CN113234858A - COVID-19 detection kit - Google Patents
COVID-19 detection kit Download PDFInfo
- Publication number
- CN113234858A CN113234858A CN202110550503.6A CN202110550503A CN113234858A CN 113234858 A CN113234858 A CN 113234858A CN 202110550503 A CN202110550503 A CN 202110550503A CN 113234858 A CN113234858 A CN 113234858A
- Authority
- CN
- China
- Prior art keywords
- leu
- covid
- ala
- transposase
- reverse transcriptase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a detection kit of COVID-19, belonging to the technical field of biological detection, and the detection kit comprises a pretreatment reagent and a library construction reagent; the pretreatment reagent comprises a sputum liquefier; the library reagents include a reverse mutant transcriptase and a mutant Tn5 transposase. The detection kit of COVID-19 provided by the invention comprises a sputum liquefier, a mutant reverse transcriptase and a mutant Tn5 transposase, and when the kit is used for detecting COVID-19, the nucleic acid quantity required by library construction is lower than that of a common commercial kit, so that the problems that the total extraction and accounting quantity is lower and a library cannot be normally built due to the fact that the abundance of pathogens is not high in a COVID-19 sample are overcome; in addition, the kit is used for detecting COVID-19, the time required for building the library is short, the detection time is greatly shortened, and an accurate detection report can be provided in a short time.
Description
Technical Field
The invention belongs to the technical field of biological detection, and particularly relates to a COVID-19 detection kit.
Background
As an RNA virus, COVID-19, no matter RT-PCR (reverse transcription PCR) or second-generation sequencing detection is used, the RNA needs to be reversely transcribed into cDNA before detection. It is often determined clinically by RT-PCR qualitative analysis of specific nucleic acid fragments whether or not COVID-19 is infected. The RT-PCR method requires sequence-specific primers for detection, but the COVID-19 has extremely fast mutation as an RNA virus, and the RT-PCR method cannot detect the COVID-19 after mutation, so the method is not suitable for research on origin of the COVID-19 and toxicity, transmission and the like of the COVID-19.
Metagenome sequencing technology (mNGS) can directly carry out high-throughput sequencing on nucleic acid in a clinical sample without depending on traditional microorganism culture, and pathogenic microorganisms such as viruses, bacteria, fungi and parasites contained in the clinical sample can be rapidly and objectively judged by comparing with a special microorganism database and a drug-resistant genome database and according to the compared sequence information. The mNGS does not need specific amplification, can quickly, comprehensively and accurately detect clinical samples, is particularly suitable for detecting critical and difficult infections, and provides hopes for quickly and accurately diagnosing the difficult and serious infections. NGS non-specific primer PCR can detect non-variant COVID-19 fragment, and can also detect variant COVID-19 fragment.
However, the detection of COVID-19 by using the mNGS has the following problems: firstly, the abundance of pathogens in a sample is not high enough, the total extraction and accounting amount is low, a library cannot be normally built, and the subsequent detection is influenced. Second, the COVID-19 is an RNA virus, when RNA is subjected to library construction, multiple links such as high-temperature breaking, single-strand synthesis, double-strand synthesis, linker addition, library amplification and the like are required, multiple purifications are required, more target fragments are lost, the library-out concentration is low, and the risk that detection on a computer cannot be performed exists. And thirdly, compared with RT-PCR, the detection process of the mNGS is more complicated, the detection time is longer, and the requirement of quickly detecting the COVID-19 at present cannot be met.
Disclosure of Invention
In order to overcome the defects of the prior art, the technical problems to be solved by the invention are as follows: provides a detection kit which can use the mNGS to carry out quick and accurate detection on the COVID-19.
In order to solve the technical problems, the invention adopts the technical scheme that: a detection kit of COVID-19 comprises a pretreatment reagent and a library construction reagent;
the pretreatment reagent comprises a sputum liquefier;
the library establishing reagent comprises reverse transcriptase and Tn5 transposase;
the reverse transcriptase is a mutant reverse transcriptase, and mutation sites of the mutant reverse transcriptase are as follows: P55I, D204E, T334S, E566Q, D587N and L607I;
the Tn5 transposase is a mutant Tn5 transposase, and the mutation sites of the mutant Tn5 transposase are as follows: K54E, I64Y, K160R, K200R and S303G.
The invention has the beneficial effects that: the detection kit for COVID-19 provided by the invention comprises a sputum liquefier, a mutant reverse transcriptase and a mutant Tn5 transposase, and when the kit is used for detecting COVID-19, the action efficiency of the reverse transcriptase and the Tn5 transposase is obviously improved, so that the nucleic acid amount required by library construction is lower than that of a common commercial kit, 1ng of nucleic acid can be taken at least for accurate detection, and the problems that the total extraction accounting amount is lower and a library cannot be normally built due to the fact that the abundance of pathogens existing in a COVID-19 sample is not high enough are solved; in addition, the kit is used for detecting COVID-19, the time required for building a library is short, the detection time is greatly shortened, an accurate detection report can be provided in a short time, and the problems of large COVID-19 sample size, long detection time and high working strength of operators are solved.
Drawings
FIG. 1 is a graph showing the COVID-19 genomic coverage of a sample COVID-19-1 according to an embodiment of the present invention;
FIG. 2 is a graph showing the COVID-19 genomic coverage of a sample COVID-19-2 according to an embodiment of the present invention;
FIG. 3 is a graph showing the COVID-19 genomic coverage of a sample COVID-19-3 according to an embodiment of the present invention.
Detailed Description
In order to explain technical contents, achieved objects, and effects of the present invention in detail, the following description is made with reference to the accompanying drawings in combination with the embodiments.
The detection kit of COVID-19 comprises a pretreatment reagent and a library construction reagent;
the pretreatment reagent comprises a sputum liquefier;
the library establishing reagent comprises reverse transcriptase and Tn5 transposase;
the reverse transcriptase is a mutant reverse transcriptase, and mutation sites of the mutant reverse transcriptase are as follows: P55I, D204E, T334S, E566Q, D587N and L607I, the above sites being mutated simultaneously;
the Tn5 transposase is a mutant Tn5 transposase, and the mutation sites of the mutant Tn5 transposase are as follows: K54E, I64Y, K160R, K200R and S303G, which are mutated simultaneously.
From the above description, the beneficial effects of the present invention are: the detection kit of COVID-19 provided by the invention comprises a sputum liquefier, a mutant reverse transcriptase and a mutant Tn5 transposase, and when the kit is used for detecting COVID-19, the action efficiency of the reverse transcriptase is improved by about 20%, and the action efficiency of the Tn5 transposase is improved by about 15%, so that the nucleic acid amount required by library construction is lower than that of a common commercial kit, and accurate detection can be carried out by taking at least 1ng of nucleic acid, thereby overcoming the problems that the total extraction and accounting amount is lower and a library cannot be normally built due to the common existence of pathogens in a COVID-19 sample with insufficient abundance; in addition, the kit is used for detecting COVID-19, the time required for building the library is short, the library can be built within 2h at the fastest speed, the detection time is greatly shortened, an accurate detection report can be provided in a short time, and the problems of large COVID-19 sample size, long detection time and high working strength of operators are solved.
Furthermore, the amino acid sequence of the reverse transcriptase is shown as SEQ ID NO.1, and the nucleotide sequence of the reverse transcriptase is shown as SEQ ID NO. 2.
Furthermore, the amino acid sequence of the Tn5 transposase is shown as SEQ ID NO.3, and the nucleotide sequence of the Tn5 transposase is shown as SEQ ID NO. 4.
Further, the library construction reagent also comprises a reverse transcription buffer solution, Ol igo (dT), a random primer, Tn5 transposase reaction liquid, a primer, high fidelity amplification reaction liquid and high fidelity amplification enzyme.
Further, the kit for detecting pathogenic microorganisms further comprises a reverse transcription reaction solution, wherein the reverse transcription reaction solution is dimethyl sulfoxide with the concentration of 0.2-2%.
Furthermore, the kit for detecting the pathogenic microorganisms further comprises a high-fidelity amplification reaction solution, wherein the high-fidelity amplification reaction solution comprises 0.1-5mmol/L of 5-iodine-2' -deoxyuridine (IDU), 0.05-10mol/L of Tris (hydroxymethyl) aminomethane hydrochloride (Tris-HCl), 0.01-0.05% of dimethyl sulfoxide (DMSO), 0.005-0.01% of polyethylene glycol (PEG) and 0.1-50mmol/L of disodium citrate.
From the above description, the composition of the high fidelity amplification reaction solution is optimized, so that the damage of high temperature to nucleic acid during library construction can be effectively reduced, and genome and transcriptome information can be effectively retained.
Further, the sputum liquefier consists of a component A and a component B, wherein the component A comprises absolute ethyl alcohol and 0.03-0.06% (volume percentage) of PEG2000, and the component B comprises 0.005% (mass percentage) of DTT and physiological saline.
As can be seen from the above description, when the sample is liquefied, the component A and the component B are mixed in equal volumes, and then added to the sample in a volume 1.5 times that of the sample, and shaken to complete the liquefaction.
The invention relates to a nucleic acid extraction method of COVID-19, which comprises the following steps:
a, taking an inactivated human or animal plasma or respiratory tract sample;
when the sample is a sputum sample, adding a sputum liquefier which is 1-1.5 times of the sample volume, and oscillating for 15-20min by using a crusher to obtain an extracted sample;
when the sample is a non-sputum sample, taking 400 mu L of the sample, and centrifuging to remove 200 mu L of supernatant to obtain an extracted sample;
step b, putting 200 mu L of the extracted sample obtained in the step a into a centrifuge tube, adding 300 mu L of lysate, shaking and uniformly mixing, incubating in a metal bath at the temperature of 80 ℃ for 10min, and cooling to room temperature; adding 500 μ L of anhydrous ethanol, mixing, centrifuging instantly, adding 20 μ L of magnetic beads (10mg/ml), mixing, standing at room temperature for 5min, placing the centrifuge tube on a magnetic frame, adsorbing with magnetic beads completely, and removing waste liquid;
in the standing process, if magnetic beads precipitate, the centrifuge tube is turned over gently to suspend the magnetic beads;
c, adding 1mL of washing solution into the product obtained in the step b, dispersing magnetic beads (for example, sucking with a pipette), placing a centrifugal tube on a magnetic frame, and after the magnetic beads are completely adsorbed, absorbing and discarding waste liquid; then repeating step c once;
and d, placing the centrifugal tube in a magnetic frame, demagnetizing, opening a cover, drying in a 50 ℃ metal bath until the surface of the magnetic beads is bright without water traces, adding 50 mu L of eluent, uniformly mixing, and then performing metal bath at 50 ℃ for 5min (keeping the magnetic beads suspended during the process) to obtain the nucleic acid.
The nucleic acid extraction kit (lysis solution, washing solution and eluent) used in the nucleic acid extraction method is the kit disclosed in the application number 201911413714.4 patent or Tiangen DP 316.
Further, the centrifugation in the step a is as follows: centrifuging at 10000rpm at 4 deg.C for 5 min.
The invention relates to a construction method of a sequencing library of COVID-19, which comprises the following steps:
step 1, extracting 1-5ng of nucleic acid of a sample, and then adding ddH2O, incubation;
step 2, adding reverse transcriptase into the incubated nucleic acid obtained in the step 1 to perform reverse transcription on RNA, then adding Tn5 transposase to perform fragmentation, and adding a stop solution to stop the fragmentation reaction after the fragmentation is finished;
step 3, sequencing the product obtained in the step 2 after strand displacement, library enrichment, library purification and quality inspection;
the reverse transcriptase is a mutant reverse transcriptase, and mutation sites of the mutant reverse transcriptase are as follows: P55I, D204E, T334S, E566Q, D587N and L607I, the above sites being mutated simultaneously;
the Tn5 transposase is a mutant Tn5 transposase, and the mutation sites of the mutant Tn5 transposase are as follows: K54E, I64Y, K160R, K200R and S303G, which are mutated simultaneously.
Example 1:
a detection kit of COVID-19 comprises a pretreatment reagent and a library construction reagent;
the pretreatment reagent comprises a sputum liquefier;
the library establishing reagent comprises reverse transcriptase and Tn5 transposase;
the reverse transcriptase is a mutant reverse transcriptase, and mutation sites of the mutant reverse transcriptase are as follows: P55I, D204E, T334S, E566Q, D587N and L607I;
the Tn5 transposase is a mutant Tn5 transposase, and the mutation sites of the mutant Tn5 transposase are as follows: K54E, I64Y, K160R, K200R and S303G.
Example 2:
a detection kit of COVID-19 comprises a pretreatment reagent and a library construction reagent;
the pretreatment reagent comprises a sputum liquefier;
the library establishing reagent comprises reverse transcriptase and Tn5 transposase;
the reverse transcriptase is a mutant reverse transcriptase, and mutation sites of the mutant reverse transcriptase are as follows: P55I, D204E, T334S, E566Q, D587N and L607I;
the Tn5 transposase is a mutant Tn5 transposase, and the mutation sites of the mutant Tn5 transposase are as follows: K54E, I64Y, K160R, K200R and S303G;
the amino acid sequence of the reverse transcriptase is shown as SEQ ID NO.1, and the nucleotide sequence of the reverse transcriptase is shown as SEQ ID NO. 2;
the primers used to synthesize the reverse transcriptase were as follows:
NZ55-F：tgattatcatcctgaaggc；
NZ55-R：gccttcaggatgataatca；
NZ204-F：gacccttttcgaagaggcc；
NZ204-R：ggcctcttcgaaaagggtc；
NZ334-F：acgaaaagtggaaccctgt；
NZ334-R：acagggttccacttttcgt；
NZ566-F：gcaacgcgctcagcttattgc；
NZ566-R：gcaataagctgagcgcgttgc；
NZ587-F：gtttacacgaatagccgtta；
NZ587-R：taacggctattcgtgtaaac；
NZ607-F：gccgtggcattctgacca；
NZ607-R：tggtcagaatgccacggc；
the amino acid sequence of the Tn5 transposase is shown as SEQ ID NO.3, and the nucleotide sequence of the Tn5 transposase is shown as SEQ ID NO. 4;
primers used to synthesize the Tn5 transposase were as follows:
TN54-F：gagggtagtgaagccatgc；
TN54-R：gcatggcttcactaccctc；
TN64-F：accgattttaccgcaatcc；
TN64-R：ggattgcggtaaaatcggt；
TN160-F：gcggatgaaagagagagtg；
TN160-R：cactctctctttcatccgc；
TN200-F：ctgcaggacaggctggcgca；
TN200-R：tgcgccagcctgtcctgcag；
TN303-F：gttgctgaccggcgaaccg；
TN303-R：cggttcgccggtcagcaac。
example 3:
a detection kit of COVID-19 comprises a pretreatment reagent and a library construction reagent;
the pretreatment reagent comprises a sputum liquefier;
the library establishing reagent comprises reverse transcriptase, Tn5 transposase, reverse transcription buffer solution, oligo (dT), random primers, Tn5 transposase reaction liquid, primers, high fidelity amplification reaction liquid and high fidelity amplification enzyme
The reverse transcriptase is a mutant reverse transcriptase, and mutation sites of the mutant reverse transcriptase are as follows: P55I, D204E, T334S, E566Q, D587N and L607I;
the Tn5 transposase is a mutant Tn5 transposase, and the mutation sites of the mutant Tn5 transposase are as follows: K54E, I64Y, K160R, K200R and S303G;
the amino acid sequence of the reverse transcriptase is shown as SEQ ID NO.1, and the nucleotide sequence of the reverse transcriptase is shown as SEQ ID NO. 2;
the amino acid sequence of the Tn5 transposase is shown as SEQ ID NO.3, and the nucleotide sequence of the Tn5 transposase is shown as SEQ ID NO. 4;
the reverse transcription reaction solution comprises a component for promoting reverse transcription;
the high-fidelity amplification reaction solution comprises 0.1-5mmol/L IDU, 0.05-10mol/L Tris-HCl, 0.01-0.05% DMSO, 0.005-0.01% PEG and 0.1-50mmol/L disodium citrate.
The Random primer is Random Hexamers (Invitrogen)TM)；
The primer comprises a primer 1 and a primer 2, wherein the nucleotide sequence of the primer 1 is as follows: aatgatacggcgaccaccgagatctacac [ nnnnnnnnnn ] tcgtcggcagcgtc, wherein the nucleotide sequence of the primer 2 is as follows: caagcagaagacggcatacgagat [ nnnnnnnnnn ] gtctcgtgggctcgg, wherein nnnnnnnnnn is the index sequence;
the reverse transcription reaction solution is SuperScriptTMIV reverse transcriptase (Invitrogen)TM) An additional buffer;
the Tn5 Transposase reaction solution is a buffer attached to TIANSeq Tn5 Transposase;
the high-fidelity amplification enzyme is
HS DNA。
Example 4:
example 4 differs from example 3 only in that the high fidelity amplification reaction of example 4 consists of 0.5mmol/L IDU, 1mol/L Tris-HCl, 0.02% DMSO, 0.06% PEG and 20mmol/L disodium citrate.
Example 5:
the detection kit of the COVID-19 in the embodiment 4 is used for detecting the COVID-19, and the detection is simultaneously carried out on the same sample by adopting the traditional RNA next generation sequencing method and the QPCR method;
the kit provided by the invention is used for detecting COVID-19, and specifically comprises the following steps:
step 1, taking each sample of inactivated human plasma, alveolar lavage fluid and sputum;
adding a sputum liquefier with the volume 1.5 times that of the sputum sample, and oscillating for 18min by using a crusher to obtain an extracted sample; wherein, the sputum liquefier consists of a component A and a component B, the component A consists of absolute ethyl alcohol and 0.06% (weight percentage) of PEG2000, the component B consists of 0.005% (weight percentage) of DTT and physiological saline, and when a sample is liquefied, the component A and the component B are mixed in equal volume;
centrifuging 400 μ L of blood plasma and alveolar lavage fluid at 4 deg.C and 10000rpm for 5min, and removing 200 μ L of supernatant to obtain extract sample;
step 2, extracting nucleic acid from the sample by using a nucleic acid extraction kit (Tiangen DP-316), then taking 1ng of the extracted nucleic acid, and adding ddH2Supplementing O to 10 μ L, and incubating at 65 deg.C for 5 min;
wherein, the step of extracting and calculating is a conventional method, such as the steps described in the specification of the application;
step 3, adding 2. mu.L of reverse transcriptase, 2. mu.L of reverse transcription buffer, 1. mu.L of oligo (dT), 1. mu.L of random primer and 4. mu.L of ddH to the incubated nucleic acid obtained in step 22O, incubating at 25 ℃ for 5min, incubating at 37 ℃ for 40min to perform reverse transcription of RNA, adding 2 mu L of Tn5 transposase and 10 mu L of transposase reaction solution, incubating at 55 ℃ for 15min to perform fragmentation, and adding 2 mu L of stop solution to stop the fragmentation reaction after the fragmentation is finished;
wherein the reverse transcriptase is a mutant reverse transcriptase, and mutation sites of the mutant reverse transcriptase are as follows: P55I, D204E, T334S, E566Q, D587N and L607I;
the Tn5 transposase is a mutant Tn5 transposase, and the mutation sites of the mutant Tn5 transposase are as follows: K54E, I64Y, K160R, K200R and S303G, the above sites being mutated simultaneously;
the amino acid sequence of the reverse transcriptase is shown as SEQ ID NO.1, and the nucleotide sequence of the reverse transcriptase is shown as SEQ ID NO. 2;
the amino acid sequence of the Tn5 transposase is shown as SEQ ID NO.3, and the nucleotide sequence of the Tn5 transposase is shown as SEQ ID NO. 4;
step 4, after the fragmentation is finished, adding 50 mu L of high-fidelity amplification reaction solution, 5 mu L of primer and 1 mu L of high-fidelity amplification enzyme into the product obtained in the step 3, incubating for 5min at 55 ℃, then incubating for 5min at 60 ℃, and finally incubating for 5min at 95 ℃ to finish the strand displacement;
step 5, adding a linker primer into the product obtained in the step 4, setting a PCR program to perform library enrichment (library amplification), and operating a PCR instrument as shown in Table 1;
TABLE 1
Wherein, the joint primer comprises a primer 1 and a primer 2, and the nucleotide sequence of the primer 1 is as follows:
aatgatacggcgaccaccgagatctacac[nnnnnnnn]tcgtcggcagcgtc；
the nucleotide sequence of primer 2 is:
caagcagaagacggcatacgagat [ nnnnnnnn ] gtctcgtgggctcgg; wherein NNNNNNNN is an index sequence.
Step 6, purifying the library by using DNA Clean Beads, wherein the using amount of the magnetic Beads is 0.6 to 0.8; the purified library is quantified by using the Qubit 4.0, and then fragment length distribution detection is carried out by using Agilent 2100, wherein the length of the library is between 300 and 1000 bp;
and 7, sequencing the sample by using an Illumina Nextseq500 sequencer. Controlling the number of reads of each sample to be 5-20M;
and 8, performing bioinformatics analysis.
The detection is carried out by adopting the traditional RNA next generation sequencing, and the method specifically comprises the following steps:
step 1, taking each sample of inactivated human plasma, alveolar lavage fluid and sputum;
adding NaOH solution with the volume 1.5 times of the sputum sample, and oscillating for 18min by using a crusher to obtain an extracted sample; plasma and alveolar lavage fluid are not treated and are directly used as extraction samples;
step 2, extracting sample nucleic acid by using a Tiangen DP-316 kit;
step 3, constructing an RNA library by using a kappa Recommendations and expressions for RNA-sequencing used Degraded Inputs kit;
4, sequencing by using an Illumina Nextseq 550 sequencer, wherein the number of reads of each sample is controlled to be 5-20M;
and 5, performing bioinformatics analysis.
The detection is carried out by adopting a QPCR method, which specifically comprises the following steps:
step 1, taking each sample of inactivated human plasma, alveolar lavage fluid and sputum;
adding NaOH solution with the volume 1.5 times of the sputum sample, and oscillating for 18min by using a crusher to obtain an extracted sample; plasma and alveolar lavage fluid are not treated and are directly used as extraction samples;
step 2, extracting sample nucleic acid by using a Tiangen DP-316 kit;
and 3, carrying out QPCR detection by using the DAAN novel coronavirus 2019-nCoV nucleic acid detection kit (fluorescence PCR method), and analyzing the result.
The test results of the three methods, the total time length used for the test and the time length for establishing the library (the total time length used for the test is calculated from the time of extracting the sample, and the operation is not interrupted) are recorded, and clinical verification is carried out, and the results are shown in tables 2-3.
TABLE 2
TABLE 3
The method comprises the steps of extracting and aligning sequencing data of the COVID-19 genome by the method, aligning the sequencing data to the specific COVID-19 genome, calculating the sequencing depth of each aligned position, obtaining the genome coverage, displaying a drawing, assisting in judging the reliability of the identification result of the COVID-19, and showing COVID-19 genome coverage maps of samples COVID-19-1, COVID-19-2 and COVID-19-3 in a figure 1-3.
The kit provided by the invention is simple to operate and consumes less time in the stages of sample processing and nucleic acid extraction, can efficiently extract high-purity nucleic acid samples within 30min, completes library construction within 2h, completes detection within 24h and gives accurate detection reports.
Example 6:
example 6 to use the kit of example 4 to detect COVID-19, the method is the same as example 5, and example 6 is different from example 5 only in that: example 6 instead of the sputum liquefying agent of example 5, a NaOH solution was used at a final concentration of 10 mmol/mL.
Example 7:
example 7 in order to use the kit of example 4 to detect COVID-19, the method is the same as example 5, and example 7 is different from example 5 only in that: example 7 the Tn5 transposase and reverse transcriptase used were different from example 5 and the Tn5 transposase and reverse transcriptase of example 7 were: SuperScriptIV reverse transcriptase (Invitrogen)TM) TIANseq Tn5 Transposase (Tiangen).
Example 8:
example 8 in order to use the kit of example 4 to detect COVID-19, the method is the same as example 5, and example 8 is different from example 5 only in that: example 8 unlike example 5, the high fidelity amplification reaction used in example 8 was:
HS DNA Polymerase (TAKARA) buffer attached.
The results (number of sequences) of the tests of examples 5 to 8 are shown in Table 4.
TABLE 4
| Sample numbering | Type of sample | Example 5 | Example 6 | Example 7 | Example 8 |
| COVID-19-4 | Sputum | 117 | 80 | 0 | 105 |
| COVID-19-5 | |
196 | 155 | 0 | 161 |
| COVID-19-6 | |
29 | 13 | 0 | 14 |
In conclusion, the detection kit for COVID-19 provided by the invention treats the sputum sample by using the sputum liquefier instead of the traditional NaOH solution, so that the sputum can be liquefied mildly, the damage of NaOH to the COVID-19 nucleic acid is avoided, and the false negative rate of the sputum sample is reduced; by optimizing the reverse transcriptase and the Tn5 transposase in the kit, the action efficiency of the reverse transcriptase and the Tn5 transposase can be obviously improved, the nucleic acid quantity required by library construction is lower than that of a common commercial kit, accurate detection can be carried out by taking at least 1ng of nucleic acid, the characteristic of low general nucleic acid quantity in a COVID-19 sample can be met, the accuracy of a detection result is high, the time required by library construction can be finished within 2 hours, the time required by detection is greatly reduced, the characteristic of large detection quantity of the COVID-19 sample can be met, and the detection result can be quickly and accurately provided; by improving the composition of the high-fidelity amplification reaction solution, the damage of high temperature to nucleic acid during library construction is avoided, genome and transcriptome information is effectively reserved, and the accuracy of a detection result is further ensured.
The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all equivalent changes made by using the contents of the present specification and the drawings, or applied directly or indirectly to the related technical fields, are included in the scope of the present invention.
Sequence listing
<110> Ashian (Fuzhou) Gene medicine inspection laboratory Co., Ltd
<120> detection kit for COVID-19
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 681
<212> PRT
<213> Artificial Sequence
<400> 1
Leu Gln Val Leu Thr Leu Asn Ile Glu Asp Glu His Arg Leu His Glu
1 5 10 15
Thr Ser Lys Glu Pro Asp Val Ser Leu Gly Ser Thr Trp Leu Ser Asp
20 25 30
Phe Pro Gln Ala Trp Ala Glu Thr Gly Gly Met Gly Leu Ala Val Arg
35 40 45
Gln Ala Pro Leu Ile Ile Ile Leu Lys Ala Thr Ser Thr Pro Val Ser
50 55 60
Ile Lys Gln Tyr Pro Met Ser Gln Glu Ala Arg Leu Gly Ile Lys Pro
65 70 75 80
His Ile Gln Arg Leu Leu Asp Gln Gly Ile Leu Val Pro Cys Gln Ser
85 90 95
Pro Trp Asn Thr Pro Leu Leu Pro Val Lys Lys Pro Gly Thr Asn Asp
100 105 110
Tyr Arg Pro Val Gln Asp Leu Arg Glu Val Asn Lys Arg Val Glu Asp
115 120 125
Ile His Pro Thr Val Pro Asn Pro Tyr Asn Leu Leu Ser Gly Leu Pro
130 135 140
Pro Ser His Gln Trp Tyr Thr Val Leu Asp Leu Lys Asp Ala Phe Phe
145 150 155 160
Cys Leu Arg Leu His Pro Thr Ser Gln Pro Leu Phe Ala Phe Glu Trp
165 170 175
Arg Asp Pro Glu Met Gly Ile Ser Gly Gln Leu Thr Trp Thr Arg Leu
180 185 190
Pro Gln Gly Phe Lys Asn Ser Pro Thr Leu Phe Glu Glu Ala Leu His
195 200 205
Arg Asp Leu Ala Asp Phe Arg Ile Gln His Pro Asp Leu Ile Leu Leu
210 215 220
Gln Tyr Val Asp Asp Leu Leu Leu Ala Ala Thr Ser Glu Leu Asp Cys
225 230 235 240
Gln Gln Gly Thr Arg Ala Leu Leu Gln Thr Leu Gly Asn Leu Gly Tyr
245 250 255
Arg Ala Ser Ala Lys Lys Ala Gln Ile Cys Gln Lys Gln Val Lys Tyr
260 265 270
Leu Gly Tyr Leu Leu Lys Glu Gly Gln Arg Trp Leu Thr Glu Ala Arg
275 280 285
Lys Glu Thr Val Met Gly Gln Pro Thr Pro Lys Thr Pro Arg Gln Leu
290 295 300
Arg Glu Phe Leu Gly Thr Ala Gly Phe Cys Arg Leu Trp Ile Pro Gly
305 310 315 320
Phe Ala Glu Met Ala Ala Pro Leu Tyr Pro Leu Thr Lys Ser Gly Thr
325 330 335
Leu Phe Asn Trp Gly Pro Asp Gln Gln Lys Ala Tyr Gln Glu Ile Lys
340 345 350
Gln Ala Leu Leu Thr Ala Pro Ala Leu Gly Leu Pro Asp Leu Thr Lys
355 360 365
Pro Phe Glu Leu Phe Val Asp Glu Lys Gln Gly Tyr Ala Lys Gly Val
370 375 380
Leu Thr Gln Lys Leu Gly Pro Trp Arg Arg Pro Val Ala Tyr Leu Ser
385 390 395 400
Lys Lys Leu Asp Pro Val Ala Ala Gly Trp Pro Pro Cys Leu Arg Met
405 410 415
Val Ala Ala Ile Ala Val Leu Thr Lys Asp Ala Gly Lys Leu Thr Met
420 425 430
Gly Gln Pro Leu Val Ile Leu Ala Pro His Ala Val Glu Ala Leu Val
435 440 445
Lys Gln Pro Pro Asp Arg Trp Leu Ser Asn Ala Arg Met Thr His Tyr
450 455 460
Gln Ala Leu Leu Leu Asp Thr Asp Arg Val Gln Phe Gly Pro Val Val
465 470 475 480
Ala Leu Asn Pro Ala Thr Leu Leu Pro Leu Pro Glu Glu Gly Leu Gln
485 490 495
His Asn Cys Leu Asp Ile Leu Ala Glu Ala His Gly Thr Arg Pro Asp
500 505 510
Leu Thr Asp Gln Pro Leu Pro Asp Ala Asp His Thr Trp Tyr Thr Asp
515 520 525
Gly Ser Ser Leu Leu Gln Glu Gly Gln Arg Lys Ala Gly Ala Ala Val
530 535 540
Thr Thr Glu Thr Glu Val Ile Trp Ala Lys Ala Leu Pro Ala Gly Thr
545 550 555 560
Ser Ala Gln Arg Ala Gln Leu Ile Ala Leu Thr Gln Ala Leu Lys Met
565 570 575
Ala Glu Gly Lys Lys Leu Asn Val Tyr Thr Asn Ser Arg Tyr Ala Phe
580 585 590
Ala Thr Ala His Ile His Gly Glu Ile Tyr Arg Arg Arg Gly Ile Leu
595 600 605
Thr Ser Glu Gly Lys Glu Ile Lys Asn Lys Asp Glu Ile Leu Ala Leu
610 615 620
Leu Lys Ala Leu Phe Leu Pro Lys Arg Leu Ser Ile Ile His Cys Pro
625 630 635 640
Gly His Gln Lys Gly His Ser Ala Glu Ala Arg Gly Asn Arg Met Ala
645 650 655
Asp Gln Ala Ala Arg Lys Ala Ala Ile Thr Glu Thr Pro Asp Thr Ser
660 665 670
Thr Leu Leu Ile Glu Asn Ser Ser Pro
675 680
<210> 2
<211> 2043
<212> DNA
<213> Artificial Sequence
<400> 2
ttccaagtac tcaccctgaa tattgaagat gagcatcggt tgcatgaaac tagcaaggaa 60
cccgatgtgt ctctgggcag cacctggctg agcgactttc cacaagcgtg ggcggagaca 120
ggtggtatgg gtttagcagt gcgccaggct cccctgatta tcatcctgaa ggcaacgagc 180
acccctgtga gcatcaaaca atatccgatg agccaggaag ctcgtttagg cattaaaccg 240
catattcaac gtttgctgga tcagggcatt ctggtcccat gccagagccc atggaatacc 300
ccgttgctgc cagtgaaaaa gccaggcacg aatgactacc ggccagtgca agatctgcgt 360
gaagtgaata aacgcgtgga agatatacat ccgaccgtgc cgaatccgta taatctttta 420
agtgggctgc ctccgagcca tcagtggtac actgtgttgg accttaaaga cgcattcttt 480
tgcttgcggt tacatcccac tagccagccg ctgtttgcgt ttgagtggcg tgatcccgag 540
atgggcattt ccggtcaact gacatggacc cgtctgccgc agggcttcaa aaattccccg 600
acccttttcg aagaggcctt gcatcgtgat ttagcggact ttcgcataca acacccggac 660
ctgattctgt tacagtatgt ggacgattta ctgctggcgg ctacgtctga gctggattgt 720
cagcaaggta cacgcgcatt attgcagacg ctggggaatt tgggttaccg tgcgagcgcg 780
aaaaaagcgc agatttgcca aaagcaagtg aaatatctgg gatatttgct gaaggaaggg 840
cagcggtggt tgacagaggc ccgtaaggag actgtgatgg ggcaaccaac cccgaagaca 900
cctcgccagt tacgtgaatt cctggggact gcgggatttt gtcgcctgtg gatccccggc 960
tttgcagaga tggcagctcc actttatccg cttacgaaaa gtggaaccct gtttaattgg 1020
gggccagacc aacagaaagc ataccaggaa atcaagcaag cattactgac tgcgcctgcc 1080
ctgggcctgc cggacttgac caaaccgttc gagttatttg tggatgaaaa gcaggggtac 1140
gcaaaaggcg ttcttaccca gaagctgggc ccctggcgtc gccccgtcgc gtatctgtcc 1200
aaaaagttgg atcctgtagc ggcaggttgg ccgccttgct tacgcatggt tgcggccatc 1260
gcggtgttga cgaaggatgc gggcaagtta acaatgggcc agccccttgt cattcttgcg 1320
cctcatgcag tggaagcatt ggtgaagcag cccccagatc gttggcttag caatgcacgc 1380
atgacccatt atcaggcgct gttactggat accgatcgcg tgcagtttgg cccggtggtg 1440
gcgttgaacc cggcgacact tttaccattg cccgaggaag gacttcaaca taattgcttg 1500
gacatcctgg ccgaagcaca cgggacacgg cccgacctga cggatcaacc tcttcccgac 1560
gcagaccaca catggtatac agacggttcg agcctgctgc aagagggaca gcggaaggcg 1620
ggagcggcgg tgacaaccga aaccgaggtc atatgggcga aagccttacc ggctggaacg 1680
tcagcgcaac gcgctcagct tattgcgttg acccaagcgc tgaaaatggc cgagggcaaa 1740
aaactgaatg tttacacgaa tagccgttat gcattcgcga ccgcgcacat acatggcgaa 1800
atctatcgtc gccgtggcat tctgaccagc gaaggaaaag agatcaaaaa caaggatgag 1860
atattggctc ttctgaaagc tctgtttctt ccgaagcggt tatccatcat acattgtcct 1920
ggtcatcaaa agggccatag tgcggaggct cgtggtaatc gtatggcaga tcaagctgct 1980
cgcaaagcgg caattacaga gactcctgat accagcacgc ttctgataga gaactcgtct 2040
cca 2043
<210> 3
<211> 476
<212> PRT
<213> Artificial Sequence
<400> 3
Met Ile Thr Ser Ala Leu His Arg Ala Ala Asp Trp Ala Lys Ser Val
1 5 10 15
Phe Ser Ser Ala Ala Leu Gly Asp Pro Arg Arg Thr Ala Arg Leu Val
20 25 30
Asn Val Ala Ala Gln Leu Ala Lys Tyr Ser Gly Lys Ser Ile Thr Ile
35 40 45
Ser Ser Glu Gly Ser Glu Ala Met Gln Glu Gly Ala Tyr Arg Phe Tyr
50 55 60
Arg Asn Pro Asn Val Ser Ala Glu Ala Ile Arg Lys Ala Gly Ala Met
65 70 75 80
Gln Thr Val Lys Leu Ala Gln Glu Phe Pro Glu Leu Leu Ala Ile Glu
85 90 95
Glu Thr Thr Ser Leu Ser Tyr Arg His Gln Val Ala Glu Glu Leu Gly
100 105 110
Lys Leu Gly Ser Ile Gln Asp Lys Ser Arg Gly Trp Trp Val His Ser
115 120 125
Val Leu Leu Leu Glu Ala Thr Thr Phe Arg Thr Val Gly Leu Leu His
130 135 140
Gln Glu Trp Trp Met Arg Pro Asp Asp Pro Ala Asp Ala Asp Glu Arg
145 150 155 160
Glu Ser Gly Lys Trp Leu Ala Ala Ala Ala Thr Ser Arg Leu Arg Met
165 170 175
Gly Ser Met Met Ser Asn Val Ile Ala Val Cys Asp Arg Glu Ala Asp
180 185 190
Ile His Ala Tyr Leu Gln Asp Arg Leu Ala His Asn Glu Arg Phe Val
195 200 205
Val Arg Ser Lys His Pro Arg Lys Asp Val Glu Ser Gly Leu Tyr Leu
210 215 220
Tyr Asp His Leu Lys Asn Gln Pro Glu Leu Gly Gly Tyr Gln Ile Ser
225 230 235 240
Ile Pro Gln Lys Gly Val Val Asp Lys Arg Gly Lys Arg Lys Asn Arg
245 250 255
Pro Ala Arg Lys Ala Ser Leu Ser Leu Arg Ser Gly Arg Ile Thr Leu
260 265 270
Lys Gln Gly Asn Ile Thr Leu Asn Ala Val Leu Ala Glu Glu Ile Asn
275 280 285
Pro Pro Lys Gly Glu Thr Pro Leu Lys Trp Leu Leu Leu Thr Gly Glu
290 295 300
Pro Val Glu Ser Leu Ala Gln Ala Leu Arg Val Ile Asp Ile Tyr Thr
305 310 315 320
His Arg Trp Arg Ile Asp Glu Phe His Lys Ala Trp Lys Thr Gly Ala
325 330 335
Gly Ala Glu Arg Gln Arg Met Glu Glu Pro Asp Asn Leu Glu Arg Met
340 345 350
Val Ser Ile Leu Ser Phe Val Ala Val Arg Leu Leu Gln Leu Arg Glu
355 360 365
Ser Phe Thr Pro Pro Gln Ala Leu Arg Ala Gln Gly Leu Leu Lys Glu
370 375 380
Ala Glu His Val Glu Ser Gln Ser Ala Glu Thr Val Leu Thr Pro Asp
385 390 395 400
Glu Cys Gln Leu Leu Gly Tyr Leu Asp Lys Gly Lys Arg Lys Arg Lys
405 410 415
Glu Lys Ala Gly Ser Leu Gln Trp Ala Tyr Met Ala Ile Ala Arg Leu
420 425 430
Gly Gly Phe Met Asp Ser Lys Arg Thr Gly Ile Ala Ser Trp Gly Ala
435 440 445
Leu Trp Glu Gly Trp Glu Ala Leu Gln Ser Lys Leu Asp Gly Phe Leu
450 455 460
Ala Ala Lys Asp Leu Met Ala Gln Gly Ile Lys Ile
465 470 475
<210> 4
<211> 1428
<212> DNA
<213> Artificial Sequence
<400> 4
atgataactt ctgctcttca tcgtgcggcc gactgggcta aatctgtgtt ctcttcggct 60
gcgctgggtg accctcgccg tactgcccgc ttggttaacg tcgccgccca attggcaaaa 120
tattctggta aatcaataac catctcatca gagggtagtg aagccatgca ggaaggcgct 180
taccgatttt accgcaatcc caacgtttct gccgaggcga tcagaaaggc tggcgccatg 240
caaacagtca agttggctca ggagtttccc gagctgctgg ccattgagga aaccacctct 300
ttgagttatc gccaccaggt cgccgaagag cttggcaagc tgggctctat tcaggataaa 360
tcccgcggat ggtgggttca ctccgttctc ttgctcgagg ccaccacatt ccgcaccgta 420
ggattactgc atcaggagtg gtggatgcgc ccggatgacc ctgccgatgc ggatgaaaga 480
gagagtggca aatggctggc agcggccgca actagccggt tacgcatggg cagcatgatg 540
agcaacgtga ttgcggtctg tgaccgcgaa gccgatattc atgcttatct gcaggacagg 600
ctggcgcata acgagcgctt cgtggtgcgc tccaagcacc cacgcaagga cgtagagtct 660
gggttgtatc tgtatgacca tctgaagaac caaccggagt tgggtggcta tcagatcagc 720
attccgcaaa agggcgtggt ggataaacgc ggtaaacgta aaaatcgacc agcccgcaag 780
gcgagcttga gcctgcgcag tgggcgcatc acgctaaaac aggggaatat cacgctcaac 840
gcggtgctgg ccgaggagat caacccgccc aagggtgaga cgccgttgaa atggttgttg 900
ctgaccggcg aaccggtcga gtcgctagcc caagccttgc gcgtcatcga catttatacc 960
catcgctggc ggatcgacga gttccataag gcatggaaaa ccggagcagg agccgagagg 1020
caacgcatgg aggagccgga taatctggag cggatggtct cgatcctttc gtttgttgcg 1080
gtcaggctgt tacagctcag agaaagcttc acgccgccgc aagcactcag ggcgcaaggg 1140
ctgctaaagg aagcggaaca cgtagaaagc cagtccgcag aaacggtgct gaccccggat 1200
gaatgtcagc tactgggcta tctggacaag ggaaaacgca agcgcaaaga gaaagcaggt 1260
agcttgcagt gggcttacat ggcgatagct agactgggag gttttatgga cagcaagcga 1320
accggaattg ccagctgggg cgccctctgg gagggatggg aagccctgca aagtaaactg 1380
gatggctttc ttgccgccaa ggacctgatg gcgcagggga tcaagata 1428
Claims (5)
1. The detection kit of COVID-19 is characterized by comprising a pretreatment reagent and a library building reagent;
the pretreatment reagent comprises a sputum liquefier;
the library establishing reagent comprises reverse transcriptase and Tn5 transposase;
the reverse transcriptase is a mutant reverse transcriptase, and mutation sites of the mutant reverse transcriptase are as follows: P55I, D204E, T334S, E566Q, D587N and L607I;
the Tn5 transposase is a mutant Tn5 transposase, and the mutation sites of the mutant Tn5 transposase are as follows: K54E, I64Y, K160R, K200R and S303G.
2. The COVID-19 detection kit according to claim 1, wherein the amino acid sequence of the reverse transcriptase is shown as SEQ ID No.1, and the nucleotide sequence of the reverse transcriptase is shown as SEQ ID No. 2.
3. The COVID-19 detection kit of claim 1, wherein the amino acid sequence of Tn5 transposase is shown as SEQ ID No.3, and the nucleotide sequence of Tn5 transposase is shown as SEQ ID No. 4.
4. The assay kit of claim 1, wherein the banking reagents further comprise a reverse transcription buffer, oligo (dT), random primers, Tn5 transposase reaction, primers, Hi-Fi amplification reaction, and Hi-Fi amplification enzyme.
5. The COVID-19 assay kit of claim 1, wherein the library building reagents further comprise a high fidelity amplification reaction solution comprising 0.1-5mmol/L of 5-iodo-2' -deoxyuridine, 0.05-10mol/L of tris hydrochloride, 0.01-0.05% of dimethylsulfoxide, 0.005-0.01% of polyethylene glycol, and 0.1-50mmol/L of disodium citrate.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110550503.6A CN113234858A (en) | 2021-05-20 | 2021-05-20 | COVID-19 detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110550503.6A CN113234858A (en) | 2021-05-20 | 2021-05-20 | COVID-19 detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113234858A true CN113234858A (en) | 2021-08-10 |
Family
ID=77137729
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110550503.6A Pending CN113234858A (en) | 2021-05-20 | 2021-05-20 | COVID-19 detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113234858A (en) |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001092500A1 (en) * | 2000-05-26 | 2001-12-06 | Invitrogen Corporation | Thermostable reverse transcriptases and uses thereof |
| WO2015112767A2 (en) * | 2014-01-22 | 2015-07-30 | Life Technologies Corporation | Novel reverse transcriptases for use in high temperature nucleic acid synthesis |
| US20170298403A1 (en) * | 2008-04-10 | 2017-10-19 | Thermo Fisher Scientific Baltics Uab | Production of nucleic acid |
| WO2018110595A1 (en) * | 2016-12-14 | 2018-06-21 | タカラバイオ株式会社 | Heat-resistant reverse transcriptase mutant |
| CN111139532A (en) * | 2020-02-24 | 2020-05-12 | 南京诺唯赞生物科技有限公司 | Method and kit for simultaneously constructing sequencing library by DNA and RNA |
| CN111188094A (en) * | 2020-02-24 | 2020-05-22 | 南京诺唯赞生物科技有限公司 | Sequencing library construction method and kit for pathogenic microorganism detection |
| CN111647644A (en) * | 2020-06-12 | 2020-09-11 | 武汉菲沙基因信息有限公司 | Library construction method based on new coronavirus specific reverse transcription primer and application |
| CN111849938A (en) * | 2020-06-05 | 2020-10-30 | 华南理工大学 | Mutant reverse transcriptase and preparation method and application thereof |
| CN112195521A (en) * | 2020-09-11 | 2021-01-08 | 翌圣生物科技（上海）有限公司 | DNA/RNA co-database building method based on transposase, kit and application |
-
2021
- 2021-05-20 CN CN202110550503.6A patent/CN113234858A/en active Pending
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001092500A1 (en) * | 2000-05-26 | 2001-12-06 | Invitrogen Corporation | Thermostable reverse transcriptases and uses thereof |
| US20170298403A1 (en) * | 2008-04-10 | 2017-10-19 | Thermo Fisher Scientific Baltics Uab | Production of nucleic acid |
| WO2015112767A2 (en) * | 2014-01-22 | 2015-07-30 | Life Technologies Corporation | Novel reverse transcriptases for use in high temperature nucleic acid synthesis |
| CN106164261A (en) * | 2014-01-22 | 2016-11-23 | 生命技术公司 | It is applicable to the novel reverse transcriptase of high temperature nucleic acid synthesis |
| WO2018110595A1 (en) * | 2016-12-14 | 2018-06-21 | タカラバイオ株式会社 | Heat-resistant reverse transcriptase mutant |
| CN111139532A (en) * | 2020-02-24 | 2020-05-12 | 南京诺唯赞生物科技有限公司 | Method and kit for simultaneously constructing sequencing library by DNA and RNA |
| CN111188094A (en) * | 2020-02-24 | 2020-05-22 | 南京诺唯赞生物科技有限公司 | Sequencing library construction method and kit for pathogenic microorganism detection |
| CN111849938A (en) * | 2020-06-05 | 2020-10-30 | 华南理工大学 | Mutant reverse transcriptase and preparation method and application thereof |
| CN111647644A (en) * | 2020-06-12 | 2020-09-11 | 武汉菲沙基因信息有限公司 | Library construction method based on new coronavirus specific reverse transcription primer and application |
| CN112195521A (en) * | 2020-09-11 | 2021-01-08 | 翌圣生物科技（上海）有限公司 | DNA/RNA co-database building method based on transposase, kit and application |
Non-Patent Citations (2)
| Title |
|---|
| MARTINEZ-GARCIA,E.等: ""Tn5 hyperactive transposase [Cloning vector pBAM1]"", 《GENBANK》 * |
| SHINNICK,T.M.等: ""Pr180 [Moloney murine leukemia virus]", 《GENBANK》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112501268B (en) | Nanopore sequencing-based primer group and kit for rapidly identifying respiratory microorganisms and application of primer group and kit | |
| EP4219743A1 (en) | Sample nucleic acid measurement test kit, reagent, and application thereof | |
| CN111500781B (en) | Amplification primer group for detecting SARS-CoV-2 by mNGS and application thereof | |
| US20210246499A1 (en) | Detection of short homopolymeric repeats | |
| CN111020031A (en) | Method for detecting tumor gene mutation by combining sequence specific blocker with specific PCR (polymerase chain reaction) program | |
| CN113388691B (en) | Nucleic acid detection method based on PCR amplification and CRISPR-Cas12a and application | |
| CN111575348A (en) | Metagenome library, and library construction method and application thereof | |
| WO2023142619A1 (en) | Marker for dilated cardiomyopathy genetic detection and use thereof | |
| CN110343754A (en) | A method of it is quickly detected for hematopoietic stem cell transplantation donor pathogenic microorganism | |
| CN111304285B (en) | Urinary metagenome sample library building and detecting method based on nanopore sequencing platform | |
| CN111662959A (en) | High-throughput rapid detection method for fungi | |
| CN112662763A (en) | Probe composition for detecting common amphoteric cancers | |
| CN108070636A (en) | A kind of processing method and kit of fluorescent PCR amplified sample | |
| CN113265452A (en) | Bioinformatics pathogen detection method based on Nanopore metagenome RNA-seq | |
| CN113322523A (en) | RNA rapid database building method and application thereof | |
| CN111363793A (en) | PCR amplification reaction system without whole blood taking, amplification kit and amplification method thereof | |
| CN113234858A (en) | COVID-19 detection kit | |
| CN111961709A (en) | Reagent and kit for oral swab direct fluorescence PCR amplification | |
| CN113249441B (en) | Reference substance for detecting pathogenic microorganisms infected with blood influenza and preparation method thereof | |
| CN115820837A (en) | PCR (polymerase chain reaction) detection kit for corneal dystrophy and application thereof | |
| KR20110060156A (en) | Composition for extracting nucleic acid, nucleic acid extracting method and nucleic acid amplifying method using the same | |
| CN114908147A (en) | RT-qPCR detection method for distribution of human mesenchymal stem cells in mouse and application thereof | |
| CN112680794A (en) | Ultramicro nucleic acid sample library building method applied to NGS platform | |
| CN109811052A (en) | A kind of kit and gene panel detecting idiopathic azoospermatism | |
| CN113667714A (en) | Target area capturing method, kit and sequencing method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |