CN105861466B - The high activity mannase obtained by genetic engineering transformation and its mutational site - Google Patents
The high activity mannase obtained by genetic engineering transformation and its mutational site Download PDFInfo
- Publication number
- CN105861466B CN105861466B CN201610323104.5A CN201610323104A CN105861466B CN 105861466 B CN105861466 B CN 105861466B CN 201610323104 A CN201610323104 A CN 201610323104A CN 105861466 B CN105861466 B CN 105861466B
- Authority
- CN
- China
- Prior art keywords
- mannase
- enzyme
- seq
- amino acids
- acid sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2477—Hemicellulases not provided in a preceding group
- C12N9/2488—Mannanases
- C12N9/2494—Mannan endo-1,4-beta-mannosidase (3.2.1.78), i.e. endo-beta-mannanase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01078—Mannan endo-1,4-beta-mannosidase (3.2.1.78), i.e. endo-beta-mannanase
-
- D—TEXTILES; PAPER
- D21—PAPER-MAKING; PRODUCTION OF CELLULOSE
- D21C—PRODUCTION OF CELLULOSE BY REMOVING NON-CELLULOSE SUBSTANCES FROM CELLULOSE-CONTAINING MATERIALS; REGENERATION OF PULPING LIQUORS; APPARATUS THEREFOR
- D21C9/00—After-treatment of cellulose pulp, e.g. of wood pulp, or cotton linters ; Treatment of dilute or dewatered pulp or process improvement taking place after obtaining the raw cellulosic material and not provided for elsewhere
- D21C9/10—Bleaching ; Apparatus therefor
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses the high activity mannase obtained by genetic engineering transformation and its mutational sites, the mannosan enzyme amino acid sequence is the amino acid sequence replaced an at least amino acids in the 221st, 301 and 122 of the amino acid sequence as shown in SEQ ID NO.1 after modification, wherein the 221st amino acids are modified to isoleucine by leucine substitution, 301st amino acids are modified to glutamic acid by lysine substitution, and the 122nd amino acids are modified to arginine by glutamine substitution.The present invention increases substantially the enzyme activity of mannase after being transformed by genetic engineering.
Description
Technical field
The invention belongs to microbial technique engineering field, it is related to that the high activity mannosan obtained is transformed by genetic engineering
Enzyme and its mutational site.
Technical background
Plant is the main renewable organic resource of nature, is mainly made of cellulose, hemicellulose and lignin.And
Hemicellulose accounts for the 25%-35% of plant dry weight, and content is only second to cellulose in nature.Compared with cellulose, hemicellulose
Plain structure and composition are more complicated, including the various ingredients such as xylan, mannosan, glucan and araban.
Beta-mannase is the linear polysaccharide connected with Isosorbide-5-Nitrae-β-D- mannopyranoside bonds, if the certain residue quilts of main chain
Glucose replaces or galactolipin passes through 1,6- α glycosidic bond and mannose residue is connected to form branch, then becomes different mannose, main
There are glucomannans (glucomannan), galactomannans (galactomannan) and galactoglucomannan
(galactoglucomannan).Above-mentioned substance constitutes the second largest component of plant hemicellulose.
Mannase (EC 3.2.1.78) is the abbreviation of inscribe β-Isosorbide-5-Nitrae-mannosan glycoside hydrolase, belongs to half fiber
Tie up plain enzyme, can β-Isosorbide-5-Nitrae-D-MANNOSE glycosidic bond in random hydrolysis mannosan molecular backbone, in plant, animal and microorganism
In be found, be now widely used in food, medicine, feed, weaving, paper pulp bleaching and the fields such as energy development.
Although the crystal structure of current some 'beta '-mannases has been parsed, since 'beta '-mannase exists
It is many kinds of, the features such as source is complicated, and substrate is various, and the mechanism Journal of Sex Research of beta-mannase enzymatic structure and function is not enough
It is perfect, accordingly, it is difficult to carry out fixed point transformation to its enzyme molecule with the means that the reasonability such as rite-directed mutagenesis design.
Fallibility round pcr (error prone PCR) is a kind of simplicity by Leung et al. invention rapidly in DNA sequence
The method of mutation is randomly generated in column.The basic principle is that by adjusting the dense of magnesium ion in normal PCR reaction system and dNTP
Degree, archaeal dna polymerase and addition the methods of manganese ion using low fidelity make DNA in a replication process to a certain extent
It goes wrong to generate the library of sequence polymorphism.The key of this method is to find the suitable frequency of mutation, the frequency of mutation
The excessively high complete deactivation that will lead to enzyme, reduces the capacity in library；The frequency of mutation is too low, and wild type occupies very big ratio, no
Conducive to the screening and identification in later period.
Fallibility round pcr has simple rapid, at low cost and plasticity strong as a kind of molecular directed evolution technology
The advantages that, the transformation etc. for applying to enzyme molecule gradually.
Summary of the invention
The purpose of the present invention is to provide a kind of mannases.
Another object of the present invention is to provide the applications of above-mentioned mannase.
The purpose of the present invention is achieved through the following technical solutions:
A kind of mannase, which is will the amino acid sequence as shown in SEQ ID NO.1
The the 221st, 301 and 122 in an at least amino acids replace modification after amino acid sequence, wherein the 221st amino acids by
Leucine substitution is modified to isoleucine, and the 301st amino acids are modified to glutamic acid, the 122nd amino acids by lysine substitution
Arginine is modified to by glutamine substitution.
Preferably, which has the ammonia as shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4
Base acid sequence.
The encoding gene of above-mentioned mannase.
As a kind of optimal technical scheme, the encoding gene has such as SEQ ID NO.6, SEQ ID NO.7 or SEQ
Nucleotide sequence shown in ID NO.8.
Recombinant vector, expression cassette, transgenic engineered bacteria or cell line containing above-mentioned beta-mannase coding gene.
For expressing recombinant vector, expression cassette, transgenic engineered bacteria or the cell line of above-mentioned mannase.
A kind of mutational site of high activity mannase, the mutational site are amino acid sequence shown in SEQ ID NO.1
The the 221st, 301 and 122 at least one.
Application of the above-mentioned mannase in feed, food, paper industry.
From 'beta '-mannase producing strains bacillus, (Bacillus sp.MK-2, it is micro- to be preserved in Chinese agriculture to the present invention
Biological inoculum preservation administrative center (ACCC), deposit number ACCC19935) in cloned the coding base of 'beta '-mannase
Cause establishes the mutant library of the gene using fallibility round pcr, therefrom screening obtain that three enzyme activity increase substantially it is prominent
Variant obtains three kinds of high activity 'beta '-mannases and its gene mutation site has been determined.
One is to change the 221st amino acids leucine of wild type mannase as shown in SEQ ID NO.1 with different
Leucine, which replaces, modifies its sequence；Secondly being the 301st amino acids of wild type mannase as shown in SEQ ID NO.1
Lysine, which changes to replace with glutamic acid, modifies its sequence；Secondly for will the wild type mannase as shown in SEQ ID NO.1 the
122 amino acids glutamine, which change to replace with arginine, modifies its sequence.
The application system clones mannase gene from bacillus (Bacillus sp.MK-2), passes through pP43NMK
Carrier realizes expression in Bacillus subtilis WB800, and enzyme activity is relatively high, has certain application value,
To further increase the application value of this enzyme industrially, the application by the means of fallibility PCR to mannase gene into
It has gone random mutation, Bacillus subtilis WB800 will be transferred to after the enzyme gene of mutation and expression vector pP43NMK recombination
In, the mutant expression library of mannase gene is successfully constructed, therefrom screening has higher active mutant.
It will be described mannanase protein is transformed in the application method and acquired improvement in following specific embodiments
Mannanase protein.
Beneficial effects of the present invention:
The application has carried out random mutation to mannase gene by the means of fallibility PCR, by the enzyme gene of mutation
It is transferred in Bacillus subtilis WB800 with after expression vector pP43NMK recombination, successfully constructs mannase gene
Mutant expression library, therefrom screening has higher active mutant, the dew of the improvement mannanase protein and wild type
Dextranase increases significantly compared to its activity tool.
Specific embodiment
The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Without departing substantially from spirit of that invention
In the case where essence, to modifications or substitutions made by the method for the present invention, step or condition, all belong to the scope of the present invention.
1 material
Superrich culture medium (1L): 20g yeast powder, 25g peptone, 3g dipotassium hydrogen phosphate, 30g glucose.
Bacillus subtilis WB800 conversion reagent:
SP-A salting liquid (1L): (NH4)2SO44g, K2HPO4·3H2O 28g, KH2PO412g, sodium citrate 2g, 121
DEG C sterilizing 20min.
SP-B salting liquid (1L): MgSO4·7H2O 0.4g, 121 DEG C of sterilizing 20min.
100 × CAYE solution (100ml): casein hydrolysate 2g, yeast powder 10g, 121 DEG C of sterilizing 20min.
SPI Medium (10mL): 4.9mL SP-A salting liquid, 4.9mL SP-B salting liquid, 100 μ l Glucose (50%
W/v (50g/100ml), 115 DEG C of sterilizing 20min), 100 100 × CAYE of μ l.
SPII Medium (10mL): 9.8mL SPI Medium, 100 μ l 50mM CaCl2, 100 μ l 250mM MgCl2。
100 × EGTA solution: 10mM EGTA solution, when dissolution, need to add a small amount of NaOH to pH 8.0.
5 × M9 salting liquid: Na2PO4·7H2O 12.8g, KH2PO43.0g, NaCl 0.5g, NH4Cl 1.0g is added water to
200mL。
M9 minimal medium: the MgSO of 5 × M9 salting liquid 200ml, 1mol/L42ml, 20% (w/v, 20g/100ml's)
The Cacl of glucose solution 20ml, 1mol/L20.1ml adds water to 1000ml.
Trypan blue plate screening culture medium (1L): 10g peptone, 5g yeast powder, 5g sodium chloride, 1g konjaku flour, 0.1g platform
Expect indigo plant.
The clonal expression of 2 mannase genes
The building of 2.1pP43-man expression vector
Handbook is extracted according to Axygen company genome, using AxyPrep bacteria genome extraction
(this plant of bacterium is in the management of Chinese agriculture Microbiological Culture Collection for the genome of kit extraction bacterial strain Bacillus sp.MK-2
The heart (ACCC) preservation, deposit number are ACCC19935, and Chinese agriculture Microbiological Culture Collection administrative center is China national grade
Agriculture Microbiological Culture Collection manages specialized agency, is responsible for collection, identification, the evaluation, guarantor of National Agricultural microbial resources
Hiding, supply and international exchange task, stock strain all use whole society's opening and shares, and those skilled in the art can use
The mode bought to the collection obtains the bacterial strain).Using the genome of bacterial strain Bacillus sp.MK-2 as template, with P1 and
P2 is primer amplification mannase gene complete sequence (SEQ ID NO.1).
P1:5'-AACTGCAGCGCATACTGTGTCGCCTGTGAATCCTAATGCCCAGCAGACAA C-3'
P2:5'-CCCAAGCTTTCAGTGGTGGTGGTGGTGGTGTTCAACGATTGGCGTTAAAG A-3'
25 μ l amplification systems are as follows:
Amplification condition:
After the detection of 1% agarose gel electrophoresis of PCR product, purified using DNA purification kit (Axygen), it is spare.
By the mannase gene of previous step purifying and the matter extracted through AxyPrepplasmid extraction kit
Grain
PP43NNK carries out digestion, 20 μ l digestion systems respectively are as follows:
Digestion sample is placed in 37 DEG C of reaction 3-5h, and segment is through PCR purification kit (AxyPrep PCR DNA
Purification kit, Axygen) purification and recovery, plasmid is by DNA gel kit gel extraction.It will be upper using T4 ligase
It states purified segment and plasmid connects, construction of expression vector pP43-man, enzyme disjunctor system is as follows:
Enzyme is connected into 16 DEG C of reaction overnights (14h) of sample.
The conversion of 2.2 bacillus coli DH 5 alphas
(1) enzyme is connected into sample and bacillus coli DH 5 alpha competence (100 μ L) is mixed, stand 30min on ice.
(2) mixed sample handles 90s in 42 DEG C of water-baths, is again placed in 2min on ice.
(3) 800 μ L LB liquid mediums are added, 37 DEG C of 100rpm recovery 1h are coated on 100 μ gml of Amp-1LB it is flat
In plate, 37 DEG C of culture 12h.Picking single colonie is inoculated in 3ml liquid LB test tube (the 100 μ gml containing Amp-1) 37 DEG C of concussion trainings
8h is supported, plasmid is extracted.Double digestion verifying is carried out to plasmid using corresponding restriction endonuclease.
10 μ l digestion systems are as follows:
Digestion sample is placed in 37 DEG C of reaction 3-5h, 1% gel electrophoresis verifying.The correct plasmid of digestion verification is sent to Shanghai
The correctness to guarantee Insert Fragment sequence is sequenced in U.S. lucky biological Co., Ltd.
2.3 bacillus WB800 conversion and expression
A full ring bacillus subtilis glycerol stock is taken, is crossed in LB culture medium flat plate, 37 DEG C of incubator stationary culture 12h；
It chooses single bacterium to drop down onto 5ml LB culture medium, 37 DEG C, 220rpm overnight incubation；200 μ l culture solutions are taken to be forwarded to the fresh SPI training of 10ml
It supports in base, 37 DEG C, 250rpm is cultivated to logarithmic growth latter stage (about 4-5h)；0.4ml is taken to grow to the culture solution in the logarithm end of term extremely
In 4ml SPII culture medium, 37 DEG C, 100rpm is cultivated 90 minutes；20 μ l are added in the thallus of above-mentioned SPII culture medium
10mmol·L-1EGTA, then at 37 DEG C, 100rpm is cultivated 10 minutes, treated bacterium solution is distributed into the every pipe of 0.5ml, respectively
The expression vector pP43-man of 10 μ l is added, 37 DEG C, 170rpm is cultivated 90 minutes.It is coated in the LB plate of Km100 μ g/ml,
37 DEG C of culture 12h.Picking single colonie is inoculated in 3ml liquid LB test tube (100 μ g/ml) 37 DEG C of shake culture 8h, extracts plasmid,
Sequencing, the transformant for being transferred to correct plasmid is linked into superrich culture medium and carries out fermented and cultured.
The acquisition of 3 beta-mannase enzyme mutants
The acquisition of 3.1 beta-mannase gene mutant fragments
Using the expression vector pP43-man of 2.1 steps building as template, P1/P2 is primer, is tried using instant fallibility PCR
Agent box (Beijing day bounties Gene Tech. Company Limited) amplification beta-mannase gene mutant fragments.
30 μ l amplification systems:
Amplification condition:
PCR product cuts glue after the detection of 1% agarose gel electrophoresis and returns and quantify.
The linearisation of 3.2pP43-MAN plasmid
In beta-mannase gene interior design primer P3 and P4, the expression vector pP43-man constructed with 2.1 steps
For template, the pP43-man plasmid of linearisation is expanded.
P3:5'-ATTGCTGACGGACTTCAAGA-3'
P4:5'-GCACACCTTGGTTCTCCAGC-3'
25 μ l reaction systems:
PCR reaction condition:
PCR product cuts glue after the detection of 1% agarose gel electrophoresis and returns and quantify.
The acquisition of 3.3pP43-error-man plasmid multimers
PCR amplification is carried out by following reaction system and reaction condition, to obtain pP43-error-man plasmid multimers
(Zhang X-Z et al.,2011)。
PCR reaction system:
PCR reaction condition
PCR product is subjected to electrophoresis detection with 1% Ago-Gel.
3.4pP43-error-MAN plasmid multimers convert WB800
The pP43-error-man plasmid multimers obtained in step 3.3 are converted into gemma bar referring to the method for step 2.3
Bacterium WB800, will recover to obtain converted product and be added in 10mL M9 minimal medium by 90min, and 37 DEG C, 170rpm culture
14h.Above-mentioned product M9 minimal medium is diluted 20 times again, 37 DEG C, 170rpm cultivates 8h.Finally obtained bacterium solution is diluted
Multiple appropriate is coated on the trypan blue plate screening culture medium containing 30ng/mL kanamycins, obtains positive colony conversion
Son establishes beta-mannase gene mutant library.
4. mannase gene mutant strain is screened
To have the clone of transparent circle on plate screening culture medium, be transferred to containing fermentation medium (2.0% yeast powder,
2.5% peptone, 0.3% dipotassium hydrogen phosphate, 3.0% glucose, the unit of the above % are mass volume ratio g/ml) 96 hole depths
It ferments in orifice plate for 24 hours, surveys its enzyme activity, after multi-turns screen, 20 plants of high enzymes bacterial strain living is sieved to, through shake flask fermentation, enzyme
After measurement living, screening obtains the mutant strain that 3 plants of producing enzyme vigor significantly improve.It expresses 'beta '-mannase L221I respectively
(SEQ ID NO.2), 'beta '-mannase K301E (SEQ ID NO.3), 'beta '-mannase Q122R (SEQ ID NO.4).
4.1 crude enzyme liquid enzyme activity determinations:
Enzyme solution hydrolyzes konjaku flour under the conditions of 55 DEG C, generated required for 1 μm of ol reduced sugar (in terms of mannose) per minute
Enzyme liquid amount be an enzyme activity unit (U).
Control tube: removing ionized water 0.4ml and be added in 0.4ml 0.5% (g/ml) konjaku flour substrate solution, 55 DEG C of water
0.4ml DNS termination reaction is added immediately after bathing 10min, 100 DEG C are boiled cooling in placement ice water after 15min develops the color.
Measurement pipe (three parallel): appropriate diluted crude enzyme liquid 0.4ml is taken to be added to 0.4ml 0.5% (g/ml) konjaku flour
In substrate solution, be added immediately after 55 DEG C of water-bath 10min 0.4ml DNS terminate reaction, 100 DEG C boil 15min colour developing after place
It is cooling in ice water.It is returned to zero with control tube, measures the 520nm absorbance value of every pipe.It is obtained from standard curve according to absorbance value
The content of reduced sugar.
Enzyme activity defines unit: enzyme solution hydrolyzes konjaku flour under the conditions of 55 DEG C, to generate 1 μm of ol reduced sugar per minute (with sweet
Dew sugar meter) required for enzyme liquid amount be an enzyme activity unit (U).
According to mannose standard curve as a result, obtaining enzyme activity calculation formula:
Mannosan enzyme activity=[(y-b)/k] × N/ (V × t × M)
Absorbance value at y:520nm；B: the intercept of standard curve；K: the slope of standard curve；N: enzyme solution is dilute to be released again
Number；V: the enzyme solution volume after dilution；T: reaction time, unit minute；M: mannose molecules amount 180.16.Its enzyme activity determination knot
Fruit is shown in Table 1.
4.2 protein purification
To 20mL fermentation liquid, 80mL saturated ammonium sulfate solution is slowly added dropwise, this process should be carried out in ice, and real-time continuous stirs
Mix fermentation liquid.After mixed liquor is placed in 4 DEG C overnight, in 4 DEG C, 12000rpm is centrifuged 15min.Supernatant is discarded, 2mLpH is added
7.0Tris-HCl buffer, sufficiently dissolution precipitating.Enzyme solution after ammonium sulfate precipitation is added in the bag filter of 3500Da, juxtaposition
In pH 7.0Tris-HCl buffer, for 24 hours in 4 DEG C of dialysis, a buffer is replaced every 6h.By the enzyme solution after dialysis
The further purifying protein of affinity chromatography is carried out by method, purified albumen out is dialysed again removes the imidazoles of the inside,
And by BCA kit measurement protein content, Rate activity is calculated, the results are shown in Table 1.
1 mannase of table and its mutation vitality of subject test result
| Enzyme | Crude enzyme liquid vigor U/mL | Rate activity U/mg |
| Wild type | 2852 | 2802 |
| L221I | 9747 | 6172 |
| K301E | 11848 | 8760 |
| Q122R | 10129 | 8384 |
5. the measurement of enzyme kinetic analysis parameter
Dilution enzyme solution is reacted in the konjaku flour substrate of various concentration under optimum condition, Michaelis-Menten equation is calculated, obtains
Each parameter value, the results are shown in Table 2.
2 mannase of table and its mutant enzyme kinetic analysis test result
Claims (6)
1. a kind of mannase, it is characterised in that the mannosan enzyme amino acid sequence is will the ammonia as shown in SEQ ID NO. 1
Amino acid sequence after the 301st or 122 amino acid substitution modification of base acid sequence, wherein the 301st amino acids are by relying ammonia
Acid, which replaces, is modified to glutamic acid, and the 122nd amino acids are modified to arginine by glutamine substitution.
2. the encoding gene of mannase described in claim 1.
3. the encoding gene of mannase according to claim 2, it is characterised in that the encoding gene has such as SEQ
Nucleotide sequence shown in ID NO.7 or SEQ ID NO.8.
4. recombinant vector, expression cassette, transgenic engineered bacteria containing beta-mannase coding gene described in Claims 2 or 3 or
Cell line.
5. expressing recombinant vector, expression cassette, transgenic engineered bacteria or the cell line of mannase described in claim 1.
6. application of the mannase described in claim 1 in feed, food, paper industry.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610323104.5A CN105861466B (en) | 2016-05-15 | 2016-05-15 | The high activity mannase obtained by genetic engineering transformation and its mutational site |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610323104.5A CN105861466B (en) | 2016-05-15 | 2016-05-15 | The high activity mannase obtained by genetic engineering transformation and its mutational site |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105861466A CN105861466A (en) | 2016-08-17 |
| CN105861466B true CN105861466B (en) | 2019-05-07 |
Family
ID=56634117
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610323104.5A Active CN105861466B (en) | 2016-05-15 | 2016-05-15 | The high activity mannase obtained by genetic engineering transformation and its mutational site |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105861466B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107129958B (en) * | 2017-06-09 | 2021-07-20 | 华南理工大学 | Screening method of beta-mannase engineering bacteria |
| CN111269901B (en) * | 2020-02-18 | 2021-08-24 | 浙江科技学院 | Epoxide hydrolase mutant and application thereof |
| CN111334493B (en) * | 2020-04-02 | 2022-01-18 | 南京工业大学 | Medium-low temperature endo-beta-mannase, and coding gene and application thereof |
| CN114250211B (en) * | 2021-12-24 | 2024-01-26 | 内蒙古科为博生物科技有限公司 | Mannanase and gene and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101392241A (en) * | 2007-09-18 | 2009-03-25 | 中国科学院微生物研究所 | Beta-mannanase, gene, preparation method, vector and host cell |
| CN104109661A (en) * | 2013-04-17 | 2014-10-22 | 东莞泛亚太生物科技有限公司 | Enzyme activity enhanced mannanase |
-
2016
- 2016-05-15 CN CN201610323104.5A patent/CN105861466B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101392241A (en) * | 2007-09-18 | 2009-03-25 | 中国科学院微生物研究所 | Beta-mannanase, gene, preparation method, vector and host cell |
| CN104109661A (en) * | 2013-04-17 | 2014-10-22 | 东莞泛亚太生物科技有限公司 | Enzyme activity enhanced mannanase |
Non-Patent Citations (1)
| Title |
|---|
| MULTISPECIES:beta-mannosidase（Bacillus）;NCBI;《Genbank Database》;20150301;Accession No.：WP_041850758.1 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105861466A (en) | 2016-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105861466B (en) | The high activity mannase obtained by genetic engineering transformation and its mutational site | |
| CN112867784A (en) | Methods and compositions for improved phosphate solubilization | |
| CN109957536B (en) | Bacillus subtilis and application thereof in production of alginate lyase | |
| CN104031873B (en) | For producing ETEC and structure and the application of isoeugenol monooxygenase | |
| CN113502250B (en) | Ralstonia strain and application, acquisition and control effect evaluation method thereof | |
| CN106520642B (en) | Bacillus amyloliquefaciens and application thereof | |
| CN114717145B (en) | Cucumber golden fungus and application thereof in degradation of seaweed residues | |
| CN105420154A (en) | Double knockout recombinant rhodococcus as well as construction method and application thereof | |
| CN107227265B (en) | A kind of colloid bacillus cereus bacterial strain and microbial bacterial agent | |
| WO2016171288A1 (en) | Strain having odor removal effect, and method for removing odor from livestock excrement using same | |
| CN104560817B (en) | Thermophilic bacillus licheniformis UTM102 for producing phytase and application of thermophilic bacillus licheniformis UTM102 | |
| CN107446873B (en) | Rhizobium nodosum capable of promoting wheat growth and construction and application thereof | |
| CN111826308B (en) | Marine sediment-derived chitin efficient degrading bacterium and application thereof | |
| CN106754486B (en) | Pseudomonas for high-yield trehalose synthase and fermentation enzyme production method thereof | |
| CN110305819B (en) | Efficient feather degradation strain and application thereof | |
| CN104560815B (en) | Bacillus licheniformis with azo compound degradation activity and application thereof | |
| CN107058135A (en) | A kind of bacterial strain for producing zytase and its application | |
| CN107674839B (en) | Fusarium solani and method for producing dextranase by fermenting fusarium solani | |
| CN108741208A (en) | One plant of flavouring bacterium detached from reproduced tobacco concentrated liquid and its application | |
| CN104726388A (en) | Pullulanase enzyme-producing strain and method for improving enzyme-producing capacity thereof | |
| KR102083165B1 (en) | Novel microorganism of the Genus Euglena having beta-1,3-glucan-producing activity and process for producing Euglena-biomass containing beta-1,3-glucan using the same | |
| CN111172082B (en) | Bacillus altitudinis strain SG-1 for producing alkaline xylanase and application thereof | |
| CN108192848A (en) | A kind of Psychrobacter bacterial strain of galactopoiesis carbohydrase and the method that low temperature lactase is prepared using the bacterial strain | |
| CN111172062A (en) | Sphingobacterium multivorum and application thereof | |
| CN105200088B (en) | A kind of enzymatic conversion method DL-2- amino-△2The method of thiazoline -4- carboxylic acid synthesis L-cysteine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |