LU502063B1

LU502063B1 - USE OF CitT PROTEIN OR CitT PROTEIN-ENCODING GENE IN REGULATING EFFICIENCY OF RAMIE DEGUMMING BY MICROORGANISMS

Info

Publication number: LU502063B1
Application number: LU502063A
Authority: LU
Inventors: Qi Yang; Zhiyuan Liu; Ke Zheng; Lifeng Cheng; Yuande Peng; Xiangyuan Feng; Shengwen Duan
Original assignee: Inst Bast Fiber Crops Caas
Priority date: 2021-10-20
Filing date: 2022-05-11
Publication date: 2022-11-17
Also published as: CN113956336A; CN113956336B

Abstract

The present disclosure relates to the technical field of genetic engineering, particularly to use of a CitT protein or a CitT protein-encoding gene in regulating an efficiency of ramie degumming by microorganisms. In the present disclosure, a B. subtilis strain that does not produce cellulase is used as an original strain, and a citT gene in the strain is knocked out to obtain a mutant engineering bacterium. Compared with the original strain, the citT gene-knockout strain has a lower weight loss rate of ramie bast and a higher residual gum rate of ramie fibers during ramie degumming, indicating that the citT gene is positively correlated with the degumming efficiency of the ramie by the B. subtilis. This is of great significance in improving the degumming efficiency of the ramie by the microorganisms.

Description

BL-5496 USE OF CitT PROTEIN OR CitT PROTEIN-ENCODING GENE IN REGULATING LU502063

EFFICIENCY OF RAMIE DEGUMMING BY MICROORGANISMS TECHNICAL FIELD

[0001] The present disclosure relates to the technical field of genetic engineering, particularly to use of a CitT protein or a CitT protein-encoding gene in regulating an efficiency of ramie degumming by microorganisms.

BACKGROUND ART

[0002] Ramie (Boehmeria nivea) is one of the common economic crops. Ramie fibers have long filament, high strength, low density and antibacterial activity. The ramie fibers are an important source of natural fibers, and are widely used in textile, rail transit, aerospace and medical fields. In addition to fibers, ramie bast also contains 25% to 35% of bonded non-cellulose substances (commonly known as "colloid"), including pectin and hemicellulose (such as xylan and mannan). Stripping of the bonded non-cellulosic substances (degumming) is the only way to obtain the ramie fibers. At present, chemical degumming is mostly used in the industry, with a high cost, huge energy consumption, serious environmental pollution, low fibers production rate, and poor quality. Bio-degumming can save a lot of chemical raw materials and energy, greatly reduce the environmental pollution caused by degumming wastewater, and can obtain fibers with a better quality. There are two bio-degumming methods: enzymatic degumming and microbial degumming. The enzymatic degumming is to conduct heterologous expression of functional enzymes (such as pectinase and xylanase) for the degumming of ramie bast. However, this method is difficult to be applied to large-scale industrial production due to an unstable enzyme preparation activity, high cost, and immature enzyme immobilization and recovery technology. The microbial degumming is to biotransform the colloid using metabolism of degumming microorganisms (mostly bacteria). This technology, due to a desirable quality, high efficiency, energy saving and cleanliness, is an important development direction of researches on the degumming of ramie bast.

[0003] Currently, most of microbial resources used for the degumming of ramie bast come from wild strains screened in the natural environment. However, the wild strains have a poor degumming effect and a high residual gum rate in obtained fibers, which is difficult to achieve industrial production. It is a key to use of the microbial degumming in large-scale industrial production by directional transformation of wild degumming bacteria to obtain high-efficiency engineering bacteria. However, a metabolic regulation mechanism of microorganisms during the degumming is still unclear, and there is a lack of theoretical guidance for the directional 1

BL-5496 transformation of wild degumming bacteria. Therefore, there is a serious shortage of efficient, | 595063 genetically-engineered bacteria that can be used for degumming in large-scale industrial production.

SUMMARY

[0004] To solve the problems in the prior art, the present disclosure provides use of a CitT protein or a CitT protein-encoding gene in regulating an efficiency of ramie degumming by microorganisms.

[0005] The present disclosure provides use of a CitT protein or a CitT protein-encoding gene or a regulatory factor of the CitT protein-encoding gene in regulating an efficiency of ramie degumming by microorganisms.

[0006] Further, the CitT protein may include an amino acid sequence shown in SEQ ID NO: 1.

[0007] Further, the CitT protein-encoding gene may include a nucleotide sequence shown in SEQ ID NO: 2.

[0008] Further, the regulatory factor of the CitT protein-encoding gene may include a biological material capable of inhibiting expression of the CitT protein of B. subtilis by editing a citT gene;

[0009] preferably, the biological material may be a nucleic acid, or an expression vector including the nucleic acid, or an engineering bacterium including the nucleic acid; and the nucleic acid may include a homologous arm sequence for knocking out the cit7' gene; and

[0010] more preferably, the homologous arm sequence for knocking out the cit7 gene may include a nucleotide sequence shown in SEQ ID NO: 3.

[0011] Further, the degumming efficiency of the microorganisms may be improved by improvement the expression of the CitT protein.

[0012] Further, the microorganisms may be one or more selected from the group consisting of B.

subtilis, Aspergillus flavus, Bacillus brevis, and Pectobacterium.

[0013] The present disclosure further provides a method for improving an efficiency of ramie degumming by microorganisms, including overexpressing a CitT protein-encoding gene of the microorganisms; where

[0014] the CitT protein-encoding gene includes a nucleotide sequence shown in SEQ ID NO: 2.

[0015] Further, the method may include: knocking out the CitT protein-encoding gene in the microorganisms by a clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) system.

[0016] Further, a homologous arm used in the CRISPR/Cas9 system may include a nucleotide sequence shown in SEQ ID NO: 3.

[0017] Further, the microorganisms may be one or more selected from the group consisting of B. 2

BL-5496 subtilis, Aspergillus flavus, Bacillus brevis, and Pectobacterium. LU502063

[0018] The present disclosure has the following beneficial effects:

[0019] The B. subtilis that does not produce cellulase is used as an original strain, and the cit7 gene in the strain is knocked out to obtain a cit7' gene-knockout strain, and the ci#7 gene-knockout strain and the original strain are used for the bio-degumming of ramie. The results show that the citT gene has a significant effect on the degumming efficiency of B. subtilis, after knockout of the citT gene, the strain has a significantly-decreased degumming efficiency. This lays a theoretical foundation for use of genetic engineering to transform the B. subtilis or other degumming strains.

BRIEF DESCRIPTION OF THE DRAWINGS

[0020] FIG. 1 shows types of ramie degumming bacteria and classification of corresponding Bacillus provided by the present disclosure; where a is the types of ramie degumming bacteria, and b is the classification of Bacillus;

[0021] FIG. 2 shows an amino acid sequence conservation analysis of a CitT protein in degumming microorganisms provided by the present disclosure;

[0022] FIG. 3 shows a predicted interaction between the CitT protein and other proteins in B. subtilis provided by the present disclosure;

[0023] FIG. 4 shows PCR verification results of a cit7 gene-knockout strain provided by the present disclosure; where Lanes 1, 4, and 6: DNA marker; Lanes 2 and 3: amplification of upstream and downstream homologous arms of the cit7' gene; Lane 5: a homologous arm fusion fragment for Cit7 knockout; and Lanes 7 and 8: detection results of the cif7 gene, which are an original strain and the cifT gene-knockout strain;

[0024] FIG. 5 shows growth curves of the original strain and the cit7' gene-knockout strain in a bio-degumming system of the ramie provided by the present disclosure;

[0025] FIG. 6 shows detection results of an enzyme activity of the original strain and the cit7 gene-knockout strain provided by the present disclosure; and

[0026] FIG. 7 shows comparison results of a weight loss rate and a residual gum rate of the original strain and the mutant strain provided by the present disclosure.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0027] The following examples are intended to illustrate the present disclosure, rather than to limit the scope of the present disclosure. The following examples are only intended to illustrate the present disclosure, rather than limiting the scope of the present disclosure. Experimental methods in the following examples are conventional methods, unless otherwise specified.

[0028] Example 1 Construction of CitT mutant strain 3

BL-5496

[0029] An original strain involved in the present disclosure was a non-cellulose-producing B.| 1502063 subtilis in the patent ZL201711423951.X.

[0030] A citT gene of the B. subtilis was knocked out to construct a mutant strain of the B. subtilis with deletion of the cif7T gene. A knockout method included the following steps:

[0031] (1) Conservation analysis and functional prediction of a regulatory gene cit7'in different degumming bacteria

[0032] According to statistics, there have been more than 200 strains of ramie degumming bacteria screened from nature, where Bacillus accounts for not less than 70% and most of which are B. subtilis. This shows that B. subtilis has important values for use in microbial degumming. A two-component system is one of the most important signaling systems in bacteria, and then an important way for bacteria to respond to changes in the living environment, and also participate in the regulation of various metabolic processes. In the present disclosure, the conservation of CitT protein was analyzed according to the species classification of degumming bacteria. The CitT protein was found to be widespread in Bacillus, and the sequence conservation indicated that the CitT protein might have a crucial regulatory function (FIG. 2). Furthermore, the interaction of CitT protein with other proteins in B. subtilis was predicted using a STRING 11.0 bioinformatics analysis system (FIG. 3).

[0033] (2) Obtaining nucleotide sequence information of the regulatory gene cit7

[0034] A gene sequence of the regulatory gene citT was shown in SEQ ID NO: 2, which was registered on the official website of NCBI.

[0035] (3) Design of homologous arm-related primers

[0036] The homologous arm information designed for this gene was shown in SEQ ID NO: 3, and the cit] gene was knocked out by CRISP/Cas9 technology based on this.

[0037] The primer sequences involved in gene knockout were as follows (from 5'-3"):

[0038] CitT-up-R: AGATTTTTTCATATATGGATTCCCCCTTTGTTTCT (SEQ ID NO: 4),

[0039] CitT-down-F: AGGGGGAATCCATATATGAAAAAATCTATAATCC (SEQ ID NO: 5),

[0040] CitT-up-sallF: ACGCGTCGACCAGGTGCAGGCCATTTTGTTAG (SEQ ID NO: 6),

[0041] CitT-downxbal-R: GCTCTAGACTCATTCAGCACATCCTTGCCA (SEQ ID NO: 7),

[0042] CitT-ter-new-F: TTGATTCACATCGCGATTGC (SEQ ID NO: 8),

[0043] CitT-ter-new-R, CTAATCCGCCGCCAAATA (SEQ ID NO: 9),

[0044] SgRNA: CCGTAACAGCTGACAAGTTC (SEQ ID NO: 10).

[0045] (4) Construction of a repaired homologous arm and knockout of cit7' gene

[0046] An extracted genomic DNA of the non-cellulase-producing B. subtilis was used as a template, and PCR amplification was conducted with primers 4

BL-5496 CitT-up-sallF/CitT-UP-R>CitT-down-F/CitT-downxbal-R according to the following 4502063 procedures, to obtain fragments CLSA up and CLSA down:

[0047] Table 1 PCR reaction system

[0048] ~~ 2xpfUPCRmix ~~ 25pt Primer PI (10gM) 2 el PrimerP2 (10gM) 2 pl Genomic DNA 2 el ddH,0 19 pl Total 50(11

[0049] Amplification conditions were: at 94°C for 5 min; 30 Cycles (including at 94°C for 30 sec, at 55°C for 30 sec, and at 72°C for 20 sec); and hold on at 10°C. The repaired homologous arm was constructed using overlapping PCR, the amplified fragments CLSA up and CLSA down were recovered by a PCR product purification kit, and fusion PCR amplification was conducted according to the following system:

[0050] Table 2 Fusion PCR amplification system

[0051] 2xSuperpfu PCR mix 25 gl citt-UPsall-F (IOjiM) 2 pl Citt-downxbal-R (10pM) 2 gl CLSA up recovery fragment 4 pl CLSA down recovery fragment 4 el ddH:0 13 Total 50 pl

[0052]

[0053] Amplification conditions were: at 94°C for 5 min; 2 Cycles (including at 94°C for 30 sec, at 50°C for 30 sec, and at 68°C for 30 sec), 30 cycles (including at 94°C for 30 sec, at 50°C for 30 sec, and at 68°C for 30 sec); and hold on at 10°C.

[0054] The fused fragments CLSA up and CLSA down were ligated to a pUX-T vector, transformed into E.coli DHS50 competent cells, colony PCR was conducted, and positive clones were selected for sequencing. The electrotransformation competence of non-cellulase-producing B. subtilis was prepared, a knockout plasmid was introduced by electrotransformation, the positive clones were selected, and identification of the cit7' gene-knockout strain was conducted with identification primers CitT-ter-new-F and CitT-ter-new-R.

BL-5496

[0055] PCR identification of the cir7' gene-knockout strain is shown in FIG. 4, indicating that the, | 595063 citT gene-knockout mutant strain has been obtained.

[0056] Example 2 Use of citT gene-knockout strain and original strain in bio-degumming of ramie

[0057] (1) Culture of bacterial solution

[0058] The single colonies of the cit7 gene-knockout strain and the original strain were inoculated into a 150 mL Erlenmeyer flask containing 20 mL of an LB liquid medium, and incubated on a shaker overnight at 37°C and 180 rpm; an obtained incubation product was transferred to a 500 mL Erlenmeyer flask containing 100 mL of the LB liquid medium, and incubated for 7 h at 37°C and 180 rpm, to obtain a bacterial solution À of the mutant strain and a bacterial solution B of the original strain.

[0059] (2) Shake flask test for bio-degumming of ramie

[0060] A 500 mL Erlenmeyer flask was filled with 10 g of ramie bast and 100 mL of water, flask mouths were sealed with a sealing film, while three parallel tests were set up; after repeated sterilization at 121°C for 20 min, 10 mL for each of the bacterial solution A and the bacterial solution B were added into each Erlenmeyer flask, and mixed evenly. Incubation was conducted on a shaker for about 25 h at 35°C and 180 rpm, and degumming was terminated to obtain degummed ramie bast.

[0061] (3) Effect of cit7 gene knockout on growth characteristics of B. subtilis

[0062] The growth curves of the mutant strain and the original strain in the ramie degumming system were detected by spectrophotometry. That is, under a wavelength of ODeoo nm, an absorbance value of bacterial solution in degumming system was measured every 1 h; according to measured data, the growth curves were fitted to explore an effect of cit7 gene knockout on the growth characteristics of B. subtilis. The results show that a cell density of the original strain is higher than that of the mutant strain in the ramie degumming system (FIG. 5).

[0063] (4) Effect of citT gene knockout on enzyme activity in ramie degumming system

[0064] Due to active growth of bacteria, the logarithmic phase is the stage that cells use nutrients in the environment for rapid growth and reproduction. Therefore, enzyme activities of pectinase, mannanase and xylanase in a degumming solution in the logarithmic growth phase are determined according to growth characteristics of the mutant strain and the original strain during the ramie degumming. The activities of pectinase and xylanase were determined by a DNS method, and the activity of mannanase was determined by enzyme-linked immunosorbent assay (ELISA, Microorganism B-mannanase ELISA Kit), to explore the effect of cit7 gene knockout on enzyme activity in ramie degumming system. The results show that after knocking out the citT gene, the degumming functional enzymes pectinase and xylanase in the mutant strain have a lower activity 6

BL-5496 than that in the original strain (FIG. 6); this result is consistent with the functional prediction of, | 595063 CitT protein.

[0065] (5) Determination of weight loss rate of ramie bast and residual gum rate of ramie fibers

[0066] A calculation method of the weight loss rate was:

[0067] A dry weight of the ramie bast before treatment was set to M1; after rinsing with water, the degummed ramie bast was dried at 60°C to a constant weight; a dry weight of the ramie bast after degumming was set to M2. A formula for calculating the weight loss rate was:

[0068] Weight loss rate = (M1 - M2)/M1 x 100%

[0069] A weight of the degummed ramie fibers dried to constant weight was set as W1, and the dried ramie fibers were placed in a Erlenmeyer flask containing 200 mL of a 20 g/L NaOH solution, and scoured at 100°C for 2 h. After the scouring, the ramie fibers were washed with water, dried at 60°C to constant weight, weighed, and a weight was set to W2. A formula for calculating the residual gum rate was:

[0070] Residual gum rate = (W1 - W2)/W1 x 100%

[0071] The results show that the mutant strain with knockout of cit7' gene, after bio-degumming, has a weight loss rate of ramie bast significantly lower than that of the original strain, and a residual gum rate of ramie fibers significantly higher than that of the original strain (FIG. 7).

[0072] The above results show that cifT gene is a positive regulator gene used by B. subtilis for the degumming of ramie.

[0073] While the present disclosure has been described in detail above with reference to general description and a specific embodiment, it will be apparent to those skilled in the art that some modifications or improvements can be made to the present disclosure. Therefore, all these modifications or improvements made without departing from the spirit of the present disclosure fall within the protection scope of the present disclosure.

7

SEQUENCE LISTING 0502063 <110> Hunan Agricultural University <120> USE OF CitT PROTEIN OR CitT PROTEIN-ENCODING GENE IN REGULATING

EFFICIENCY OF RAMIE DEGUMMING BY MICROORGANISMS <130> HKJU20220302260 <160> 10 <170> Patentln version 3.5 <210> 1 <211> 226 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of CitT protein <400> 1 Met lle His Ile Ala Ile Ala Glu Asp Asp Phe Arg Val Ala Gln Ile 1 5 10 15 His Glu Arg Leu lle Lys GIn Leu Asp Gly Phe Lys lle Ile Gly Lys Ala Ala Asn Ala Lys Glu Thr Leu Ala Leu Leu Lys Glu His Lys Ala 40 45 Asp Leu Leu Leu Leu Asp lle Tyr Met Pro Asp Glu Leu Gly Thr Ala 50 55 60 Leu lle Pro Asp lle Arg Ser Arg Phe Pro Glu Val Asp lle Met lle 65 70 75 80 lle Thr Ala Ala Thr Glu Thr Arg His Leu GIn Glu Ala Leu Arg Ala

Gly lle Ala His Tyr Leu lle Lys Pro Val Thr Ala Asp Lys Phe Arg 100 105 110 Gln Val Leu Leu GIn Tyr Lys Glu Lys Arg Lys Leu Leu Met Ser Gin 115 120 125 Pro Glu Val Ser GIn Ser Met lle Asp His lle Phe Gly Asn Gly Val 130 135 140 Lys Thr Ala Leu Pro Ala Glu Asp Leu Pro Thr Gly Ile Asn Ser lle 145 150 155 160 Thr Leu Arg Lys lle Lys Glu Ala Leu GIn Thr Ala Ser Glu Gly Leu 165 170 175 Thr Ala Glu Glu Leu Gly Glu Lys Met Gly Ala Ser Arg Thr Thr Ala 180 185 190 Arg Arg Tyr Ala Glu Tyr Leu Val Ser Lys Glu Glu Ala Arg Ala Glu 195 200 205 Leu Glu Tyr Gly lle Ile Gly Arg Pro Glu Arg Lys Tyr Tyr Leu Ala 210 215 220 Ala Asp 225 <210> 2 <211> 681 <212> DNA <213> Artificial Sequence

<220> LU502063 <223> nucleotide sequence of the gene for encoding CitT protein

<400> 2 ttgattcaca tcgcgattgc ggaggatgat tttcgagttg cgcaaatcca tgagagattg 60 attaaacagc ttgatggatt caagattatc ggcaaggcgg ctaacgcaaa agagacattg 120 gcgcttttga aggaacacaa ggctgatttg cttctgctgg atatttatat gccggacgag 180 cttgggaccg cgttgattcc tgatatacga agccgatttc ctgaagtgga cattatgatt 240 atcacagcgg caacagaaac ccgtcatttg caggaagcgc taagggcggg aattgcccac 300 tatttgatca aacccgtaac agctgacaag ttcaggcagg tgctgcttca gtataaagaa 360 aaaaggaagc tgctcatgtc tcagccggag gtcagccaat ccatgatcga ccatattttt 420 gggaacggtg tgaagacagc tttgccggca gaggatttgc cgactggcat taattcgatt 480 acactgcgaa aaattaagga agcgcttcag actgcgtcag aaggattgac agcggaggaa 540 cttggggaaa aaatgggggc gtcacgaaca actgcccgcc gttatgccga gtaccttgtg 600 tcaaaggaag aagcaagagc cgagcttgaa tacgggatta tcggcaggcc ggagagaaaa 660 tattatttgg cggcggatta g 681

<210> 3

<211> 2317

<212> DNA

<213> Artificial Sequence

<220>

<223> homologous arm sequence for knocking out the citT gene

<400> 3 ttcgcgattc gagaagggat tattgccacc aatcgtgaag gcgtcgtcac catgatgaac 60 gtatcggcgg ccgagatgct gaagctgecc gagectgtga tccatcttec tatagatgac 120 gtcatgccgg gagcagggct gatgtctgtg cttgaaaaag gagaaatgct gccgaaccag 180 gaagtaagcg tcaacgatca agtgtttatt atcaatacga aagtgatgaa tcaaggcggg 240 1502063 caggcgtatg ggattgtcgt cagcttcagg gagaaaacag agctgaagaa gctgatcgac 300 acattgacag aggttcgcaa atattcagag gatctcaggg cgcagactca tgaattttca 360 aataagcttt atgcgatttt agggctgctt gagcttgggg agtatgatga agccattgat 420 ctgattaaag aggaatatgc gatacaaaat gaacagcatg atcttttatt ccataacatc 480 cattcgcagc aggtgcaggc cattttgtta gggaaaataa gcaaggcatc ggaaaagaag 540 gtcaagctgg tgattgatga gaacagctca ctcgcgcectc ttectgegea tatcgacttg 600 tcccatctta ttacgattat tggcaattta attgataacg ctttcgaagc tgtagcggag 660 caaagcgtga aggaagtttt gttttttatc acggatatgg gccatgacat tgtcattgaa 720 gtatcagaca cagggcccgg tgtgccgcca gagaaaatag aagctgtgtt tgagagagge 780 tattcttcaa aggggatgag gagaggctac ggtctggcca atgtgaaaga ctcagtgcgt 840 gaactgggcg gctggatcga actggcgaat caaaaaactg gcggggceggt attcactgta 900 tttataccga aggagaaaca aagggggaat ccatttgatt cacatcgcga ttgcggagga 960 tgattttcga gttgcgcaaa tccatgagag attgattaaa cagcttgatg gattcaagat 1020 tatcggcaag gcggctaacg caaaagagac attggcgctt ttgaaggaac acaaggctga 1080 tttgcttctg ctggatattt atatgccgga cgagcttggg accgcgttga ttcctgatat 1140 acgaagccga tttcctgaag tggacattat gattatcaca gcggcaacag aaacccgtca 1200 tttgcaggaa gcgctaaggg cgggaattgc ccactatttg atcaaacccg taacagctga 1260 caagttcagg caggtgctgc ttcagtataa agaaaaaagg aagctgctca tgtctcagcc 1320 ggaggtcagc caatccatga tcgaccatat ttttgggaac ggtgtgaaga cagctttgcc 1380 ggcagaggat ttgccgactg gcattaattc gattacactg cgaaaaatta aggaagcgct 1440 tcagactgcg tcagaaggat tgacagcgga ggaacttggg gaaaaaatgg gggcgtcacg 1500 aacaactgcc cgccgttatg ccgagtacct tgtgtcaaag gaagaagcaa gagccgagct 1560 1502063 tgaatacggg attatcggca ggccggagag aaaatattat ttggcggcgg attagatatg 1620 aaaaaatcta taatcctatt gaatattcta ttgatcttta tgcagggtga tatcaggcag 1680 gcggctgcgce cgegcectgec ggacgggcecg atagaaattg tcgtcectge cgaaccttet 1740 ggcggctggg atgtcacagc gcaggcgatc caatcagttt tgaggcagaa gcagatcgtg 1800 aaggatgatg ttcatatcgt ctataaatcc ggcggcgggg gagagaaagg ctggaaatat 1860 gtcaacaaaa gcagcaaaca aaccatcagc atgacgtcca gcctaatatt gagcaatgat 1920 cttctcgggc aaagcaaatt aaaaatgtcc gattttacgc cgctcgcecat tctctccaag 1980 gaatggcaga cggttgcatt gccaaaagga tcagcgttaa caaatggcaa ggatgtgctg 2040 aatgagatca acatgcatcc cggcaaggtg agaatcggct ttgccccggg gtttggcaat 2100 gatgatcagc tctcgttcgt cagagcggca gatatgtacg gcattgaccc gtttgacatt 2160 caattctcac agtatgacag cagcgaacag ctcattcagg cgctgatcag acatgagata 2220 gaagcggctt ccatgacact ttctgaagcg aaaccatatg aacgaaacgg cgatatcacg 2280 ttagccoctg taacgtctga taaaagactt cccggtt 2317

<210> 4

<211> 35

<212> DNA

<213> Artificial Sequence

<220>

<223> sequence of primer CitT-up-R

<400> 4 agattttttc atatatggat tccccctttg tttct 35

<210> 5

<211> 34

<212> DNA

<213> Artificial Sequence US02063 <220>

<223> sequence of primer CitT-down-F

<400> 5 agggggaatc catatatgaa aaaatctata atcc 34 <210> 6

<211> 32

<212> DNA

<213> Artificial Sequence

<220>

<223> sequence of primer CitT-up-sallF

<400> 6 acgcgtcgac caggtgcagg ccattttgtt ag 32 <210> 7

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> sequence of primer CitT-downxbal-R

<400> 7 gctctagact cattcagcac atccttgcca 30 <210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> sequence of primer CitT-ter-new-F

<400> 8 ttgattcaca tcgcgattgc 20

<210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> sequence of primer CitT-ter-new-R <400> 9 ctaatccgcc gccaaata 18 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sequence of primer SQRNA <400> 10 ccgtaacagc tgacaagttc 20

Claims

BL-5496 CLAIMS LU502063

1. Use of a CitT protein or a CitT protein-encoding gene or a regulatory factor of the CitT protein-encoding gene in regulating an efficiency of degumming ramie by microorganisms.

2. The use according to claim 1, wherein the CitT protein comprises an amino acid sequence shown in SEQ ID NO: 1.

3. The use according to claim 1 or 2, wherein the CitT protein-encoding gene comprises a nucleotide sequence shown in SEQ ID NO: 2.

4. The use according to any one of claims 1 to 3, wherein the regulatory factor of the CitT protein-encoding gene comprises a biological material capable of inhibiting expression of the CitT protein of the B. subtilis by editing a cit” gene, preferably, the biological material is a nucleic acid, or an expression vector comprising the nucleic acid, or an engineering bacterium comprising the nucleic acid; and the nucleic acid comprises a homologous arm sequence for knocking out the cit7' gene; and more preferably, the homologous arm sequence for knocking out the cifT gene comprises a nucleotide sequence shown in SEQ ID NO: 3.

5. The use according to any one of claims 1 to 4, wherein the degumming efficiency of the microorganisms is improved by enhancing the expression of the CitT protein.

6. The use according to claim 5, wherein the microorganisms are one or more selected from the group consisting of B. subtilis, Aspergillus flavus, Bacillus brevis, and Pectobacterium.

7. A method for improving an efficiency of ramie degumming by microorganisms, comprising overexpressing a CitT protein-encoding gene of the microorganisms; wherein the CitT protein-encoding gene comprises a nucleotide sequence shown in SEQ ID NO: 2.

8. The method according to claim 7, comprising: knocking out the CitT protein-encoding gene in the microorganisms by a clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) system.

9. The method according to claim 8, wherein a homologous arm used in the CRISPR/Cas9 8

BL-5496 system comprises a nucleotide sequence shown in SEQ ID NO: 3. LU502063

10. The method according to any one of claims 7 to 9, wherein the microorganisms are one or more selected from the group consisting of B. subtilis, Aspergillus flavus, Bacillus brevis, and Pectobacterium. 9