CN111188094A

CN111188094A - Sequencing library construction method and kit for pathogenic microorganism detection

Info

Publication number: CN111188094A
Application number: CN202010111731.9A
Authority: CN
Inventors: 聂俊伟; 韩锦雄; 江明扬; 张力军; 瞿志鹏; 吴恒
Original assignee: Vazyme Biotech Nanjing Co ltd
Current assignee: Vazyme Biotech Nanjing Co ltd
Priority date: 2020-02-24
Filing date: 2020-02-24
Publication date: 2020-05-22
Anticipated expiration: 2040-02-24
Also published as: CN111188094B

Abstract

The invention discloses a sequencing library construction method and a kit for pathogenic microorganism detection, wherein the method comprises the steps of (1) putting an extracted sample into a sample preservation solution, carrying out DNA/RNA co-extraction, and removing host rRNA; (2) adding reverse transcriptase to make RNA reverse transcription to form RNA/cDNA composite double-chain; (3) directly adding mutant Tn5 transposase and an interruption buffer solution into a mixture of a reverse transcription product cDNA/RNA composite double strand and a DNA double strand for fragmentation, and carrying out termination reaction by using a termination reaction solution 5 XTS-plus after the fragmentation is finished; (3) adding an amplification buffer solution, a strand displacement and amplification enzyme mixture, and performing PCR amplification; (4) and purifying the magnetic beads to obtain a sequencing library of the original DNA/RNA. The method greatly reduces the library building steps, shortens the library building time, reduces the requirement on the initial amount of the sample, and improves the library output and the off-line data quality.

Description

Sequencing library construction method and kit for pathogenic microorganism detection

Technical Field

The invention relates to the technical field of biology, in particular to a sequencing library construction method and a kit for pathogenic microorganism detection.

Background

Pathogenic microorganisms refer to microorganisms, or pathogens, that can invade the body and cause infections and even infectious diseases. Among pathogens, the most harmful are bacteria and viruses. Pathogenic microorganisms include prions, parasites (protozoa, worms, medical insects), fungi, bacteria, spirochetes, mycoplasma, rickettsia, chlamydia, viruses.

Infectious diseases and infectious diseases caused by pathogenic microorganisms are one of the most common diseases facing clinical treatment, account for 50% of human diseases, and the pathogenic microorganisms have the tendency of diversification and complication along with the influence of factors such as the structural change of people, environmental pollution, drug abuse and the like and the high variability of pathogens and seriously threaten human health. Infectious diseases caused by pathogenic microorganisms often develop rapidly, and unknown pathogens exist, so that great difficulty is brought to diagnosis and detection. The rapid and accurate diagnosis has great significance in monitoring the state of illness, and can help provide effective treatment and control the spread of diseases. The currently common pathogenic microorganism detection methods comprise smear microscopy, biochemical reaction, immunodetection, culture method, conventional PCR method, qPCR, gene chip technology, high throughput sequencing (NGS), mass spectrometry and other technologies.

The NGS technique has the advantages of being capable of comprehensively mastering all related microorganism information, being capable of discovering unknown pathogens, being capable of detecting variation, having the highest sensitivity, having the highest flux and the like without depending on known nucleic acid sequences, and is gradually applied to diagnosis, treatment and monitoring of infectious diseases compared with the rapidity of the traditional detection method and the accuracy of the general molecular detection methods such as PCR and the like, thereby becoming one of the gold standard methods for pathogen detection.

The high-throughput sequencing for detecting pathogenic microorganisms mainly comprises the following procedures: 1. collecting and transporting the sample; 2. extracting nucleic acid; 3. removing host ribosomal RNA; DNA disruption (including physical and enzymatic disruption); RNA disruption; RNA reverse transcription-strand synthesis; cDNA double-strand synthesis; 8. purifying the double-strand cDNA; 9. mixing the fragmented DNA and the double-stranded cDNA; 10. repairing the end of the double-stranded DNA; 11.3' end with A tail; 12. connecting a joint matched with the sequencing platform; amplifying the PCR library; 14. and purifying library magnetic beads. The whole process takes about 10-11 hours. The scheme has the advantages of long library building flow, complexity and high requirement on the initial amount of the sample, and cannot meet the rapidly-developed detection market and the urgent requirement of a patient on the detection result report. Therefore, if the existing scheme can be improved, the library building process can be shortened, the research and clinical application of high-throughput sequencing on the aspect of pathogenic microorganism detection can be greatly promoted, and a faster and more accurate detection result can be provided for patients.

High throughput sequencing for detection of pathogenic microorganisms generally comprises the following procedures (as shown in fig. 1): 1. collecting and transporting the sample; storing the sample in a sample storage tube or storing and transporting at-70 ℃; 2. extracting nucleic acid; because of the presence of RNA viruses and the need to know the amount of specific gene expression of pathogens and drug resistance gene testing, it is often necessary to co-extract DNA and RNA from a sample. Column extraction method or magnetic bead method can be used for extraction, and magnetic bead method extraction is suitable for automatic extraction instrument, and can greatly improve extraction flux. 3. Removing host ribosomal RNA; since the vast majority of the extracted sample is host DNA and RNA, and the rRNA accounts for more than 90%, the removal of the host rRNA is beneficial to more effective data detection. The current methods include RNase H method and magnetic bead capture method based on DNA probes. The RNase H method has high removal efficiency and good specificity, but the flow is longer; the magnetic bead grasping method is relatively simple in operation, short in time and low in removal efficiency; DNA disruption (including physical disruption methods such as ultrasonic disruption using Covaris instruments or Biorupter; and enzyme-based disruption methods); RNA breaking (RNA is single-stranded and is easy to break in high-concentration metal ions); reverse transcription of RNA for one-strand synthesis using reverse transcriptase; cDNA double-stranded synthesis using DNA polymerase; 8. purifying the double-strand cDNA by using DNA purification magnetic beads; 9. mixing the fragmented DNA and the double-stranded cDNA; 10. repairing double-stranded DNA ends, generally performing end filling and phosphorylation by enzymes such as T4 DNA polymerase, T4 PNK and the like; 11.3' end with A tail, by Taq DNA polymerase or Klenow DNA polymerase; 12. connecting a linker matched with a sequencing platform, such as an Illumina sequencing platform, an MGI sequencing platform and an Ion Torrent sequencing platform; PCR library amplification using PCR reactions based on thermostable DNA polymerases and sequencing platform adapted primers; 14. and purifying library magnetic beads. The entire process takes approximately 10-11 hours. Infection and infectious diseases caused by detection of pathogenic microorganisms are fast in morbidity, the growth and reproduction speed of the pathogenic microorganisms in a patient body is extremely fast, and therefore the detection speed is higher, the warehouse building process of the scheme is long and complex, the warehouse building efficiency is low, the detection time is too long, and the requirement of the patient and medical staff on the timeliness of the report cannot be met; and the prior art has higher requirements on the initial amount of the sample. The prior art generally requires more than 100ng for the initial amount of sample, and can achieve 10ng in an extreme case. Because the patient samples come from comparatively complicated samples such as cerebrospinal fluid, hydrothorax, alveolar lavage fluid, blood and the like, the sample is not well preserved, so that the nucleic acid is easily degraded, the extraction quality is not high, the microorganism content is low, and the requirement of the detection starting amount is often difficult to meet; in addition, DNA and RNA are separately operated, the process is long, errors are prone to occur, the key step of simultaneously constructing the DNA and RNA is a transposase breaking step, Tn5 transposase has low breaking efficiency on a cDNA hybrid chain, the inactivation of the transposase is not thorough when the reaction is stopped, the transposase is stuck on the DNA, the subsequent amplification is influenced, and the quality and the speed of constructing the library are greatly influenced. Errors in library construction can lead to incomplete and incomplete information of the obtained library, and finally cause low pathogen detection efficiency.

Disclosure of Invention

The invention aims to provide a rapid and simple sequencing library construction method and a kit for detecting pathogenic microorganisms. The whole process can shorten the original construction process of the pathogenic microorganism detection library which takes 10-11 hours and needs 14 steps to only 6-7 steps and only 3.5-5 hours, thereby greatly reducing the steps of library construction, shortening the time of library construction, reducing the requirement on the initial amount of samples, improving the library output and the off-line data quality, helping to obtain more pathogenic microorganism information and helping patients and medical staff to quickly obtain detection results.

The invention also provides a sample preservation solution, which can prevent nucleic acid in a sample from being easily degraded.

The object of the invention can be achieved by the following measures:

one of the purposes of the invention is to provide a sequencing library construction method for detecting pathogenic microorganisms, which comprises the following steps:

(1) putting the extracted sample into a sample preservation solution, then carrying out DNA/RNA co-extraction, and removing rRNA of a host;

(2) adding reverse transcriptase into the sample obtained in the step (1) to carry out reverse transcription on the RNA in the sample to form an RNA/cDNA composite double strand;

(3) directly adding mutant Tn5 transposase and an interruption buffer solution into the mixture of the cDNA/RNA composite double strand and the DNA double strand of the reverse transcription product obtained in the step (2) for fragmentation, and performing termination reaction by using a termination reaction solution 5 XTS-plus after the fragmentation is finished, so as to inactivate the mutant Tn5 transposase;

(3) strand displacement and library amplification: adding an amplification buffer solution, a strand displacement and amplification enzyme mixture into the product obtained in the step (2) to perform PCR amplification;

(4) and purifying the magnetic beads to obtain a sequencing library of the original DNA/RNA.

In the method of the present invention, in step (1), the sample is preserved and transported using a sample preservation solution, which comprises: Tris-HCl10 mM-2M, PH 7.0-9.0, guanidine hydrochloride 0.1M-8M, cobalt chloride 0.5-10mM, EDTA.2Na 0.1M-2M, Triton X-1000.1% -5%, sodium deoxycholate 0.1 mM-4M; preferably, it comprises: 50mM-200mM of Tris-HCl, 7.0-9.0 pH, 1M-5M of guanidine hydrochloride, 1-4mM of cobalt chloride, 0.1M-0.5M of EDTA.2Na, 0.5 mM-2% of TritonX-1000.5%, and 0.5mM-2M of sodium deoxycholate; further preferably, the composition comprises 100mM Tris-HCl, 8.0 pH guanidine hydrochloride, 2mM cobalt chloride, 0.2M EDTA.2Na, 1001% Triton X and 1mM sodium deoxycholate. By adopting the preservation solution, RNA can not be degraded after being preserved for 1 hour at 56 ℃, and at the temperature, a plurality of samples containing viruses can be heated to 56 ℃ for sterilization and then be subjected to subsequent experiments, thereby being beneficial to protecting experimenters.

The sample in step (1) of the present invention may be a sample obtained by any of the collection types and methods commonly used in the art, such as human nasopharynx swab, oral swab, sputum, alveolar lavage fluid, pleural effusion, cerebrospinal fluid, serum, plasma, blood, urine, feces, etc. The sample collection method can adopt a method commonly used in the field for collection, and after collection, the sample preservation solution provided by the invention is immediately adopted for collecting, preserving and transporting samples, and the sample preservation solution has an inactivation function, guarantees safe use, protects nucleic acid, and is suitable for short-term normal-temperature transportation.

Preferably, the sample is heated to 50-56 ℃ for 0.5-1 hour after being placed in the sample preservation solution, and most preferably, the sample is heated to 56 ℃ for 0.5-1 hour after being placed in the sample preservation solution.

The method for co-extracting DNA/RNA from the sample in step (1) of the present invention may be a method that is conventional in the art, such as a magnetic bead method or a column method. In one embodiment of the invention, the invention provides a method of DNA/RNA co-extraction: after 400-.

The removal of the host rRNA in the step (1) of the present invention may be performed by a conventional method in the art, for example, by using an RNase H method or a magnetic bead method; the designed DNA probe can be specifically matched with rRNA, RNase H can identify a DNA/RNA heterozygous chain and cut the RNA chain in the DNA/RNA heterozygous chain, and then Dnase is used for removing the DNA probe, so that the rRNA of a host can be removed; the magnetic bead method is to use streptavidin magnetic bead to grab the rRNA complementary sequence with biotin label, and after complementary pairing, the unpaired solution is sucked out, and the rRNA is left on the streptavidin magnetic bead and separated from other RNA.

The reverse transcription of RNA in the reaction substrate to form RNA/cDNA complex double strand in step (2) of the present invention can be performed by a conventional reverse transcription method in the art.

In one embodiment of the present invention, the mutation site of mutant Tn5 transposase in step (3) of the present invention is: D24E, D97E, K160R and E326D are mutated simultaneously, the amino acid sequence of the mutation is shown as SEQ ID NO.1, and the gene sequence is shown as SEQ ID NO. 2. The hybrid strand breaking efficiency of the mutant Tn5 transposase cDNA is higher.

The final concentration of mutant Tn5 transposase after incorporation into the disruption system in step (3) of the present invention can be 1-50ng/ul, preferably 1-20ng/ul, and more preferably 1-10ng/ul, and in one embodiment, the final concentration of mutant Tn5 transposase after incorporation into the disruption system is 5 ng/ul.

In the step (3) of the present invention, a partial linker sequence may be added to the 5' end of the double strand as usual while the mutant Tn5 transposase is disrupted.

The termination reaction solution 5 XTS-plus used in the step (3) of the present invention comprises: 0.1% -5% BSA, 0.05% -2% Tween-20, 0.1-1% SDS, 1mM-50mM DTT; preferably, it comprises: 2% -3% BSA, 0.05% -1.5% Tween-20, 0.1-1% SDS, 20mM-30mM DTT; in a specific embodiment, 2.5% BSA, 1% Tween-20, 0.5% SDS, 25mM DTT is included.

In the step (3) of the present invention, after the mutant Tn5 transposase is inactivated, magnetic bead purification may be performed, or the reaction may proceed to the next step without purification, and since the termination reaction solution 5 × TS-plus used in the step (3) of the present invention can inactivate Tn5 transposase well without sticking to DNA, and has little influence on the subsequent experiment, the subsequent steps may be performed even without purification.

In some embodiments, the mixture of cDNA/RNA complex duplexes and DNA duplexes in step (3) of the invention is between 0.1ng and 1. mu.g. The inventor finds that the co-construction library scheme can be well realized in the mixture in the range during the library construction process.

The mutant Tn5 transposase in step (3) of the invention can form a complex with partial sequencing linker in advance according to a conventional method, and the embedded linker can be suitable for an Illumina sequencing platform, an Ion Torrent sequencing platform and an MGI sequencing platform made by Huada Intelligence.

The mutated Tn5 transposase of step (3) of the present invention can be bound to streptavidin magnetic beads.

The breaking buffer used in step (3), the amplification buffer used in step (4), the strand displacement and amplification enzyme mixture used in step (4) of the present invention may be any one of those conventional in the art.

In one embodiment of the invention, the magnetic bead method or the column method is used for DNA/RNA co-extraction; removing rRNA of a host by using an RNase H method or a magnetic bead method; synthesizing a cDNA strand by RNA reverse transcription by using reverse transcriptase; then fragmenting a mixture of DNA and RNA by using Tn5 transposase (Tn 5 transposase with high cDNA heterozygosity breaking efficiency) and connecting a connector tap, and performing termination reaction by using the special 5 XTS-plus of the invention to inactivate the mutant Tn5 transposase; and (3) carrying out strand displacement and PCR library amplification on the fragmented products to form a complete library.

The flow chart of the method for constructing the sequencing library for detecting the pathogenic microorganisms can be shown in figure 2, the time is about 3.5-5 hours, and compared with the flow chart of the co-constructing the DNA/RNA library of the pathogenic microorganisms, which is shown in figure 1, the time is greatly shortened.

The invention also aims to provide a kit for constructing a sequencing library for detecting pathogenic microorganisms, which comprises the following components:

(1) a sample preservation solution;

(2) rRNA removal of fractions;

(3) reverse transcription reaction component: comprises reverse transcriptase, reverse transcription reaction buffer solution and reverse transcription primer;

(4) mutant Tn5 transposase fragment components: comprises mutant Tn5 transposase, disruption buffer and termination reaction solution 5 × TS-plus;

(5) strand displacement and library amplification components: comprises a mixture of strand displacement and amplification enzymes and an amplification buffer.

The sample preservation solution in the kit of the present invention comprises: Tris-HCl10 mM-2M, PH 7.0-9.0, guanidine hydrochloride 0.1M-8M, cobalt chloride 0.5-10mM, EDTA.2Na 0.1M-2M, Triton X-1000.1% -5%, sodium deoxycholate 0.1 mM-4M; preferably, it comprises: 50mM-200mM of Tris-HCl, 7.0-9.0 pH, 1M-5M of guanidine hydrochloride, 1-4mM of cobalt chloride, 0.1M-0.5M of EDTA.2Na, 0.5 mM-2% of Triton X-1000.5%, and 0.5mM-2M of sodium deoxycholate; further preferably, the composition comprises 100mM Tris-HCl, 8.0 pH guanidine hydrochloride, 2mM cobalt chloride, 0.2M EDTA.2Na, 1001% Triton X and 1mM sodium deoxycholate.

The rRNA-depleted fraction of the kit of the invention may be a fraction conventional in the art, for example: comprises rRNAProbe (H/M/R), Probe Buffer, RNase H, DNase I Buffer, DNase I, nucleic-free water and the like, and can also comprise streptavidin magnetic beads, magnetic bead washing Buffer solution, hybridization probes, hybridization Buffer solution and the like; alternatively, rRNA removal fractions were used directly with the Nanjing Novozam Biotechnology Ltd Ribo-off rRNAD displacement Kit (Human/Mouse/Rat) (cat # N406) or using streptavidin-based magnetic bead coated rRNA probe capture kits.

Mutant Tn5 transposase and termination reaction solution 5 XTS-plus in the kit of the invention were as described above.

The kit of the invention can also comprise a purification component, wherein the purification component comprises RNA purification magnetic beads, DNA purification magnetic beads and nuclease-free water.

The kit of the present invention may further comprise an amplification primer in the strand displacement and library amplification component (5).

The Reverse Transcriptase of the present invention may be a commercial Reverse Transcriptase commonly used in the art, for example HiScript Reverse Transcriptase or HiScript II Reverse Transcriptase or HiScript III Reverse Transcriptase (cat # R101 or R201 or R302) of Nanjing Novowed Biotech, Inc.

The Reverse transcription buffer solution of the present invention may be a Reverse transcription buffer solution commonly used in the art, for example, a buffer solution attached to a HiScript Reverse Transcriptase, HiScript II Reverse Transcriptase, HiScript III Reverse Transcriptase, Nanjing Novomedium Biotech, Inc., and mainly comprises: 100-.

The reverse transcription primer of the invention is a mixture of oligo (dT) and a random primer, or oligo (dT), or a random primer.

The disruption Buffer of the present invention can be a commercial Tn5 transposase matching Buffer commonly used in the art, such as TruePrep DNA library Prep Kit V2for Illumina Kit, TruePrep tag Buffer L, Nanjing Novowed Biotech Limited.

The RNA purification magnetic bead of the present invention may be a commercially available RNA purification magnetic bead commonly used in the art, such as VAHTS RNA clean beads of nakai nuozokenza biotechnology limited.

The DNA purification magnetic bead of the present invention may be a commercially available DNA purification magnetic bead commonly used in the art, such as VAHTS DNA clean beads from Biotechnology Ltd of Nanjing Novozam.

The nuclease-free water is double distilled water sterilized after DEPC treatment.

The mixture of strand displacement and amplification enzymes of the present invention is a mixture of an enzyme having strand displacement activity and DNA polymerase, wherein the enzyme having strand displacement activity may be, for example, E.coli DNA polymerase I, klenow fragment, Bst DNA polymerase, Phi29DNA polymerase, reverse transcriptase, Tth DNA polymerase, etc.; the DNA polymerase may be, for example, Taq DNA polymerase, Pfu DNA polymerase, KOD DNA polymerase, Phanta high fidelity DNA polymerase (e.g., Nanjing Novozam Biotech Co., Ltd., product No. P505) or VAHTS HiFi DNA polymerase (e.g., Nanjing Novozam Biotech Co., Ltd., product No. N616) or TruePrepAmplify Enzyme (e.g., TAE component of TruePrep DNA library Prep Kit V2for Illumina Kit, Nanjing Novozam Biotech Co., Ltd.), or a mixture of other equivalent products.

The amplification Buffer of the present invention is a Buffer solution adapted by E.coli DNA polymerase I, klenow fragment, Bst DNA polymerase, Phi29DNA polymerase, reverse transcriptase, Tth DNA polymerase, Taq DNA polymerase, Pfu DNA polymerase, KOD DNA polymerase, Phanta high fidelity DNA polymerase (Nanjing Nozaki Biotech Co., Ltd., product No. P505) or VAHTS HiFi DNA polymerase (Nanjing Nozaki Biotech Co., Ltd., product No. N616), or a 5 TAB × component in TruePrep DNA library Prep Kit V2for Illumina Kit, i.e., a uePrep amplification Buffer. The main component comprises a mixture of 10-500mM Tris-HCl, 10-500mM KCl, 0.1-100mM potassium acetate, 0.1-100mM ammonium sulfate, and additionally contains BSA, Triton X-100, etc., and has a pH of 7.5-9.0.

The amplification primer of the present invention can be a conventional amplification primer in the art, such as TruePrep Index Kit for Illumina Kit of nakyo nuozhen biotechnology limited.

The reverse transcriptase, the reverse transcription buffer solution and the reverse transcription primer in the kit can be mixed into one or 2 mixtures.

The strand displacement and amplification enzyme mixture, the amplification buffer and the amplification primers in the kit can be mixed into one or 2 mixtures.

The library constructed by the invention can be subjected to quality control, the quality control method is that a Qubit or equivalent principle detection instrument and a reagent are used for detecting the concentration of the library, and an Agilent 2100 instrument is used for detecting the peak pattern of the library.

The present invention also provides a sample preservation solution comprising: Tris-HCl10 mM-2M, PH 7.0-9.0, guanidine hydrochloride 0.1M-8M, cobalt chloride 0.5-10mM, EDTA.2Na 0.1M-2M, Triton X-1000.1% -5%, sodium deoxycholate 0.1 mM-4M; preferably, it comprises: 50mM-200mM of Tris-HCl, 7.0-9.0 pH, 1M-5M of guanidine hydrochloride, 1-4mM of cobalt chloride, 0.1M-0.5M of EDTA.2Na, 0.5 mM-2% of Triton X-1000.5%, and 0.5mM-2M of sodium deoxycholate; further preferably, the composition comprises 100mM Tris-HCl, 8.0 pH guanidine hydrochloride, 2mM cobalt chloride, 0.2M EDTA.2Na, 1001% Triton X and 1mM sodium deoxycholate. The preservation solution can prevent RNA from being degraded after being preserved for 1 hour at 56 ℃, and at the temperature, a plurality of samples containing viruses can be heated to 56 ℃ for sterilization and then be subjected to subsequent experiments, thereby being beneficial to protecting experimenters.

The invention also provides application of the sample preservation solution in preservation of pathogenic microorganism-containing samples.

The advantages of the invention over the prior art are:

(1) according to the invention, the traditional pathogenic microorganism DNA/RNA co-construction library which takes 10-11 hours and is shown in FIG. 1 is shortened to only 3.5-5 hours, so that the library construction time is greatly shortened, the library output and off-line data quality are improved, and more real information is obtained.

(2) The preservation solution can prevent RNA from being degraded after being preserved for 1 hour at 56 ℃, and at the temperature, a plurality of samples containing viruses can be heated to 56 ℃ for sterilization and then be subjected to subsequent experiments, thereby being beneficial to protecting experimenters.

(3) The mutant Tn5 transposase (D24E, D97E, K160R and E326D are mutated at the same time) applied in the invention has higher cDNA heterozygosity strand breaking efficiency, and the breaking termination buffer solution of 5 × TS-plus can completely inactivate the transposase, effectively prevent the transposase from being adhered to DNA, is beneficial to library amplification and obtains a library with high yield.

(4) The used reaction terminating solution 5 XTS-plus can inactivate Tn5 transposase well, does not stick to DNA, and has little influence on subsequent experiments, so that subsequent steps can be carried out even if purification is not carried out, magnetic bead purification can be carried out after the mutant Tn5 transposase is inactivated, and the next step of reaction can be directly carried out without purification.

Part of the definitions in the present invention:

high throughput sequencing technology: also known as second generation sequencing technology, next generation sequencing technology, may be abbreviated as NGS. The method refers to a technology for carrying out sequence determination on hundreds of thousands to millions of DNA molecules at a time in parallel, and the determined sequence length is generally short.

Transposase: the enzyme performing the transposition function, usually encoded by a transposon, recognizes specific sequences at both ends of the transposon, and can detach the transposon from adjacent sequences and insert it into a new DNA target site without homology requirement. Tn5 transposase is one of transposases, has the characteristics of good randomness, high stability, easy sequencing of insertion sites and the like, and is a high-efficiency tool applied to molecular inheritance and gene sequencing.

Drawings

FIG. 1 is a process of the present scheme for detecting a DNA/RNA co-library of pathogenic microorganisms;

FIG. 2 is a conventional DNA/RNA co-library process for pathogenic microorganism detection;

FIG. 3 is an electrophoretogram of samples of example 2 stored in two storage solutions at 4 ℃ for 24 h;

FIG. 4 is an electrophoretogram of samples of example 2 stored in two storage solutions at 56 ℃ for 1 h;

FIG. 5 is the Agilent 2100 library peak pattern of the termination reaction (panel two) with TS-plus of example 3;

FIG. 6 is the Agilent 2100 library peak pattern for the termination reaction with the TS fraction (control group two) of example 3;

FIG. 7 is an electrophoretic image of the library of example 3TTE-plus Tn5 transposase disruption (Experimental group one) and TTE Tn5 transposase disruption (control group one);

FIG. 8 is the Agilent 2100 library peak pattern in example 4;

FIG. 9 shows the Agilent 2100 library peak patterns in example 5.

Detailed Description

The present invention will be further described with reference to the following examples, which should be understood that the specific examples described herein are only for illustrating the present invention and are not intended to limit the present invention, and that the simple modifications of the preparation method of the present invention based on the concept of the present invention are within the scope of the present invention. The following examples are experimental procedures without specifying specific conditions, generally according to the means known in the art. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

The core of the invention is used for rapidly and simply establishing the library for pathogenic microorganisms, and the invention has the advantages that the sample preservation solution can better prevent nucleic acid degradation; in addition, the mutant Tn5 transposase has good breaking efficiency on cDNA heterozygous chains, the breaking of a termination buffer solution can completely inactivate the transposase, the library building process is short, the operation time required by library building is short, the requirement on the initial amount of a sample is reduced, the library output and the off-line data quality are improved, more pathogenic microorganism information is obtained, and a patient and medical staff are helped to quickly obtain a detection result.

Example 1: acquisition of mutant Tn5 transposase

The preparation method of the mutant Tn5 transposase with the amino acid sequence shown as SEQ ID NO.1 comprises the following steps: using the method of gene synthesis, a primer sequence containing a site to be mutated and a substituted base was synthesized as follows:

D24-f：CGGCGCTGGGTGAGCCTCGCCGTA

D24-r：TACGGCGAGGCTCACCCAGCGCCG

A97-f：GCCATTGAGGAAACCACCT；

A97-r：AGGTGGTTTCCTCAATGGC；

K160-f：TGCGGATGAAAGGGAGAGTGGCAA

K160-r：TTGCCACTCTCCCTTTCATCCGC

C326-f：CGGATCGACGAGTTCCATA；

C326-r：TATGGAACTCGTCGATCCG；

phanta Max Super-Fidelity DNA Polymerase (Vazyme, cat. P505, manufactured by Nanjing Nodezaki Biotech Co., Ltd.) was used as the DNA Polymerase. The amplification condition is 95 ℃ for 30 s; 15s at 95 ℃; 15s at 60 ℃; 30s-3min at 72 ℃; 5min at 72 ℃; for a total of 30 cycles. After the amplification, 1. mu.l of DpnI was directly added to 50. mu.l of the reaction system, incubated at 37 ℃ for 2 hours, and the original plasmid template was digested. Performing agarose gel electrophoresis at 1-1.5% (W/V) to obtain a target band, cutting, and recovering. The recovered product is utilized by Mut

The MultiS Fast Mutagenesis Kit V2 (Vazyme, cat # C215, manufactured by Nanjing Nodezam Biotech Co., Ltd.) was subjected to recombination reaction and incubated at 37 ℃ for 0.5 hour.

Mu.l of the cooled reaction mixture was added to 100. mu.l of Bl21 competent cells (Vazyme), gently flicked, and mixed under the tube wall, and then placed on ice for 30 min. Heat shock at 42 ℃ for 90 seconds, and incubation in ice water bath for 2 min. Add 500. mu.l LB medium and incubate at 37 ℃ for 10min for sufficient recovery. Shake the bacteria for 45min at 37 ℃. 100. mu.l of the bacterial suspension was applied evenly to a plate containing ampicillin. The plate was inverted and incubated at 37 ℃ overnight. The next day, single clones were picked and sequenced for validation. The sequencing result shows that: the gene sequence of the mutant Tn5 transposase synthesized by the invention is shown in SEQ NO.2, and the amino acid sequence is shown in SEQ NO. 1.

Example 2: testing the stability of the sample preservative fluid

The specimen preservation solution of the present invention includes: Tris-HCl100mM, PH 8.0, guanidine hydrochloride 3M, cobalt chloride 2mM, EDTA.2Na 0.2M, Triton X-1001%, sodium deoxycholate 1 mM.

Putting normal human throat swab specimens into the specimen preservation solution and the commercially sold specimen preservation solution, wherein one group is stored at 4 ℃ for 24 hours, the other group is stored at 56 ℃ for 1 hour, and then extracting RNA by using a conventional experimental method to obtain results shown in figures 3 and 4, wherein figure 3 shows that the specimens are stored at 4 ℃ for 24 hours, the first 3 holes are placed in the specimen preservation solution, and the second 3 holes are placed in the commercially sold specimen preservation solution; FIG. 4 shows the storage at 56 ℃ for 1 hour, the first 2 wells being in the specimen preservation solution of the present invention, and the last 3 wells being in a commercially available specimen preservation solution.

After the sample is stored for 24 hours at 4 ℃, the nucleic acid of the commercially available sample storage solution starts to degrade, three mRNA bands start to disperse, and the sample storage solution of the invention has complete bands; nucleic acid was severely degraded in the commercially available sample preservation solution at 56 ℃ for 1 hour, whereas the sample preservation solution of the present invention had intact bands. The sample preservation solution can prevent RNA from being degraded after being preserved for 1 hour at 56 ℃, and at the temperature, a plurality of samples containing viruses can be heated to 56 ℃ for sterilization and then be subjected to subsequent experiments, thereby being beneficial to protecting experimenters.

Example 3: DNA/RNA rapid co-library construction based on mutant Tn5 transposase

The core of this example lies in the rapid co-library construction of DNA/RNA, and the Reverse Transcriptase used in this example is HiScript III Reverse Transcriptase (cat # R302) of Nanjing Novozam Biotechnology Ltd; the reverse transcription reaction buffer solution used is a buffer solution attached to HiScript III ReverseTranscriptase of Biotechnology Limited of Nanjing NuoZan; the reverse transcription primer used was oligo (dT)₂₀VN and a mixture of random primers; tn5 transposases D24E, D97E, K160R and E326DMutant mutants, i.e.: TTE-plus. The breaking Buffer solution is a TTBL component in a TruePrep DNA library Prep Kit V2for Illumina Kit of limited biological technology of Nanjing Novowed Torran, namely TruePrep tag Buffer L; disruption of termination buffer 5 × TS-plus, comprising: 2.5% BSA, 1% Tween-20, 0.5% SDS, 25mM DTT; the RNA purification magnetic beads are RNA purification magnetic beads VAHTS RNA clean beads of Nanjing Novozam biotechnology limited; the DNA purification magnetic beads are DNA purification magnetic beads VAHTS DNA clean beads of Nanjing Novozam biotechnology limited; the nuclease-free water is double distilled water sterilized after DEPC treatment; the strand displacement and amplification enzyme mixture is a mixture of Bst DNA polymerase and Phanta high fidelity DNA polymerase (Nanjing Nodezam Biotech, Inc., Cat. P505); the amplification buffer is 5 XTAB component in the Kit TruePrep DNAlibrary Prep Kit V2for Illumina of Nanjing Novowed Toxon Biotech Co., Ltd, namely TruePrep amplifyBuffer. The amplification primer is TruePrep Index Kit for Illumina Kit of Nanjing Novozam Biotechnology Ltd, cat # TD 202. In this embodiment, a reaction template is a mixture of DNA and RNA extracted from 100ng of human HEK293 cells, and the library construction process is as follows:

1. reverse transcription reaction

(1) Denaturation of RNA template

The following mixture was prepared in RNase-free centrifuge tubes as described in Table 1 below:

[ TABLE 1 ]

Components	Volume of
		Rnase-free ddH₂O	To 8μl
DNA/RNA mixtures	100ng

Heating at 65 deg.C for 5min opens the secondary structure of RNA, rapidly placing on ice for quenching, and standing on ice for 2 min.

(2) Reverse transcription reaction systems were prepared as shown in table 2:

[ TABLE 2 ]

Gently pipetting and mixing.

(3) The reverse transcription reaction conditions are shown in Table 3:

[ TABLE 3 ]

25℃	5min
		37℃	15min
85℃	5sec

Tn5 transposase fragmentation reaction (1) fragmentation reaction systems were formulated as shown in table 4: [ TABLE 4-1 ] Experimental group-sample mixing system

Components	Volume of
		5×TTBL	10μl
Reaction product of the last step	20μl
		TTE-plus	5μl
Rnase-free ddH₂O	15μl

[ TABLE 4-2 ] control group-mixed sample system

Note: TTE-plus is mutant Tn5 transposase with simultaneous mutation of D24E, D97E, K160R and E326D, and the final concentration in the reaction system is 5 ng/ul;

TTE is mutant Tn5 transposase with simultaneous mutation of D97E and E326D, the final concentration in the reaction system is 5ng/ul, and the TTE is obtained from the patent of 'a mutant Tn5 transposase and a preparation method and application thereof', the application number is: 201611196754.4.

in the step, an experimental group is interrupted by TTE-plus, a control group is interrupted by TTE, a parallel experiment is carried out, and the interruption efficiency is compared.

Gently flick 20 times by using a pipette and mix well.

(2) The fragmentation reaction conditions are shown in Table 5

[ TABLE 5 ]

55℃	15min
		10℃	Hold

Experiment group two: immediately after completion of the reaction, 5. mu.l of 5 XTS-plus (2.5% BSA, 1% Tween-20, 0.5% SDS, 25mM DTT) was added to the product of the first experimental group (interrupted by TTE-plus) and gently pipetted to mix well.

Control group two: immediately after completion of the reaction, a common disruption stop buffer such as the TS fraction of the TruePrep DNA library KitV 2for Illumina kit of Nanjing Novophilia Biotech Ltd was added to the product of the test group one (TTE-plus disruption), and gently pipetted and mixed well.

3. Purification of the product

(1) Vortex to mix well the VAHTS RNA Clean Beads, pipette 60. mu.l (1.2X) into the product from the previous step, and gently pipette 10 times to mix well. The incubation was performed at room temperature for 5min to allow the nucleic acid to bind to the magnetic beads.

(2) The sample was placed on a magnetic stand and after the solution cleared (about 5min), the supernatant was carefully removed;

(3) keeping the sample on the magnetic stand all the time, add 200 μ l of freshly prepared 80% ethanol to rinse the beads, incubate for 30sec at room temperature, carefully remove the supernatant.

(4) Repeating the step (3) and rinsing twice in total.

(5) Keeping the reaction tube on the magnetic frame all the time, opening the cover and drying in air for about 5 min.

(6) The reaction tube was removed from the magnetic holder and eluted with 25. mu.l of sterilized ultrapure water. Vortexing or blowing and beating for 10 times by using a pipette, and fully mixing, and incubating for 5min at room temperature.

(7) The reaction tube was briefly centrifuged and placed on a magnetic stand to separate the magnetic beads from the liquid, and after the solution cleared (about 5min), 23 μ l of the supernatant was carefully pipetted into a fresh sterile PCR tube.

4. Strand displacement and library amplification

(1) Preparation of Strand Displacement and library amplification reaction systems as shown in Table 6

[ TABLE 6 ]

Gently flick and mix with a pipette.

(2) Strand displacement and library amplification reaction conditions

The following table 7 procedure was run in the PCR instrument with the hot lid set at 105 ℃.

[ TABLE 7 ]

5. Amplification product purification

(1) Vortex to mix well the VAHTS DNA Clean Beads, pipette 60. mu.l (1.2X) into the product from the previous step, and pipette gently 10 times to mix well. The incubation was performed at room temperature for 5min to allow the nucleic acid to bind to the magnetic beads.

(4) Repeating the step (3) and rinsing twice in total.

(6) The reaction tube was removed from the magnetic holder and eluted with 22. mu.l of sterilized ultrapure water. Vortexing or blowing and beating for 10 times by using a pipette, and fully mixing, and incubating for 5min at room temperature.

(7) The reaction tube was briefly centrifuged and placed on a magnetic rack to separate the magnetic beads from the liquid, and after the solution cleared (about 5min) 20. mu.l of the supernatant was carefully pipetted into a fresh sterile PCR tube.

6.Qubit detection of library concentration

The concentration of the obtained library is measured by using the Qubit, the library yield is calculated, and the library yields shown in Table 8 are obtained by TS-plus termination and TS termination, so that the TS-plus termination effect is better, and the obtained yield is more.

[ TABLE 8 ]

7. The libraries disrupted by TTE-plus Tn5 transposase in the experimental group and by TTE Tn5 transposase in the control group were run on 2% electrophoresis gel to obtain the results shown in FIG. 7, where 4m is the library disrupted by TTE-plus Tn5 transposase in the experimental group and 2m is the library disrupted by TTE Tn5 transposase in the control group, it can be seen that TTE-plus Tn5 transposase (mutated at D24E, D97E, K160R and E326D) was smaller than the fragments of TTE Tn5 transposase (mutated at D97E and E326D) and better in breaking the cDNA hybrid chain.

8. Evaluation of library quality with Agilent 2100Bioanalyzer

Mu.l of the purified PCR product was analyzed using Agilent DNA 1000kit (Agilent, Cat. No.5067-1504) to obtain the results shown in FIGS. 5 and 6, wherein FIG. 5 shows the Agilent 2100 library peak pattern of the library terminated with TS-plus (Experimental group II), and FIG. 6 shows the Agilent 2100 library peak pattern of the terminated with TS group (control group II). As can be seen from the 2100 plots and the resulting library yields (Table 8), co-pooling of DNA and RNA using this protocol resulted in higher library yields and 2100 peak patterns consistent with those obtained from conventional pooling.

9. Sequencing on an Illumina platform and analyzing data to obtain the data in the following table 9.

[ TABLE 9 ] specific sequencing data cases

Type	Raw data	Clean data
			Number of Reads	109238414	95555766
Data Size	16385762100	14333364900
			GC(％)	41.14	40.82
Q20(％)	96.76	96.62
			Q30(％)	92.73	92.48
Discard Reads related to Adapter	13672692
			Clean Rate	87.47％
Mapping Rate		81.48％
			Duplicate Rate		15.47％
Average sequencing depth		3.36
			Coverage		95.6％
Expression of gene factors		24501

As is clear from the data in Table 9, the library obtained by the DNA/RNA pooling process is high in quality and good in data uniformity, from the information of Reads number, GC content, Q20, Q30, Clean Rate, Mapping Rate, replication Rate, Average sequencing depth, Coverage, expression gene factor, and the like.

This step of purification of the product of step 3 of this example can be omitted, without having a significant effect on the results.

Example 4: rapid and simple sequencing library construction method for pathogenic microorganism detection

The specimen preservation solution used in this example includes: Tris-HCl100mM, pH 8.0, guanidine hydrochloride 3M, chlorineCobalt oxide 2mM, EDTA.2Na 0.2M, Triton X-1001%, sodium deoxycholate 1 mM; the nucleic acid extraction reagent is a magnetic bead method virus DNA/RNA extraction reagent of Nanjing Novozan Biotechnology GmbH, with a cargo number of RM 101; the rRNA removal reagent used was Ribo-off rRNA deletion Kit (Human/Mouse/Rat) (cat # N406) from Biotech, Inc. of Nanjing Novozam; the reverse transcriptase used was HiScript III ReverseTranscriptase (cat # R302) of Biotech, Inc. of Nanjing Novozam; the Reverse transcription reaction buffer solution used is a buffer solution attached by HiScript III Reverse Transcriptase Transcriptase of Nanjing Novowed Biotechnology Limited; the reverse transcription primer used was oligo (dT)₂₀VN and a mixture of random primers; the Tn5 transposase is a mutant of simultaneous mutations of D24E, D97E, K160R and E326D, namely: TTE-plus. The breaking Buffer solution is a TTBL component in a TruePrep DNA library Prep KitV 2for Illumina kit of Nanjing Novowed Torazan Biotech limited, namely TruePrep tag Buffer L; disruption of termination buffer 5 × TS-plus, comprising: 2.5% BSA, 1% Tween-20, 0.5% SDS, 25mM DTT; the RNA purification magnetic beads are RNA purification magnetic beads VAHTS RNA clean beads of Nanjing Novozam biotechnology limited; the DNA purification magnetic beads are DNA purification magnetic beads VAHTS DNA clean beads of Nanjing Novozam biotechnology limited; the nuclease-free water is double distilled water sterilized after DEPC treatment; the strand displacement and amplification enzyme mixture is a mixture of Bst DNA polymerase and Phanta high fidelity DNA polymerase (Nanjing Nodezam Biotech, Inc., Cat. P505); the amplification Buffer is 5 XTAB component in TruePrep DNA library Prep Kit V2for Illumina Kit of Nanjing Novowed Torazan Biotech Co., Ltd, namely TruePrep amplification Buffer. The amplification primer is TruePrep Indexkit for Illumina kit of Nanjing Novozam Biotech Co., Ltd, cat # TD 202.

In this embodiment, 1 normal human throat swab specimen is used as a sample for detecting pathogenic microorganisms, and the library construction process specifically includes:

1. sample collection and preservation:

repeatedly scraping by using a swab at the deep part of the angina (two sides of the uvula and the tonsil) to obtain a sample;

immersing the swab head into the sample preservation solution, breaking off the tail part, discarding, screwing the tube cover, and packaging in a disposable self-sealing bag for convenient transportation and preservation;

2. nucleic acid extraction:

pre-packaging 20 μ L of proteinase K into a new 1.5mL nuclease-free EP tube, adding 600 μ L of the above sample preservative solution and 300 μ L of anhydrous ethanol, slightly vortexing or mixing up and down, adding 20 μ L of magnetic beads, vortexing and mixing for 15 sec, incubating for 5min at room temperature, and mixing up and down for 2 times. After instantaneous centrifugation, the EP tube was placed on a magnetic stand, left to stand for 1min and the supernatant was discarded. Then, according to the procedures of RM101 extraction kit, 700. mu.L of the washing solution and 700. mu.L of the rinsing solution were used for washing, respectively, and then the nucleic acid was recovered by using the eluent into a new 1.5mL nuclease-free centrifuge tube.

rRNA removal:

(1) a part of the nucleic acid is taken out for use.

(2) In a nucleic-free PCR tube, 100ng of total nucleic acid was diluted to 11. mu.l with nucleic-free water and placed on ice until use.

(3) Hybridization reactions were prepared as in Table 10, and the designed DNA probes were specifically matched to rRNA.

[ TABLE 10 ]

Components	Volume of
		rRNA Probe(H/M/R)	1μl
Probe buffer	3μl
		Total nucleic acids	11μl

(4) Hybridization reaction conditions are given in Table 11

[ TABLE 11 ]

95℃	2min
		95-22℃	0.1℃/sec
22℃	5min

(5) Digestion reactions, specifically as shown in Table 12, RNase H recognizes the DNA/RNA hybrid strand and cleaves the RNA strand therein.

[ TABLE 12 ]

Components	Volume of
		RNase H Buffer	4μl
RNase H	1μl
		The product of the last step	15μl

The reaction was carried out at 37 ℃ for 30 min.

(6) DNase I digestion reactions, DNase I removed DNA probes as in Table 13.

[ TABLE 13 ]

Components	Volume of
		DNase I Buffer	29μl
DNase I	1μl
		The product of the last step	20μl

The reaction was carried out at 37 ℃ for 30 min.

(7) Use of

XP purified Ribosol-deplated RNA

7.1. Vortex oscillation mixing

XP Beads, pipette 110. mu.l (2.2X) into the RNA sample from step up and pipette 10 times to mix thoroughly.

7.2. The mixture was allowed to stand on ice for 15 minutes to bind the RNA to the magnetic beads.

7.3. The sample was placed on a magnetic stand for 5 minutes and after the solution cleared, the supernatant was carefully removed.

7.4. Keeping the sample in the magnetic stand all the time, add 200 μ l of freshly prepared 80% ethanol to rinse the beads (care not to blow the beads apart), incubate at room temperature for 30 seconds, carefully remove the supernatant.

7.5. The previous step was repeated for a total of 2 rinses.

7.6. Keeping the sample in the magnetic rack all the time, opening the cover and drying the magnetic beads in air for 5-10 minutes.

7.7. The sample was taken out from the magnetic holder, 10.5. mu.l of clean-free water was added, and the mixture was thoroughly mixed by pipetting 6 times, and allowed to stand at room temperature for 2 minutes. After the solution was clarified, 8. mu.l of the supernatant was carefully pipetted into a new Nuclean-free PCR tube.

4. Reverse transcription reaction

(1) Denaturation of RNA template

The following mixture was prepared in RNase-free centrifuge tubes as follows 14:

[ TABLE 14 ]

Components	Volume of
		Rnase-free ddH₂O	To 8μl
DNA/RNA mixtures	100ng

(2) Reverse transcription reaction System is prepared as shown in Table 15

[ TABLE 15 ]

Components	Volume of
		The mixed liquid of the last step	8μl
10×RT Mix	2μl
		HiScript III Enzyme Mix	2μl
Oligo(dT)₂₀VN	0.5μl
		Random Primer	0.5μl
Rnase-free ddH₂O	7μl

Gently pipetting and mixing.

(3) Reverse transcription conditions are shown in Table 16

[ TABLE 16 ]

Tn5 transposase fragmentation reaction

(1) Fragmentation reaction systems were formulated as in Table 17

[ TABLE 17 ]

Components	Volume of
		5×TTBL	10μl
Reaction product of the last step	20μl
		Original nucleic acid template	5μl
TTE-plus	5μl
		Rnase-free ddH₂O	10μl

Note: TTE-plus is a mutant Tn5 transposase with simultaneous mutations of D24E, D97E, K160R and E326D, and the final concentration in the reaction system is 5 ng/ul.

Gently flick 20 times by using a pipette and mix well.

(2) The fragmentation reaction conditions are shown in Table 18

[ TABLE 18 ]

55℃	15min
		10℃	Hold

Immediately after completion of the reaction, 5. mu.l of 5 XTS-plus (2.5% BSA, 1% Tween-20, 0.5% SDS, 25mM DTT) was added to the product, and gently shaken using a pipette and thoroughly mixed.

6. Purification of the product

(1) Vortex to mix well VAHTS RNA Clean Beads, pipette 60. mu.l (1.2X) into the product of the previous step, and pipette gently 10 times to mix well. The incubation was performed at room temperature for 5min to allow the nucleic acid to bind to the magnetic beads.

(4) Repeating the step (3) and rinsing twice in total.

7. Strand displacement and library amplification

(1) Preparation of Strand Displacement and library amplification reaction systems as shown in Table 19

[ TABLE 19 ]

Gently flick and mix with a pipette.

(2) Strand displacement and library amplification reaction conditions

The following table 20 procedure was run in a PCR instrument with the hot lid set at 105 ℃.

[ TABLE 20 ]

8. Amplification product purification

(1) Vortex to mix well VAHTS DNA Clean Beads, pipette 60. mu.l (1.2X) into the product of the previous step, and pipette gently 10 times to mix well. The incubation was performed at room temperature for 5min to allow the nucleic acid to bind to the magnetic beads.

(4) Repeating the step (3) and rinsing twice in total.

Qubit assay library concentration

The resulting library was subjected to concentration determination using Qubit and library yield was calculated, with a resulting library concentration of 52 ng/. mu.l and a total library yield of 1040 ng.

10. Evaluation of library quality with Agilent 2100Bioanalyzer

Mu.l of the purified PCR product was analyzed using Agilent DNA 1000kit (Agilent, Cat. No.5067-1504), and the results shown in FIG. 8 were obtained.

According to the 2100 graph and the obtained library concentration, the scheme is used for carrying out the common library building of the DNA and the RNA of the pathogenic microorganism, the obtained library concentration is higher, and the 2100 peak pattern is consistent with that of the library obtained by the traditional library building.

11. Sequencing on the Illumina platform and analyzing the data to obtain the data in table 21 and table 22.

Table 21: specific sequencing data Condition

[ TABLE 22 ]

Partially detected pathogenic microorganism	Reads number
		Oral streptococcus	42
Light streptococcus	6
		Staphylococcus aureus	251
Genus Streptococcus	1531
		Streptococcus pneumoniae	15
Acanthamoeba	101
		Haemophilus influenzae	5
Klebsiella pneumoniae	4
		Corynebacterium propionate	15
Corynebacterium crowding	33

Table 21 is the alignment of the data obtained by sequencing with the known data from humans; table 22 shows the results of comparing the data obtained by sequencing with the known data of various pathogenic microorganisms, wherein the numbers of Reads are not zero, which indicates that the gene sequences of the pathogenic microorganisms are detected in the sample. As can be seen from the data in tables 21 and 22, from the readings number, GC content, Q20, Q30, Clean Rate, Mapping Rate, replication Rate, the number of detected species, and the Reads number of pathogenic microorganisms in the library, the library obtained by the pathogenic microorganism library detection process has high quality and the pathogenic detection Rate is high.

Example 5: rapid and simple sequencing library construction method for pathogenic microorganism detection

The specimen preservation solution used in this example includes: 100mM Tris-HCl, 8.0 PH, 3M guanidine hydrochloride, 2mM cobalt chloride, 0.2M EDTA.2Na, 1mM sodium deoxycholate, and Triton X-1001%; the nucleic acid extraction reagent is a DNA/RNA extraction reagent of a column-type virus of Nanjing Nodezan Biotechnology limited company, a cargo number RC 311; the rRNA removal reagent used was Ribo-off Beads rRNA deletion Kit (Human/Mouse/Rat) (cat # N416) of Nykino Tenza Biotech Co., Ltd; the reverse transcriptase used was Nanjing Novozam BiotechHiScript III ReverseTranscriptase (cat # R302); the Reverse transcription reaction buffer solution used is a buffer solution attached by HiScript III Reverse Transcriptase Transcriptase of Nanjing Novowed Biotechnology Limited; the reverse transcription primer used was oligo (dT)₂₀VN; the Tn5 transposase is a mutant of simultaneous mutations of D24E, D97E, K160R and E326D, namely: TTE-plus; the breaking Buffer solution is a TTBL component in a TruePrep DNA library Prep Kit V2for Illumina Kit of Nanjing Novowed Torazan Biotech limited, namely TruePrep tag Buffer L; disruption of termination buffer 5 × TS-plus, comprising: 2.5% BSA, 1% Tween-20, 0.5% SDS, 25mM DTT; the DNA purification magnetic beads are DNA purification magnetic beads VAHTS DNA clean beads of Nanjing Novozam biological technology Limited; the nuclease-free water is double distilled water sterilized after DEPC treatment; the strand displacement and amplification enzyme mixture is a mixture of Bst DNA polymerase and VAHTS HiFi high fidelity DNA polymerase (Nanjing Nodezam Biotech Co., Ltd., Cat. N616). The amplification primer is TruePrep Index Kit for Illumina Kit of limited Biotechnology of Nanjing Novozam, cat # TD 203.

In this embodiment, 1 part of human sputum specimen is used as a sample for detecting pathogenic microorganisms, and the library construction process is as follows:

1. sample collection and preservation:

directly cough the sputum into a 50ml centrifuge tube containing a sample preservation solution after the deep cough, tightly screwing a tube cover, gently mixing the sputum and the sample preservation solution, and packaging the sputum in a disposable self-sealing bag for convenient transportation and preservation;

2. nucleic acid extraction:

packaging 200 μ L of anhydrous ethanol into new 1.5mL nuclease-free EP tube, adding 500 μ L of the above sample preservative solution, turning upside down, mixing, adding all the mixed solution into adsorption column (the adsorption column is placed in 2mL collection tube), covering tube cover, and centrifuging for 1min at 12,000 Xg; discard the filtrate and operate according to the instructions of the extraction kit, rinse 2 times with 600. mu.L of rinse solution, recover nucleic acids using the eluent into a 1.5mL collection tube (provided by the kit).

rRNA removal:

3.1 magnetic bead washing: magnetic Beads were vortexed and pipetted down 225. mu.L to 1.5ml RNase-Free sterile tubes. The beads were placed on a magnetic stand for 1min and after the solution cleared, the supernatant was carefully removed with a pipette. The beads were washed with an additional 225. mu.L of Resuspension Solution and gently pipetted several times. The beads were placed on a magnetic stand for 1min and after the solution cleared, the supernatant was carefully removed with a pipette. After repeated washing, 65 μ L of Resuspension Solution was added to mix the beads well, and 1 μ L of RNase Inhibitor was added to mix well and the mixture was kept at room temperature for later use.

3.2 hybridization of Probe to rRNA: the following system 23 was prepared

[ TABLE 23 ]

Gently blowing and beating for 10 times by using a pipette gun, mixing uniformly, centrifuging instantaneously, reacting for 10min at 68 ℃, and reacting for 5min at 25 ℃.

3.3rRNA removal: mu.l of the RNA-Probe reaction solution was transferred to 65. mu.l of washed Magnetic Beads, and the mixture was pipetted and mixed 10 times. Incubation was carried out at 25 ℃ for 5min and at 50 ℃ for 10 min. And in the period, the mixture is slightly flicked and mixed for many times, so that the magnetic beads are prevented from settling. Immediately placing on a magnetic frame, opening the tube orifice, and clarifying the liquid after 1 min. Pipette 90-100. mu.l of RNA-containing supernatant into a new tube and place on ice.

3.4RNA purification

(1) VAHTS RNA Clean Beads were vortexed and 100. mu.l of the RNA product from the previous step was pipetted up to 220. mu.l (about 2.2-fold volume) and mixed 10 times by pipetting.

(2) The mixture was kept on ice for 15min to allow the RNA to bind well to the beads.

(3) The sample was placed on a magnetic stand for 2min and after the solution cleared, the supernatant was carefully removed with a pipette.

(4) The sample was kept on the magnetic stand, the beads were rinsed by adding 400 μ l of freshly prepared 80% ethanol, incubated at room temperature for 30sec, and the supernatant carefully removed.

(5) And 4, repeating the step 4 for rinsing.

(6) The sample was returned to the magnetic rack and all liquid was carefully discarded with a pipette.

(7) Keeping the sample on the magnetic frame all the time, opening the cover and drying the magnetic beads for 3-5 min

(8) The sample was removed from the magnetic frame and 10. mu.l of RNase-free ddH was added₂And O, blowing and beating the magnetic beads for 10 times by using a liquid transfer machine, uniformly mixing the magnetic beads, and standing for 2min at room temperature.

(9) Standing on a magnetic frame for 2min, after the solution is clarified, carefully pipetting 8. mu.l of the supernatant into the next step without touching the beads.

4. Reverse transcription reaction:

(1) denaturation of RNA template

The following mixture was prepared in RNase-free centrifuge tubes as follows:

[ TABLE 24 ]

Heating at 65 deg.C for 5min, rapidly cooling on ice, and standing on ice for 2 min.

(2) Reverse transcription reaction System was prepared as shown in Table 25

[ TABLE 25 ]

Components	Volume of
		The mixed liquid of the last step	8μl
10×RT Mix	2μl
		HiScript III Enzyme Mix	2μl
Oligo(dT)₂₀VN	1μl
		Rnase-free ddH₂O	7μl

Gently pipetting and mixing.

(3) Reverse transcription conditions are shown in Table 26

[ TABLE 26 ]

25℃	5min
		37℃	15min
85℃	5sec

Tn5 transposase fragmentation reaction

(1) Preparation of fragmentation reaction systems, see Table 27

[ TABLE 27 ]

TTE-plus is mutant Tn5 transposase with simultaneous mutation of D24E, D97E, K160R and E326D, and the final concentration in the reaction system is 5 ng/ul;

gently flick 20 times by using a pipette and mix well.

(2) The fragmentation reaction conditions are shown in Table 28

[ TABLE 28 ]

55℃	15min
		10℃	Hold

6. Strand displacement and library amplification

(1) Preparation of the strand displacement and library amplification reaction systems shown in Table 29

[ TABLE 29 ]

Components	Volume of
		Reaction product of the last step	50μl
4×VAHTS HiFi Amplification Mix	25μl
		N5XX (Nuo Wei Zan goods number TD202)	10μl
N7XX (Nuo Wei Zan cargo number TD202)	10μl
		Strand displacement and amplification enzyme mixture	2μl
Rnase-free ddH₂O	3μl

Gently flick and mix with a pipette.

(2) Strand displacement and library amplification reaction conditions

The following table 30 procedure was run in a PCR instrument with the hot lid set at 105 ℃.

[ TABLE 30 ]

7. Amplification product purification

(1) Vortex to mix well the VAHTS DNA Clean Beads, pipette 120. mu.l (1.2X) into the product from the previous step, and pipette gently 10 times to mix well. The incubation was performed at room temperature for 5min to allow the nucleic acid to bind to the magnetic beads.

(3) the sample was kept on the magnetic stand, the beads were rinsed by adding 200. mu.l of freshly prepared 80% ethanol, incubated at room temperature for 30sec, and the supernatant carefully removed.

(4) Repeating the step (3) and rinsing twice in total.

Qubit assay library concentration

The resulting library was subjected to concentration determination using Qubit and library yield was calculated to be 93 ng/. mu.l for a total library yield of 1860 ng.

9. Evaluation of library quality with Agilent 2100Bioanalyzer

Mu.l of the purified PCR product was analyzed using Agilent DNA 1000kit (Agilent, Cat. No.5067-1504), and the results shown in FIG. 9 were obtained.

According to the 2100 picture and the obtained library concentration, the scheme is used for carrying out the common library building of DNA and RNA, the obtained library concentration is higher, and the 2100 peak pattern is consistent with that of the library obtained by the traditional library building.

Sequence listing

<110> Nanjing Nodezan Biotech Co., Ltd

<120> sequencing library construction method and kit for pathogenic microorganism detection

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>475

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Met Ile Thr Ser Ala Leu His Arg Ala Ala Asp Trp Ala Lys Ser Val

1 5 10 15

Phe Ser Ser Ala Ala Leu Gly Glu Pro Arg Arg Thr Ala Arg Leu Val

20 25 30

Asn Val Ala Ala Gln Leu Ala Lys Tyr Ser Gly Lys Ser Ile Thr Ile

35 40 45

Ser Ser Glu Gly Ser Glu Ala Met Gln Glu Gly Ala Tyr Arg Phe Tyr

50 55 60

Arg Asn Pro Asn Val Ser Ala Glu Ala Ile Arg Lys Ala Gly Ala Met

65 70 75 80

Gln Thr Val Lys Leu Ala Gln Glu Phe Pro Glu Leu Leu Ala Ile Glu

85 90 95

Glu Thr Thr Ser Leu Ser Tyr Arg His Gln Val Ala Glu Glu Leu Gly

100 105 110

Lys Leu Gly Ser Ile Gln Asp Lys Ser Arg Gly Trp Trp Val His Ser

115 120 125

Val Leu Leu Leu Glu Ala Thr Thr Phe Arg Thr Val Gly Leu Leu His

130 135 140

Gln Glu Trp Trp Met Arg Pro Asp Asp Pro Ala Asp Ala Asp Glu Arg

145 150 155 160

Glu Ser Gly Lys Trp Leu Ala Ala Ala Ala Thr Ser Arg Leu Arg Met

165 170 175

Gly Ser Met Met Ser Asn Val Ile Ala Val Cys Asp Arg Glu Ala Asp

180 185 190

Ile His Ala Tyr Leu Gln Asp Arg Leu Ala His Asn Glu Arg Phe Val

195 200 205

Val Arg Ser Lys His Pro Arg Lys Asp Val Glu Ser Gly Leu Tyr Leu

210 215 220

Ile Asp His Leu Lys Asn Gln Pro Glu Leu Gly Gly Tyr Gln Ile Ser

225 230 235 240

Ile Pro Gln Lys Gly Val Val Asp Lys Arg Gly Lys Arg Lys Asn Arg

245 250 255

Pro Ala Arg Lys Ala Ser Leu Ser Leu Arg Ser Gly Arg Ile Thr Leu

260 265 270

Lys Gln Gly Asn Ile Thr Leu Asn Ala Val Leu Ala Glu Glu Ile Asn

275 280 285

Pro Pro Lys Gly Glu Thr Pro Leu Lys Trp Leu Leu Leu Thr Gly Glu

290 295 300

Pro Val Glu Ser Leu Ala Gln Ala Leu Arg Val Ile Asp Ile Tyr Thr

305 310 315 320

His Arg Trp Arg Ile Asp Glu Phe His Lys Ala Trp Lys Thr Gly Ala

325 330 335

Gly Ala Glu Arg Gln Arg Met Glu Glu Pro Asp Asn Leu Glu Arg Met

340 345 350

Val Ser Ile Leu Ser Phe Val Ala Val Arg Leu Leu Gln Leu Arg Glu

355 360 365

Ser Phe Thr Pro Pro Gln Ala Leu Arg Ala Gln Gly Leu Leu Lys Glu

370 375 380

Ala Glu His Val Glu Ser Gln Ser Ala Glu Thr Val Leu Thr Pro Asp

385 390 395 400

Glu Cys Gln Leu Leu Gly Tyr Leu Asp Lys Gly Lys Arg Lys Arg Lys

405 410 415

Glu Lys Ala Gly Ser Leu Gln Trp Ala Tyr Met Ala Ile Ala Arg Leu

420 425 430

Gly Gly Phe Met Asp Ser Lys Arg Thr Gly Ile Ala Ser Trp Gly Ala

435 440 445

Leu Trp Gly Trp Glu Ala Leu Gln Ser Lys Leu Asp Gly Phe Leu Ala

450 455 460

Ala Lys Asp Leu Met Ala Gln Gly Ile Lys Ile

465 470 475

<210>2

<211>1429

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

atgataactt ctgctcttca tcgtgcggcc gactgggcta aatctgtgtt ctcttcggcg 60

gcgctgggtg agcctcgccg tactgcccgc ttggttaacg tcgccgccca attggcaaaa 120

tattctggta aatcaataac catctcatca gagggtagtg aagccatgca ggaaggcgct 180

taccgatttt accgcaatcc caacgtttct gccgaggcga tcagaaaggc tggcgccatg 240

caaacagtca agttggctca ggagtttccc gaactgctgg ccattgagga aaccacctct 300

ttgagttatc gccaccaggt cgccgaagag cttggcaagc tgggctctat tcaggataaa 360

tcccgcggat ggtgggttca ctccgttctc ttgctcgagg ccaccacatt ccgcaccgta 420

ggattactgc atcaggagtg gtggatgcgc ccggatgacc ctgccgatgc ggatgaaagg 480

gagagtggca aatggctggc agcggccgca actagccggt tacgcatggg cagcatgatg 540

agcaacgtga ttgcggtctg tgaccgcgaa gccgatattc atgcttatct gcaggacagg 600

ctggcgcata acgagcgctt cgtggtgcgc tccaagcacc cacgcaagga cgtagagtct 660

gggttgtatc tgatcgacca tctgaagaac caaccggagt tgggtggcta tcagatcagc 720

attccgcaaa agggcgtggt ggataaacgc ggtaaacgta aaaatcgacc agcccgcaag 780

gcgagcttga gcctgcgcag tgggcgcatc acgctaaaac aggggaatat cacgctcaac 840

gcggtgctgg ccgaggagat taacccgccc aagggtgaga ccccgttgaa atggttgttg 900

ctgaccggcg aaccggtcga gtcgctagcc caagccttgc gcgtcatcga catttatacc 960

catcgctggc ggatcgacga gttccataag gcatggaaaa ccggagcagg agccgagagg 1020

caacgcatgg aggagccgga taatctggag cggatggtct cgatcctctc gtttgttgcg 1080

gtcaggctgt tacagctcag agaaagcttc acgccgccgc aagcactcag ggcgcaaggg 1140

ctgctaaagg aagcggaaca cgtagaaagc cagtccgcag aaacggtgct gaccccggat 1200

gaatgtcagc tactgggcta tctggacaag ggaaaacgca agcgcaaaga gaaagcaggt 1260

agcttgcagt gggcttacat ggcgatagct agactgggcg gttttatgga cagcaagcga 1320

accggaattg ccagctgggg cgccctctgg taaggttggg aagccctgca aagtaaactg 1380

gatggctttc ttgccgccaa ggatctgatg gcgcagggga tcaagatct 1429

Claims

1. A sequencing library construction method for pathogenic microorganism detection is characterized by comprising the following steps:

2. The method of claim 1, wherein the sample preservation solution in the step (1) comprises: Tris-HCl10 mM-2M, PH 7.0-9.0, guanidine hydrochloride 0.1M-8M, cobalt chloride 0.5-10mM, EDTA.2Na 0.1M-2M, Triton X-1000.1% -5%, sodium deoxycholate 0.1 mM-4M; preferably, it comprises: 50mM-200mM of Tris-HCl, 7.0-9.0 pH, 1M-5M of guanidine hydrochloride, 1-4mM of cobalt chloride, 0.1M-0.5M of EDTA.2Na, 0.5 mM-2% of Triton X-1000.5%, and 0.5mM-2M of sodium deoxycholate; further preferably, the composition comprises 100mM Tris-HCl, 8.0 pH guanidine hydrochloride, 2mM cobalt chloride, 0.2M EDTA.2Na, 1001% Triton X and 1mM sodium deoxycholate.

3. The method of claim 1, wherein the sample of step (1) is a nasopharyngeal swab, an oral swab, sputum, alveolar lavage fluid, pleural effusion, cerebrospinal fluid, serum, plasma, blood, urine, or stool; preferably, the sample is placed in the sample preservation solution and then heated at 50-56 ℃ for 0.5-1 hour.

4. The method for constructing a sequencing library for detecting pathogenic microorganisms according to claim 1, wherein the amino acid sequence of mutant Tn5 transposase in step (3) is shown as SEQ ID No. 1; the final concentration of mutant Tn5 transposase after incorporation into the disruption system can be 1-50ng/ul, preferably 1-20ng/ul, more preferably 1-10ng/ul, and most preferably, the final concentration of mutant Tn5 transposase after incorporation into the disruption system is 5 ng/ul.

5. The method of claim 1, wherein the termination reaction solution 5 × TS-plus used in the step (3) comprises: 0.1% -5% BSA, 0.05% -2% Tween-20, 0.1-1% SDS, 1mM-50mM DTT; preferably, it comprises: 2% -3% BSA, 0.05% -1.5% Tween-20, 0.1-1% SDS, 20mM-30mM DTT; in a specific embodiment, 2.5% BSA, 1% Tween-20, 0.5% SDS, 25mM DTT is included.

6. The method of claim 1, wherein the mixture of the cDNA/RNA complex duplex and the DNA duplex in step (3) is 0.1ng-1 μ g.

7. The method of claim 1, wherein after the termination reaction of step (3) inactivates the Tn5 transposase, the subsequent reaction is carried out with or without purification; it is preferable to proceed directly to the next reaction without purification.

8. A kit for sequencing library construction for detection of a pathogenic microorganism, the kit comprising the following components:

(1) a sample preservation solution;

(2) rRNA removal of fractions;

(5) strand displacement and library amplification components: comprises a mixture of strand displacement and amplification enzymes, an amplification buffer;

wherein, the sample preservation solution contains: Tris-HCl10 mM-2M, PH 7.0-9.0, guanidine hydrochloride 0.1M-8M, cobalt chloride 0.5-10mM, EDTA.2Na 0.1M-2M, Triton X-1000.1% -5%, sodium deoxycholate 0.1 mM-4M; preferably, it comprises: 50mM-200mM of Tris-HCl, 7.0-9.0 pH, 1M-5M of guanidine hydrochloride, 1-4mM of cobalt chloride, 0.1M-0.5M of EDTA.2Na0. 1000.5% -2%, and 0.5mM-2M of sodium deoxycholate; further preferred, Tris-HCl100mM, PH 8.0, guanidine hydrochloride 3M, cobalt chloride 2mM, edta.2na 0.2M, Triton X-1001%, sodium deoxycholate 1 mM;

the amino acid sequence of the mutant Tn5 transposase is shown in SEQ ID NO. 1;

the reaction mixture was terminated by 5 XTS-plus, which contained: 0.1% -5% BSA, 0.05% -2% Tween-20, 0.1-1% SDS, 1mM-50mM DTT; preferably, it comprises: 2% -3% BSA, 0.05% -1.5% Tween-20, 0.1-1% SDS, 20mM-30mM DTT; most preferably, it comprises 2.5% BSA, 1% Tween-20, 0.5% SDS, 25mM DTT.

9. A specimen preservation solution, comprising: Tris-HCl10 mM-2M, PH 7.0-9.0, guanidine hydrochloride 0.1M-8M, cobalt chloride 0.5-10mM, EDTA.2Na 0.1M-2M, Triton X-1000.1% -5%, sodium deoxycholate 0.1 mM-4M; preferably, it comprises: 50mM-200mM of Tris-HCl, 7.0-9.0 pH, 1M-5M of guanidine hydrochloride, 1-4mM of cobalt chloride, 0.1M-0.5M of EDTA.2Na0. 1000.5% -2%, and 0.5mM-2M of sodium deoxycholate; further preferably, the compound comprises Tris-HCl100mM, pH 8.0, guanidine hydrochloride 3M, cobalt chloride 2mM, EDTA.2Na 0.2M, and Triton X-1001%.

10. Use of the sample preservation solution according to claim 9 for preservation of a sample containing pathogenic microorganisms.