JP2001008680A - Synthesis of nucleic acid - Google Patents

Abstract

PROBLEM TO BE SOLVED: To attain high-sensitivity detection of infectious extraneous organisms without affection of a variety of organism-originating contaminants, even in the presence of them, by directly adding an animal body fluid to the reaction solution and amplifying the genes of extraneous organisms. SOLUTION: A specimen of animal body fluid, for example, blood, or specimens originating from blood, for example, plasma, serum or the like, is directly added to a reaction solution constituting a gene amplification reaction system that contains polyamine, sulfated polysaccharide, dithiothreitol or the like to amplify the genes of extraneous organisms, for example, DNA virus, RNA virus, retro virus, bacteria, fungi, protozoa, cells and the like, as the reaction solution for gene amplification is adjusted its pH to >=8.2 at 25 deg.C, >=7.4 at 55 deg.C, and/or >=7.1 at 70 deg.C whereby the exotic organisms that is infectious to the host can be simply, promptly and sensitively detected in the presence of a variety of contaminants originating form organisms and synthesizes the objective nucleic acid.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a method for synthesizing nucleic acids,
Polymerase Chain Reaction:
The PCR method and the reverse transcriptase-polymerase chain reaction (Reverse Transcriptase-Polymerase Chain Rea)
ction: hereinafter abbreviated as RT-PCR).

[0002]

2. Description of the Related Art In a PCR method, a specific region in a DNA chain is sandwiched, a primer is bound, a DNA polymerase is acted on, and a DNA synthesis reaction is repeated to obtain a target DNA.
This method can amplify NA fragments several hundred thousand times. The PCR method is described in the invention of Maris et al., JP-A-61-274697.

[0003] The PCR method can be used as a highly sensitive method for analyzing nucleic acids in various samples, and particularly for analyzing nucleic acids in samples derived from animal body fluids. Therefore, the PCR method is used for diagnosis of infectious diseases, genetic diseases, and cancer caused by microorganisms.
In these cases, a blood-derived sample such as blood, plasma, or serum is often selected as a test target.

On the other hand, the RT-PCR method uses primers in the presence of
After converting RNA to complementary DNA (cDNA) using reverse transcriptase (PCR) and then amplifying the cDNA by PCR, it is possible to quantitatively analyze even a small amount of RNA. One of the high-level analysis methods is to study viruses that carry RNA as a gene, to analyze expressed genes by quantitative detection of mRNA and sequencing, and to analyze expression products by cloning cDNA. It is indispensable.

As a method for further amplifying RNA, NASBA
(Nucleic Acid Sequence Based Amplification) method and the like have been developed. Since this method can perform amplification reaction directly from RNA, it is suitable for research using RNA as a template and has recently been used. Further, since the present method does not include a denaturation step such as PCR, it has a feature that it can be amplified at a constant temperature without a heat cycle.

However, since all of the above nucleic acid synthesis methods are based on enzymatic reactions, it is widely known that the reaction is strongly inhibited by dyes, proteins, saccharides or unknown contaminants present in biological samples.

Therefore, prior to the nucleic acid synthesis, cells, protozoa, fungi, bacteria, viruses and the like are separated from the test substance.
A process for extracting nucleic acids is required. As the method, conventionally, a method of treating a biological sample with an enzyme, a surfactant, a chaotropic agent or the like, and thereafter extracting a nucleic acid using phenol or phenol / chloroform has been conventionally used. Recently, in the process of nucleic acid extraction, ion exchange resins, glass filters, glass beads, reagents having a protein agglutinating action, and the like have been used.

[0008]

However, even when purifying nucleic acids in a sample using these methods, it is difficult to completely remove contaminants, and the amount of nucleic acids recovered in the sample is not constant. Often, therefore, subsequent nucleic acid synthesis, especially when the content of the nucleic acid of interest in the sample is low,
In some cases, it cannot be done well. In addition, these purification methods are complicated and time-consuming, and have a high chance of contamination during the operation.

[0009] Further, when the nucleic acid to be analyzed is RNA, an RNase which is ubiquitously present in all biological samples is used.
(RNase) is always exposed to the danger of degradation, and RNase is not contaminated during the purification process or after purification, not to mention the need for rapid RNase inactivation during purification. Such strict operations and management are required.

Conventionally, blood is directly added to a reaction solution to prepare PC.
Attempts have been made to perform R, in which case the template is all DNA from the host. When the template is derived from the host, the amount of the template is relatively large (the number of leukocytes in normal human blood is 1
Depending on the conditions (repeated sample freeze-thaw, heat-treating the sample, changing the salt concentration in the reaction solution, etc.), the DNA can be amplified to a detectable stage by PCR, depending on the conditions (approx. Sometimes it is possible, but lacks universality. Therefore, in such a method, it is difficult to amplify a gene of a foreign organism such as a virus, a bacterium, a fungus, a protozoan or a cell present in a trace amount in a host sample to a detectable stage. Furthermore, by adding to the reaction solution directly without performing any pre-treatment that destroys the amplification reaction inhibitor in the sample such as freeze-thaw or heat treatment of the sample in advance, the trace amount of foreign organism genes present in the sample can be reduced. Amplification to a detectable stage has never been possible with conventional techniques.

An object of the present invention is to provide a novel reaction solution for efficiently amplifying a nucleic acid in a sample by suppressing the action of an inhibitory substance on gene amplification, thereby destroying an amplification reaction inhibitory substance in an animal body fluid. To directly amplify the gene of a foreign organism present in a minute amount in the body fluid of an animal without adding any pretreatment to the reaction solution.

[0012]

The present invention is characterized in that an animal body fluid sample is directly added to a reaction solution to amplify a small amount of a foreign organism gene mixed in a host sample. In this case, the animal body fluid sample may be added to the reaction solution, or the reaction solution may be added to the animal body fluid sample, and the order of addition is not particularly defined. A foreign organism is defined as a heterologous organism or transformed cell that has invaded the host, such as a DNA virus or RN.
Viruses such as A virus and retrovirus, bacteria, fungi, protozoa and cells (various cells including malignant neoplasms) are applicable.

In the present invention, the gene amplification method includes a PCR method or an RT-PCR method, but is not limited thereto as long as the gene amplification method is carried out using an enzymatic reaction.

According to the present invention, in order to realize the features described in paragraph [0012], the pH of the reaction solution to which the sample is added is adjusted to at least 8.2 at 25 ° C., preferably from 8.8 to 9.2, 55
At 7.4 ° C., preferably 8.0 to 8.4 and / or 7.
It is characterized by being 7.1 or more at 0 ° C., preferably 7.7 to 8.1.

For example, when the sample is a blood-derived sample such as blood, plasma or serum, the pH value of the reaction solution at 25 ° C. is 8.9 or 55.
The pH at 8.1C is 8.1 and / or the pH at 70C is 7.
It is preferably around 8.

Further, the present invention provides a nucleic acid synthesis method for amplifying a target gene in a sample, wherein a polyamine is added to a gene amplification reaction solution in order to realize the features described in paragraph [0012]. I do. Here, the polyamine may be added to the sample and then added to the gene amplification reaction solution, or may be added directly to the gene amplification reaction solution. The same effect can be obtained even when the polyamine is not uniformly contained in the gene amplification reaction solution (for example, when a polyamine is added to a sample and the sample is added to the reaction solution without stirring). The polyamine may be used alone or in combination of several kinds.

The polyamine described in paragraph [0016] is a general term for hydrocarbons having two or more primary or secondary amino groups. Certain types of polyamines are present in vivo, are contained in a large amount of proteins and nucleic acid-synthesizing tissues, and have various physiological effects. The action is not necessarily required, and there is no particular limitation as long as the hydrocarbon has two or more primary or secondary amino groups in one molecule.

Specifically, for example, a linear polyamine containing two amino groups in its molecule (ethylenediamine,
Trimethylenediamine, putrescine), amino group 3
Linear polyamines containing four amino groups (spermidine, diethylenetriamine), linear polyamines containing four amino groups (spermine, triethylenetetramine), linear polyamines containing five amino groups (tetraethylenepentamine), Linear polyamine containing 6 amino groups (pentaethylenehexamine), polyamine having a cyclic structure (1,4-bis (3-aminopropyl)-
Piperazine, 1- (2-aminoethyl) piperazine, 1
-(2-aminoethyl) piperidine, 1,4,10,1
3-tetraoxa-7,16-diazacyclooctadecane and tris (2-aminoethyl) amine).

The addition amount (concentration) of the polyamine varies depending on the type of the polyamine, the type of the sample, the concentration, etc.
The effect is exhibited at a higher concentration when the amino group contained in the molecule is smaller, and at a lower concentration when the amino group is contained more. For example, ethylenediamine containing two amino groups preferably has a concentration of about 8 mM, but tetraethylenepentamine or pentaethylenehexamine containing 5 or more amino groups inhibits the amplification reaction at a concentration of 4 mM or more, and 2 mM The following concentrations are preferred:

The present invention also provides a nucleic acid synthesis method for amplifying a target gene in a sample, wherein the sulfated polysaccharide is added to a gene amplification reaction solution in order to realize the feature described in paragraph [0012]. Features. Here, the sulfated polysaccharide may be added to the sample and then added to the gene amplification reaction solution, or may be added directly to the gene amplification reaction solution. Further, the sulfated polysaccharide has the same effect even when it is not uniformly contained in the gene amplification reaction solution (for example, when the sulfated polysaccharide is added to the sample and the sample is added to the reaction solution without stirring). . The sulfated polysaccharide may be one kind or a combination of several kinds.

In the present invention, as the sulfated polysaccharide, heparin and a salt thereof, dextran sulfate and a salt thereof are preferable, but not limited thereto. For example, heparan sulfate, chondroitin sulfate, dermatan sulfate, funolane, sulfated Agarose, carrageenan, porphyran, fucoidan, sulfated curdlan, and the like can be used.

The addition amount (concentration) of the sulfated polysaccharide varies depending on the type of the sulfated polysaccharide, the type of the sample, the concentration, and the like. It is preferable to add 0.4 to 25 μg / ml.
When the sample is derived from blood and the sulfated polysaccharide is dextran sulfate, it is preferable to add 0.05 to 8 μg / ml to the gene amplification reaction solution.

Further, the present invention provides a nucleic acid synthesis method for amplifying a target gene in a sample, wherein DTT is added to a gene amplification reaction solution in order to realize the feature described in paragraph [0012]. I do. Here, DTT may be added to the sample and then added to the gene amplification reaction solution, or may be added directly to the gene amplification reaction solution. Also, DTT is in a state where it is not uniformly contained in the gene amplification reaction solution (for example, DT
The same effect can be obtained when T is added and this sample is added to the reaction solution without stirring.

DTT is 0.1 mM or more in the gene amplification reaction solution,
Preferably, 0.25 to 2 mM is added.

In the present invention, animal body fluid samples include blood,
Examples include, but are not limited to, blood-derived samples such as plasma or serum, saliva, cerebrospinal fluid, urine, and milk.

The PCR reaction solution is usually a pH buffer solution and MgC
l _2, salts KCl or the like, is intended to include primers, deoxyribonucleotides and a thermostable polymerase. In addition, the above-mentioned salts are appropriately used after being changed to other salts. In addition, various substances such as gelatin, proteins such as albumin, dimethyl sulfoxide, and surfactants may be added.

The RT reaction solution is usually a pH buffer solution and MgC
l ₂ , salts such as KCl, DTT, primers, deoxyribonucleotides, RNase inhibitors and reverse transcriptase. In addition, the above-mentioned salts are appropriately used after being changed to other salts. Various substances such as gelatin, proteins such as albumin, and surfactants may be added.

RT-PCR is performed by adding a part of the product of the RT reaction to a PCR reaction solution (Two tube-Twostep), and by adding a PCR reaction reagent to the product of the RT reaction (One Tube). tube-T
wo step) or prepare all the necessary reagents for the RT-PCR reaction in advance, and execute the RT reaction and PCR continuously.
(One tube-One step) is also possible.

The pH buffer is tris (hydroxymethyl)
A combination of aminomethane and a mineral acid such as hydrochloric acid, nitric acid, sulfuric acid, etc., and a desirable mineral acid is hydrochloric acid. In addition, Tricine, CAPSO (3-N-Cyclohexylamino-2-hydroxyprop
anesulfonic acid) or CHES (2- (Cyclohexylami
No) Various pH buffers such as a pH buffer obtained by combining ethanesulfonic acid) with caustic soda and caustic potash can be used. The pH-adjusted buffer is often used at a concentration between 10 mM and 100 mM in the gene amplification reaction solution.

A primer refers to an oligonucleotide that acts as a synthesis starting point in cDNA synthesis or nucleic acid amplification. The primer is preferably single-stranded, but double-stranded may be used. If the primer is double-stranded, it is desirable to make it single-stranded before the reaction. The primer is
It can be synthesized by a known method, or can be isolated from the living world.

The thermostable polymerase means a polymerase having a high thermostability for synthesizing a nucleic acid by adding a primer. Suitable thermostable polymerases include Thermus
aquaticus-derived Taq DNA polymerase, Thermus thermo
Tth DNA polymerase from philus, K from Pyrococcus
Examples include, but are not limited to, OD, Pfu or Pwo DNA polymerase, or a mixture of the aforementioned thermostable polymerases. Tth DNA polymerase is R
Since it also has T activity, it has the characteristic that it can be covered by one type of enzyme when RT-PCR is performed in one tube-one step.

Reverse transcriptase refers to an enzyme that can reverse transcribe RNA into cDNA. As a reverse transcriptase, Rous associate
d virus (RAV) and Avian myeloblastosis virus (AMV) such as avian retrovirus-derived reverse transcriptase, Moloney muri
Mouse retroviruses such as ne leukemia virus (MMLV)
(MMLV) -derived reverse transcriptase or the aforementioned Tth DNA polymerase, but is not limited thereto.

In the RT reaction of the present invention, it is preferable to use a reverse transcriptase derived from avian retrovirus, particularly from AMV.

The procedure of the nucleic acid synthesis method of the present invention uses a reaction solution having a pH higher than that of a commonly used reaction solution, and a component obtained by combining one or more of polyamine, sulfated polysaccharide and DTT. It is no different from the usual method except for adding. That is, in the RT reaction, the reaction is performed at a reaction temperature suitable for the selected primer and reverse transcriptase for about 30 minutes to 1 hour. In PCR, first, the DNA is denatured into single-stranded DNA by heat denaturation (dinaturation step). Next, primers sandwiching the region to be amplified are hybridized (annealing step). Next, a DNA polymerase is allowed to act in the presence of four types of deoxyribonucleotides (dATP, dGTP, dCTP, dTTP) to perform a primer extension reaction (polymerization step).

[0035]

The following examples illustrate the invention but are not meant to limit the invention in any way.

[Experimental Example 1] In this example, hepatitis B virus (HBV)
PCR was performed by serially diluting the plasma of an infected person with normal human plasma and then directly adding it to the reaction solution completed this time. In the experiment, starting from a plasma of a person infected with hepatitis B virus 100-fold diluted with normal human plasma (agglutination value: 100 titer / ml), a 2-fold serial dilution of normal human plasma was performed at 1 μl per 50 μl reaction solution. PCR was performed with addition.

PCR primers are oligonucleotides (HBVV) having a base sequence of the plus strand located in the S gene region of HBV.
oligonucleotides with pF) and minus strand base sequences
(HBVpR), sold by Takara Shuzo Co., Ltd.
The sequence is as follows: As a result of PCR using these two primers, an amplification product of 432 bp can be obtained. HBVpF: 5 'GGACTTCTCTCAATTTTCTAGGG 3' (SEQ ID NO:
1) HBVpR: 5 'CAAATGGCACTAGTAAACTGAGC 3' (SEQ ID NO:
2)

The PCR reaction solution contained 10 mM Tris-HCl, 50 mM KCl,
1.5mMMgCl _2, 200μM of dATP, dCTP, dGTP and dTTP, each
0.4 μM primer, 1.25 units / 50 μl Taq DNA polymerase (TaKaRa Taq: Takara shuzo, Kyoto, Japan)
Reaction solution containing polyamine, sulfated polysaccharide and DTT
(pH 8.9) was used.

In the PCR, after preheating at 94 ° C for 4.5 minutes, 40 cycles of 94 ° C for 30 seconds, 60 ° C for 1 minute and 72 ° C for 1 minute were performed, and finally, polymerization at 72 ° C for 7 minutes was performed. . After completion of PCR, use 5 μl of the reaction solution, and
TA with 0.5 μg / ml ethidium bromide containing 5% agarose
Electrophoresis was performed in an E (40 mM Tris-acetate, 1 mM EDTA) solution and detected.

Starting from a plasma of a person infected with hepatitis B virus 100-fold diluted with normal human plasma (agglutination value: 100 titer / ml), a 2-fold serially diluted plasma of normal human was used per 50 μl reaction solution. FIG. 1 shows an electrophoretogram of the amplification product when PCR was carried out with 1 μl added.

In the figure, M is a size marker (250 ng of φX174-RF DNA cut with HincII), 1 is no dilution, 2 is 2-fold diluted, 3 is 4-fold, 4 is 8-fold, 5 is 16-fold, 6 is 32 times, 7 is 64
1: 8, 128-fold dilution, 9: normal human plasma added, 10: the results when PCR was performed with no sample added.

From the above results, the plasma (agglutination value: 10,000 titer / ml) of the hepatitis B virus infected person was converted to 1,60 normal human plasma.
It shows that HBV-specific PCR products were also obtained when the 0-fold dilution (FIG. 1, lane 5) was used for PCR.

The above shows that the use of this method makes it possible to detect trace amounts of HBV in plasma.

[Experimental Example 2] This example shows that the hepatitis B virus (HBV)
PCR was performed by serially diluting the plasma of an infected person with normal human serum and then directly adding it to the completed reaction solution. In the experiment, the same hepatitis B virus-infected plasma as in Experimental Example 1 was diluted 100-fold with normal human plasma (agglutination value: 100 ti).
(ter / ml) as a starting point, PCR was performed by adding 1 μl of a serially diluted 2-fold with normal human serum per 50 μl reaction solution.

The same PCR primers, PCR reaction solution, PCR and electrophoresis conditions as in Experimental Example 1 were used.

Starting from a plasma of a person infected with hepatitis B virus 100-fold diluted with normal human plasma (agglutination value: 100 titer / ml), a 2-fold serial dilution with normal human serum was performed per 50 μl of reaction solution. FIG. 2 shows an electrophoretogram of the amplification product when PCR was performed with 1 μl added.

In the figure, M is a size marker (250 ng of φ X174-RF DNA cut with HincII), 1 is not diluted, 2 is 2-fold diluted, 3 is 4-fold, 4 is 8-fold, 5 is 16-fold, 6 is 32 times, 7 is 64
1: 8, 128-fold dilution, 9: 256-fold dilution, 10: normal human serum added, 11: the results when PCR was performed without sample addition.

From the above results, it was found that the plasma (agglutination value: 10,000 titer / ml) of the hepatitis B virus infected person was 1,60
It shows that HBV-specific PCR products were also obtained when the 0-fold dilution (FIG. 2, lane 5) was used for PCR.

The above shows that the use of this method makes it possible to detect trace amounts of HBV in serum.

[Experimental Example 3] In this example, as a model of an exotic organism, mouse blood serially diluted with human blood was directly used.
Add mouse beta actin RN to the reaction solution completed this time
RT-PCR was performed using primers specific to A. In the experiment, RT-PCR was performed by adding 2 μl of mouse blood obtained by serially diluting 10-fold with human blood per 50 μl reaction solution.

The primer for the RT reaction was an oligonucleotide (BA) having a nucleotide sequence complementary to mouse beta actin RNA.
R1) and subsequent PCR, oligonucleotides having a nucleotide sequence complementary to the region upstream of BAR1 (BAR2) and oligonucleotides having a nucleotide sequence complementary to the cDNA synthesized by the RT reaction (BAF ) Was added. Note that RT
-In order to distinguish between RNA-derived products and DNA-derived products in PCR, an intron was designed between the BAF primer and the BAR1 and BAR2 primers. Therefore, the RT-P
The product from RNA in CR is 331 bp and the product from DNA is about 800 bp. The primer sequences used are as follows. BAF: 5 'CCCTGAAGTACCCCATTGAA 3' (SEQ ID NO: 3) BAR1: 5 'GCAGGATGGCGTGA 3' (SEQ ID NO: 4) BAR2: 5 'AGGATGGCGTGAGGGAGA 3' (SEQ ID NO: 5)

The RT reaction solution contained 10 mM Tris-HCl, 35 mM KCl,
1.5mMMgCl2, 200μM dATP, dCTP, dGTP and dTTP, 2m
M DTT, 0.4μM BAR1 primer, 50units / 50μl Ribo
nuclease Inhibitor (Takara shuzo), 5units / 50μl
A reaction solution (pH 8.9) obtained by adding polyamine and sulfated polysaccharide to AMV XL reverse transcriptase (Takara shuzo) was used.

The PCR reaction following the RT reaction was performed by adding 0.4 μM of each of the BAR2 primer, BAF primer and 1.25
units / 50μl Taq DNA polymerase (TaKaRa Taq: Ta
karashuzo).

The RT reaction was performed at 55 ° C. for 30 minutes.
Treatment was performed for 5 minutes to inactivate reverse transcriptase.

After the above operation, PCR was performed by adding BAR2 primer, BAF primer and Taq DNA polymerase. PCR was performed at 94 ° C for 30 seconds, 62 ° C for 1 minute, 72 ° C for 1 minute.
Polymerization was performed at 40 ° C. for 40 minutes, and finally at 72 ° C. for 7 minutes. After completion of the PCR, 5 μl of the reaction solution was subjected to electrophoresis in a TAE solution containing 2.5% agarose and supplemented with 0.5 μg / ml ethidium bromide for detection.

FIG. 3 shows an electrophoretogram of an amplification product when PCR was carried out by adding 2 μl of 50 μl reaction solution obtained by serially diluting mouse blood with human blood to 10-fold dilutions.

FIG. 3 (a) shows the result of PCR after RT reaction in the presence of reverse transcriptase. FIG. 3 (b) shows the results of a control experiment in which an RT reaction was performed in the absence of reverse transcriptase followed by PCR.

In the figure, M is a size marker (250 ng of φ X174-RF DNA cut with HincII), 1,6 is 10, 100 dilutions for 2,7, 1,000 dilutions for 3,8, 10,000 for 4,9. Double dilutions, 5, and 10 show the results when RT-PCR was performed with the addition of human blood only.

From the above results, the mouse blood diluted 10,000 times with human blood (lanes 4 and 9 in FIG. 3) also showed that
It is shown that an amplification product specific to mouse beta actin RNA was obtained only when RT-PCR was performed with the addition of reverse transcriptase (arrow in the figure).

Since only about 1 mouse leukocyte is present in 2 μl of a 10,000-fold diluted mouse blood, the use of this method makes it possible to detect trace RNA other than the host in the blood. It has become.

[0061]

Industrial Applicability According to the present invention, it has become possible to directly add a sample of an animal body fluid to a reaction solution to amplify a gene of a foreign organism which is present in a trace amount in a host sample. Therefore, by using the present invention, DNA viruses such as hepatitis B virus (HBV) and herpes virus lurking in animal body fluids, RNA viruses such as hepatitis C virus (HCV), AIDS virus (HI
Retroviruses such as V) can be detected simply, quickly and with high sensitivity by a direct gene amplification method from animal body fluid samples. Further, it is considered that the present method can be applied to detection of mutant cells such as cancer cells and the like, which have become different from host cells, as well as fungi and protozoa lurking in animal body fluids.

[0062]

[Sequence list]

 <110> shimadzu corp. <120> Method for synthesis of nucleic acids <130> K0990604 <160> 4 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <400> 1 GGACTTCTCTCAATTTTCTAGGG <210> 2 < 211> 23 <212> DNA <213> Artificial Sequence <400> 2 CAAATGGCACTAGTAAACTGAGC <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 CCCTGAAGTACCCCATTGAA <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 GCAGGATGGCGTGA

[Brief description of the drawings]

FIG. 1 is an electrophoretogram of gel electrophoresis used to detect DNA amplified in Experimental Example 1.

FIG. 2 is an electrophoretogram of gel electrophoresis used to detect DNA amplified in Experimental Example 2.

FIG. 3 is an electrophoretogram of gel electrophoresis used to detect RNA amplified in Experimental Example 3.

 ────────────────────────────────────────────────── ─── Continuing from the front page (72) Inventor Naoyuki Nishimura 1 Nishinokyo Kuwabaracho, Nakagyo-ku, Kyoto F-term in Shimadzu Corporation (Reference) 4B024 AA13 AA14 AA20 BA80 CA01 CA09 CA11 HA12 HA19 4B063 QA01 QA07 QA13 QA18 QQ03 QQ42 QQ52 QQ58 QR08 QR22 QR32 QR42 QR43 QR53 QR62 QS08 QS16 QS20 QS25 QS34 QS39

Claims (7)

[Claims] 1. An animal body fluid sample is directly added to a reaction solution,
A nucleic acid synthesis method comprising amplifying a gene of a foreign organism. 2. The method according to claim 1, wherein the sample is a blood-derived sample such as blood, plasma or serum. 3. The nucleic acid according to claim 1, wherein the foreign organism is a virus such as a DNA virus, an RNA virus, or a retrovirus, a bacterium, a fungus, a protozoan or a cell (various cells including a malignant neoplasm). Synthetic method. 4. The reaction solution for gene amplification wherein the pH at 25 ° C. is 8.2 or more, the pH at 55 ° C. is 7.4 or more, and / or the pH at 70 ° C. is 7.1 or more. The nucleic acid synthesis method according to claim 1, wherein 5. The method according to claim 1, wherein a polyamine is added to the gene amplification reaction system. 6. The nucleic acid synthesis method according to claim 1, wherein a sulfated polysaccharide and a salt thereof (hereinafter collectively referred to as a sulfated polysaccharide) are added to the gene amplification reaction system. . 7. The nucleic acid synthesis method according to claim 1, wherein dithiothreitol (abbreviation: DTT) is added to the gene amplification reaction system.