase and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111206010B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110189743A1 (en) * | 2009-10-06 | 2011-08-04 | Bio Architecture Lab, Inc. | Microbial systems for producing commodity chemicals |
| CN106399156A (en) * | 2016-08-25 | 2017-02-15 | 中国热带农业科学院热带生物技术研究所 | Bacillus amyloliquefaciens subsp.plantarum and application thereof to scagassum biodegradation |
| CN107574196A (en) * | 2017-08-02 | 2018-01-12 | 济南悟通生物科技有限公司 | Application of the algin catenase in series of oligosaccharides product is prepared |
| CN110656054A (en) * | 2019-11-08 | 2020-01-07 | 杭州师范大学 | Recombinant trichoderma reesei for extracellularly secreting alginate lyase and application thereof |
-
2020
- 2020-03-03 CN CN202010139302.2A patent/CN111206010B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110189743A1 (en) * | 2009-10-06 | 2011-08-04 | Bio Architecture Lab, Inc. | Microbial systems for producing commodity chemicals |
| CN106399156A (en) * | 2016-08-25 | 2017-02-15 | 中国热带农业科学院热带生物技术研究所 | Bacillus amyloliquefaciens subsp.plantarum and application thereof to scagassum biodegradation |
| CN107574196A (en) * | 2017-08-02 | 2018-01-12 | 济南悟通生物科技有限公司 | Application of the algin catenase in series of oligosaccharides product is prepared |
| CN110656054A (en) * | 2019-11-08 | 2020-01-07 | 杭州师范大学 | Recombinant trichoderma reesei for extracellularly secreting alginate lyase and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| 严婉荣等: "芽孢杆菌高产活性物质与诱变育种", 《分子植物育种》 * |
| 刘玉佩等: "解淀粉芽孢杆菌产褐藻胶裂解酶的发酵条件优化", 《湖南农业科学》 * |
| 戴圻霏等: "解淀粉芽孢杆菌产纤维素酶及其酶解能力相关研究进展", 《安徽农业科学》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111206010B (en) | 2022-11-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110484471B (en) | Acid-resistant strain for high yield of bacterial cellulose and method for producing bacterial cellulose by using acid-resistant strain | |
| CN111484954B (en) | Pseudomonas nigricans for producing alginate lyase | |
| CN114480205B (en) | Bacillus amyloliquefaciens and application thereof in brewing of solid-state fermentation vinegar | |
| CN113930368B (en) | Bacillus vallismortis and application thereof in vinegar brewing | |
| CN109295031B (en) | Antifungal protein β -1, 3-glucanase, engineering bacteria containing antifungal protein β -1, 3-glucanase and application of antifungal protein β -1, 3-glucanase | |
| CN111206010B (en) | Recombinant bacillus amyloliquefaciens secreting extracellular alginate lyase and cellulase and application thereof | |
| CN109810961B (en) | A- amylase mutant and its encoding gene and their application for high concentration starch liquefacation | |
| CN111172089A (en) | Method for synthesizing trehalose by using recombinant trehalose synthase | |
| CN114561303B (en) | Trichoderma reesei engineering strain secreting high-performance cellulase and application thereof | |
| CN113652363B (en) | Strain HSU-12 for producing heat-resistant and acid-resistant cellulase and application thereof | |
| CN114292763B (en) | Saccharomyces cerevisiae for high yield of gamma-aminobutyric acid and soluble beta-glucan and application thereof | |
| CN115975857A (en) | Broad-spectrum culture medium suitable for degrading waste feathers and application thereof | |
| CN114075520B (en) | Bacillus belicus for producing gamma-polyglutamic acid and method for producing gamma-polyglutamic acid by solid fermentation of bacillus belicus | |
| CN112458022B (en) | Bacillus licheniformis Bl22 for high yield of chitin deacetylase and related products and application thereof | |
| CN111349569B (en) | Trichoderma reesei and application thereof in xylanase production | |
| CN104818220B (en) | One plant is screened the Rhizopus oryzae bacterial strain JHSW01 obtained from rotten stalk | |
| CN110106095A (en) | The aspergillus niger and its construction method and application that one plant of calcium channel CchA gene inactivates | |
| CN110656054A (en) | Recombinant trichoderma reesei for extracellularly secreting alginate lyase and application thereof | |
| CN114686503B (en) | Coli mutant strain for stabilizing high-yield alginic acid lyase | |
| LU502063B1 (en) | USE OF CitT PROTEIN OR CitT PROTEIN-ENCODING GENE IN REGULATING EFFICIENCY OF RAMIE DEGUMMING BY MICROORGANISMS | |
| CN114806926B (en) | Kitchen waste decomposing degradation microbial inoculum and application thereof | |
| CN113980939B (en) | Glucose-resistant beta-glucosidase, and expression gene and application thereof | |
| CN114686412B (en) | Bacillus subtilis mutant strain and application thereof in production of alginic acid lyase | |
| CN111172085B (en) | Application of bacillus subtilis in production of substances inhibiting fungi | |
| CN113913450B (en) | Method for expressing chitosanase by rhodopseudomonas palustris, chitosanase, recombinant plasmid, recombinant bacteria, fermentation bacteria and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |