CN111187844A - Gene bar code detection kit and detection method for ips insect - Google Patents
Gene bar code detection kit and detection method for ips insect Download PDFInfo
- Publication number
- CN111187844A CN111187844A CN202010045283.7A CN202010045283A CN111187844A CN 111187844 A CN111187844 A CN 111187844A CN 202010045283 A CN202010045283 A CN 202010045283A CN 111187844 A CN111187844 A CN 111187844A
- Authority
- CN
- China
- Prior art keywords
- sequence
- gene
- ips
- bark beetle
- bar code
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a gene bar code detection kit for ips insects, which comprises a primer DRI/DYI reagent and a gene bar code sequence disc; primer DRI sequence: 5' -AGGAGCATCTGTTGACTT-3, primer DYI sequence: 5'-ATAAACTTCTGGGTGTCC-3' are provided. The invention also discloses a method for detecting the ips insects by using the detection kit, which comprises the steps of carrying out PCR amplification reaction by using the DNA of a sample to be detected as a template, and sequencing the PCR product to obtain a gene sequence; and comparing the sequence obtained by sequencing the bark beetle to be detected with a standard gene bar code sequence in the gene bar code sequence disk, and judging whether the sequence is the target species. The gene bar code detection kit for the ips insect is an efficient, accurate and convenient molecular detection technology for the ips insect, can distinguish 9 kinds of the ips insect at the molecular level, and can meet the use requirements.
Description
Technical Field
The invention relates to the technical field of gene bar code detection of ips, in particular to a gene bar code detection kit and a detection method for the ips.
Background
The ips insect is an important forest pest, most of which are trees killed by withering, and hosts include spruce, fir, masson pine, Chinese pine and the like. All insect states of the insect can be spread and diffused along with the long-distance transportation of the host wood and the wooden packaging material, thereby causing harm. At present, species identification research of the ips is mainly focused on form identification, a traditional insect form identification method has certain limitation, a complete adult insect is required to be used as a form research object, and form structures and incomplete insect bodies of kindred species, larvae and pupae are difficult to identify. With the advent of molecular biology research, more and more techniques can be used for species identification of the bark beetle. With the improvement of the technological level, many people have recently come to use molecular biology to perform molecular identification on insects. The molecular biology means generally needs less sample amount, has the advantages of rapidness, accuracy and the like, and can provide reliable reference basis for pest identification.
Mitochondrial DNA (mtDNA) of the insect is a closed double-chain circular genetic material, has high stability, generally has the size of 15.4-16.3 kb, exists in the mitochondrial body with high copy number, has faster evolution speed than the nucleus, is maternal inheritance, does not generate mutation such as gene recombination inversion translocation and the like in the inheritance process, and has very important significance in the researches such as classification, interspecies identification and the like of closely related species of the insect. In addition, it is also an important marker in the identification of new species and even complex species of insects. The royal silverbamboo and the like (2010) carry out determination and analysis on mtDNA COI gene sequences of 10 kinds of ips (Platypodidae) insects from different countries, and the 10 kinds of ips have obvious difference on the gene sequences, thereby providing a molecular basis for the accurate identification of the ips. Feng et al (2012) analyzed the mtDNACEI gene sequences of 31 important fly (Muscidae) insects, studied the phylogenetic and classification identification of fly insects, and showed that the sequence can be used as the basis for identifying fly insect molecules. The mtDNA COI gene sequence of 7 locusts is determined by Pangeing et al (2006), and the feasibility of identifying the locusts species by using the COI gene as a DNA bar code is discussed. Studies of Henrong et al (2012) show feasibility of applying DNA barcodes based on mtDNA COI gene fragments for the identification of ips genus classification.
DNA barcode technology is a new technology for identifying species using one or several standard, easily amplifiable, DNA fragments with interspecies differences significantly larger than intraspecies differences, the concept first proposed by the academy of canada Hebert. Compared with conventional classification techniques, DNA barcode technology has many incomparable advantages: (1) the method is simple to operate, and people with lack of knowledge in species classification and identification can also identify the species through a standard technical process; (2) the method is not limited by the development stage and morphological characteristics of individuals, and the identification requirement can be met as long as the individuals have complete target DNA fragments; (3) the technology can be used as an auxiliary means of traditional taxonomy, helps traditional taxonomists to correct the previous classification conclusion, and solves the problem that morphological classification cannot solve. Just because of the above and many other advantages of DNA barcode technology, more and more researchers have added to the research line of DNA barcode technology, making this field one of the hotspots of biological research (Hebert, 2006). However, at present, there is no related system report about the gene barcode rapid detection technology research of the bark beetle. Therefore, the establishment of an accurate and reliable bar code detection technology for the ips insects has important significance for the quarantine departments in China, is more beneficial to the supplement of gene resources in China, particularly the supplement of the ips pest resources, can make certain contribution to the aspect of fighting for limited resources in China, and simultaneously provides a new method for the classification and identification of the ips.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides a gene bar code detection kit and a detection method for the bark beetle insects, so that the bark beetle insects can be detected quickly and efficiently.
In order to solve the technical problem, the invention provides a gene bar code detection kit for ips insects, which at least comprises a gene bar code sequence disc and a primer DRI/DYI reagent; the primer DRI/DYI sequence is as follows:
primer DRI sequence: 5' -AGGAGCATCTGTTGACTT-3 of the formula I,
primer DYI sequence: 5'-ATAAACTTCTGGGTGTCC-3' are provided.
Further, 45 standard barcode sequences are stored in the gene barcode sequence, and the detailed sequences are shown in SEQ ID NO.1 to SEQ ID NO. 45.
Further, the following reagents are also included: taq buffer, MgCl2dNTP mix, Taq DNA polymerase, ddH2O, DNA standards.
Further, the method can be used for rapidly detecting 9 ips, wherein the 9 ips specifically comprises the following steps: fir bark beetle, spruce bark beetle, birch bark beetle, Dolomorph bark beetle, nephrolepis bark beetle, mixed bark beetle, frontal bark beetle, pine bark beetle.
The invention also provides a method for detecting the ips insect by using the gene bar code detection kit, which comprises the following steps:
extracting DNA of a sample to be detected;
taking the DNA of a sample to be detected as a template, carrying out PCR amplification reaction by using the primer, carrying out agarose gel electrophoresis on an amplification product, and placing the gel in an imaging system for photographing; the photos show that the bark beetle and the standard DNA sample have clear amplified bands at the position of 316bp, namely the target band;
sequencing the PCR product to obtain a gene sequence;
and comparing the sequence obtained by sequencing the bark beetle to be detected with a standard gene bar code sequence in the gene bar code sequence disk, and judging whether the sequence is the target species.
Further, a GenMagBio animal cell tissue/cell genome DNA magnetic bead extraction kit is adopted to extract a sample to be detected.
Further, the PCR amplification reaction system is as follows: the total volume is 50. mu.L, containing 5. mu.L of 10 XTaq buffer with KCl and 2mmol/L MgCl 2200 mu mol/L dNTP mix, 2U Taq DNA polymerase, 3 mu L DNA template and 1 mu mol/L primer.
Further, the PCR amplification reaction program is as follows: pre-denaturation at 95 ℃ for 2min before circulation; denaturation at 95 ℃ for 30s, annealing at 52 ℃ for 30s, and extension at 72 ℃ for 45s, and performing 35 cycles; after circulation, the product is extended at 72 deg.C for 10min and stored at-20 deg.C.
Further, the specific method for comparing the sequence obtained by sequencing the bark beetle to be detected with the standard gene barcode sequence in the gene barcode sequence disk is as follows:
a: if the similarity of the standard gene barcode sequence is 100%, the standard gene barcode sequence is determined as the type;
b: if the similarity between the gene sequence of the bark beetle to be detected and any standard bar code sequence does not reach 100 percent, translating the gene sequence of the bark beetle to be detected into amino acid according to an invertebrate codon, calculating the genetic distance by using a P-distance model with the amino acid sequence corresponding to the standard gene bar code sequence, and obtaining a standard gene bar code type with the genetic distance between the gene sequence of the bark beetle of unknown species being less than 2 percent, namely a target type; if the genetic distance is more than 2%, judging that the species of the unknown bark beetle is not in the 9 bark beetle range.
The invention achieves the following beneficial effects: compared with the prior art, the gene bar code detection kit for the ips insect is an efficient, accurate and convenient molecule detection technology for the ips insect, can distinguish 9 kinds of the ips insect at the molecular level, and has the following characteristics:
(1) the method is simple to operate, and people with lack of knowledge in species classification and identification can also identify the species of the family pissodidae through a standard technical process;
(2) the method is not limited by the development stage and morphological characteristics of individuals, and the identification requirement can be met as long as the individuals have complete target DNA fragments;
(3) the target gene is short enough and only 316bp, so that the requirement of the experiment on the quality of the specimen is reduced, and the amplification efficiency is high;
(4) interspecies variation is large and intraspecies variation is small to distinguish different species; contains sufficient phylogenetic information to locate the species in the taxonomy. Can meet the use requirement.
Drawings
FIG. 1 is an electrophoretogram of a sample to be tested, wherein 1 spruce bark beetle, 2 fir bark beetle, 3 kidney point bark beetle, 4 Meispruce bark beetle, 5 larch bark beetle, 6 white pine bark beetle elephant, and 7 glabrous shoulder beetle.
Detailed Description
The invention is further described below with reference to the accompanying drawings. The following examples are only for illustrating the technical solutions of the present invention more clearly, and the protection scope of the present invention is not limited thereby.
Example 1
A gene barcode detection kit for ips can rapidly detect 9 ips (as shown in Table 1), and at least comprises a primer DRI/DYI reagent with more than 20 dosages and 1 gene barcode sequence disk; the primer DRI/DYI sequence is as follows:
DRI sequence: 5'-AGGAGCATCTGTTGACTT-3' the flow of the air in the air conditioner,
DYI sequence: 5'-ATAAACTTCTGGGTGTCC-3' are provided.
The gene bar code sequence inventory includes 9 total 45 standard bar code sequences, and the detailed sequence is shown in SEQ ID NO. 1-45.
TABLE 1 genus name of bark beetle
| Serial number | Name of Chinese | Latin |
| 1 | Fir bark beetle | Dryocoetes striatus |
| 2 | Bark beetle of spruce | Dryocoetes hectographus |
| 3 | Betula platyphylla bark beetle | Dryocoetes betulae |
| 4 | Meiyuncao bark beetle | Dryocoetes affaber |
| 5 | Bark beetle of kidney point hair | Dryocoetes autogruphus |
| 6 | Bark beetle | Dryocoetes villosus |
| 7 | Mixed spotted bark beetles | Dryocoetes confusus |
| 8 | Brothers bark beetles | Dryocoetes luteus |
| 9 | Pine bark beetle | Dryocoetes pini |
The preferred kit components can also comprise the following reagents in an amount of more than 20 times: taq buffer, MgCl2，dNTPmix， Taq DNA polymerase, ddH2O, DNA standards.
Example 2
Selecting spruce bark beetles, fir bark beetles, renal point bark beetles, Meiyuncao bark beetles, larch bark beetles, white pine bark beetles elephant, and anoplophora glabripennis. Seven samples were used as the samples to be tested. The kit of example 1 was used for detection, the procedure was as follows:
1) total DNA extraction
Extraction of DNA was performed using a GenMagBio animal cell tissue/cell genomic DNA magnetic bead extraction kit. The specific process is as follows:
directly shearing 30mg of feet and chest parts of a specimen to be tested, putting the feet and chest parts into a test tube with the diameter of 2mm, soaking the specimen in absolute ethyl alcohol, soaking the specimen in sterile distilled water for 4-5 times, and discarding water; and (5) soaking the dry specimen in sterile distilled water for 3h, and then sucking water. Placing in a 2mL centrifuge tube, shaking and milling (30 times/s) in an MM400 ball mill for 30s, adding 180 mu L lysine Buffer and 20 mu L protease K, shaking and mixing uniformly, standing overnight at normal temperature, shaking and bathing at 55 ℃ for 3-5h, centrifuging at 12000rpm for 10min, taking supernatant, adding 200 mu L Bindingbuffer and 200 mu L absolute ethyl alcohol, mixing uniformly, adding 20 mu L magnetic beads, and mixing uniformly by gentle inversion for 10 min. And placing the centrifugal tube in a magnetic frame, sucking away liquid in the tube, keeping magnetic beads, reversing and uniformly mixing the Wash Buffer I and 500uL for 2min, placing the centrifugal tube in the magnetic frame, discarding the liquid in the tube, washing the Wash Buffer II twice in the same way, still placing the centrifugal tube on the magnetic frame, slowly adding the Wash Buffer III, and moving away the liquid in the tube after 1 min. 20 μ L of Elution Buffer was added, and DNA adsorbed on the beads was eluted in a water bath at 55 ℃ for 10min and stored at 4 ℃ for further use.
2) Sequence amplification and determination
And (3) PCR reaction system: the total volume was 50. mu.L, containing 5. mu.L of 10 XTaq buffer with KCl, 2mmol/LMgCl2200 mu mol/L dNTP mix, 2U Taq DNA polymerase, 3 mu L DNA template and primer of 1 mu mol/L respectively; PCR reaction procedure: pre-denaturation at 95 ℃ for 2min before circulation; denaturation at 95 ℃ for 30s, annealing at 52 ℃ for 30s, and extension at 72 ℃ for 45s, and performing 35 cycles; after circulation, the product is extended at 72 deg.C for 10min and stored at-20 deg.C. Mixing 8 μ L of sample to be tested with 2 μ L of 6 × Glycerol DNAloading Buffer, labeling with DNA Marker DL100 as molecular weight, maintaining constant pressure at room temperature of 120V, and mixingCarrying out electrophoresis on 3% agarose gel for 45min, carrying out EB staining on the agarose gel at 0.5% mu mol/L, detecting a sample by a gel imaging system, and carrying out photographing analysis; the electrophoretogram is shown in figure 1, in 7 samples, four kinds of bark beetles, larch bark beetles and positive samples all amplify a band with the size of 316bp, a bark beetle elephant and a glabrous shoulder longicorn do not amplify a band, and the 2 excluded species are not in the bark beetle, which is in line with the reality and is accurately excluded. The product of the amplified band was subjected to bidirectional sequencing using PCR primers as sequencing primers, and completed by Nanjing Kingsler Biotech Co.
3) Gene alignment
By using the existing comparison software and computer technology, the sequence result obtained by sequencing the unknown species bark beetle is compared with the standard gene barcode sequence in the gene barcode sequence disk, and the result operates according to the following mode:
a: if the similarity of the standard gene barcode sequence is 100%, the standard gene barcode sequence is determined as the type;
b: if the similarity of the gene sequence of the unknown type bark beetle does not reach 100 percent with any standard barcode sequence, translating the gene sequence of the unknown type bark beetle into amino acid according to an invertebrate codon, calculating a genetic distance with the amino acid sequence of the standard gene barcode by using a P-distance model, and obtaining a target type of the standard gene barcode with the genetic distance less than 2 percent with the gene sequence of the unknown type bark beetle; if the genetic distance is more than 2 percent, the unknown species of the bark beetle is not in the 9 bark beetle range.
The 5 sequences obtained were input into a gene barcode sequence tray in sequence for calculation and comparison, and the results were as follows:
1) the similarity between the spruce bark beetle sequence and the spruce bark beetle standard bar code gene in the sequence disc is 100 percent, and the identification result is accurate.
2) The similarity between the fir bark beetle sequence and the fir bark beetle standard bar code gene in the sequence disk is 100 percent, and the identification result is accurate.
3) The similarity of the sequence of the kidney spot hair bark beetle and the standard bar code gene of the kidney spot hair bark beetle in the sequence disc is 98 percent to 100 percent, the genetic distance of the sequence of the kidney spot hair bark beetle and the standard bar code gene of the black spot bark beetle in the sequence disc is 0.6 percent, the sequence is determined as the kidney spot hair bark beetle according to the result identification rule, and the identification result is accurate.
4) The similarity between the Meiyun bark beetle sequence and the Meiyun bark beetle standard bar code gene in the sequence disc is 100 percent, and the identification result is accurate.
5) The genetic distance between the ips typographus and the standard barcode gene of the ips typographus in the sequence disc is 43.7-50.3 percent and is far more than 2 percent, and the ips typographus is identified as a non-9 ips according to the result identification rule.
All results are consistent with the sample types to be tested, and the results meet the requirements, which shows that the kit can accurately identify the 4 bark beetles.
The above description is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, several modifications and variations can be made without departing from the technical principle of the present invention, and these modifications and variations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Nanjing customs animal, plant and food detection center
<120> gene bar code detection kit and detection method for bark beetle insects
<160>45
<170>SIPOSequenceListing 1.0
<210>1
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
ggagcatctg ttgatttagc tatttttagt cttcatatat caggagtatc ttcaatctta 60
ggggcaatta actttatctc aacaattata aatatgcatc caacaggaat aaaacccgaa 120
caattatccc tttttacttg atctgttaaa attacagcaa ttcttctcct tttatctctt 180
cctgtcctag caggaggaat cactatgtta ttaacagacc gaaatattaa tacatcattc 240
tttgatccag caggaggggg ggatcctatt ttataccaac acttattttg attttttgga 300
cacccagaag tttata 316
<210>2
<211>288
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
ggagcatctg ttgatttagc tatttttagt cttcatatat caggagtatc ttcaatctta 60
ggggcaatta actttatctc gacaattata aatatacatc caacaggaat aaaacccgaa120
caattatccc tttttacttg atctgttaaa attacagcaa ttcttctcct tttatctctt 180
cctgtcctag caggaggaat cactatatta ttaacagacc gaaatattaa tacatcattc 240
tttgatccag caggaggggg ggatcctatt ttataccaac atttattt 288
<210>3
<211>288
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
ggagcatctg ttgatttagc tatttttagt cttcatatat caggagtatc ttcaatctta 60
ggggcaatta actttatctc aacaattata aatatgcatc caacaggaat aaaacccgaa 120
caattatccc tttttacttg atctgttaaa attacagcaa ttcttctcct tttatctctt 180
cctgtcctag caggaggaat cactatatta ttaacagacc gaaatattaa tacatcattc 240
tttgatccag caggaggggg ggatcctatt ttataccaac atttattt 288
<210>4
<211>288
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
ggagcatctg ttgatttagc tatttttagt cttcatatat caggagtatc ttcaatctta 60
ggggcaatta actttatctc aacaattata aatatgcatc caacaggaat aaaacccgaa 120
caattatccc tttttacttg atctgttaaa attacagcaa ttcttctcct tttatctctt 180
cctgtcctag caggaggaat cactatatta ttaacagacc gaaatattaa tacatcattc 240
tttgatccag caggaggggg ggatcctatt ttataccaac atttattt 288
<210>5
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
ggagcatctg ttgacttagc tatttttagt cttcatatat caggagtatc ttcaatctta 60
ggggcaatta actttatctc aacaattata aatatgcatc caacaggaat aaaacccgaa 120
caattatccc tttttacttg atctgttaaa attacagcaa ttcttctcct tttatctctt 180
cctgtcctag caggaggaat cactatatta ttaacagacc gaaatattaa tacatcattc 240
tttgatccag caggaggggg ggatcctatt ttataccaac atttattttg attttttgga 300
cacccagaag tttata 316
<210>6
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
ggagcatctg ttgatttagc tatttttagt cttcatatat caggagtatc ttcaatctta 60
ggggcaatta actttatctc aacaattata aatatgcatc caacaggaat aaaacccgaa 120
caattatccc tttttacttg atctgttaaa attacagcaa ttcttctcct tttatctctt 180
cctgtcctag caggaggaat cactatgtta ttaacagacc gaaatattaa tacatcattc 240
tttgatccag caggaggggg ggatcctatt ttataccaac acttattttg attttttgga 300
cacccagaag tttata 316
<210>7
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
ggagcatctg ttgacttagc tatttttagt cttcacataa caggtgtttc atcaatctta 60
ggagccatca actttatctc aacaattatt aatatacatc ctgcaggaat aaagcctgaa 120
caactttctc tttttacttg atcagttaaa attacagcaa ttctacttct tttatctcta 180
cctgttctag caggaggaat cactatatta ttaacagatc gaaatattaa tacatcattt 240
tttgacccag ccggaggggg tgacccaatt ctataccaac acttattttg gttctttgga 300
cacccagaag tttata 316
<210>8
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
ggagcatctg ttgacttagc tatttttagt cttcacataa caggtgtttc atcaatctta 60
ggagccatca actttatctc aacaattatt aatatacatc ctgcaggaat aaagcctgaa 120
caactttctc tttttacttg atcagttaaa attacagcaa ttctacttct tttatctcta 180
cctgttctag caggaggaat cactatatta ttaacagatc gaaatattaa tacatcattt 240
tttgacccag ccggaggggg tgacccaatt ctataccaac acttattttg gttctttgga 300
cacccagaag tttata 316
<210>9
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
ggagcatctg ttgatttagc tatttttagt cttcacataa caggtgtttc atcaatctta 60
ggggccatca actttatctc aacaattatt aatatacatc ctgcaggagt aaagcccgaa 120
caactctccc tttttacttg atcagttaaa attacagcaa ttctacttct tctatctcta 180
cctgttctag caggaggaat cactatatta ttgacagatc gaaatattaa cacatcattt 240
tttgacccag ccggaggagg ggatccaatt ctataccagc atctattttg attctttgga 300
cacccagaag tttata 316
<210>10
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
ggagcatctg ttgatttagc tatttttagt cttcacataa caggtgtttc atcaatctta 60
ggggccatca actttatctc aacaattatt aatatacatc ctgcaggagt aaaacccgaa 120
caactttccc tttttacttg atcagttaaa attacagcaa ttctacttct tctatctcta 180
cctgttctag caggaggaat cactatatta ttgacagatc gaaatattaa cacatcattt 240
tttgacccag ccggaggagg ggatccaatt ctataccagc atctattttg attctttgga 300
cacccagaag tttata 316
<210>11
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
ggagcatctg ttgacttagc tatttttagt cttcatataa caggtgtttc ctcaatctta 60
ggggccatca attttatctc aacaattattaatatacatc ctgcaggaat aaatcctgaa 120
caactttctc tttttacttg atcagttaaa attacagcaa ttctacttct tctatctcta 180
cccgttctag caggaggaat cactatatta ttaacagatc gaaatattaa cacatcattt 240
tttgatccag ccggaggggg agatccaatt ctataccaac acttattttg attctttgga 300
cacccagaag tatata 316
<210>12
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
ggagcatctg ttgatttagc tatttttagt cttcacataa caggtgtttc atcaatctta 60
ggggccatca actttatctc aacaattatt aatatacatc ctgcaggagt aaagcccgaa 120
caactctccc tttttacttg atcagttaaa attacagcaa ttctacttct tctatctcta 180
cctgttctag caggaggaat cactatatta ttgacagatc gaaatattaa cacatcattt 240
tttgacccag ccggaggagg ggatccaatt ctataccagc atctattttg attctttgga 300
cacccagaag tttata 316
<210>13
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
ggagcatctg ttgatttagc tatttttagt cttcacataa caggtgtttc atcaatctta 60
ggggccatca actttatctc aacaattatt aatatacatc ctgcaggagt aaagcccgaa 120
caactctccc tttttacttg atcagttaaa attacagcaa ttctacttct tctatctcta 180
cctgttctag caggaggaat cactatatta ttgacagatc gaaatattaa cacatcattt 240
tttgacccag ccggaggagg ggatccaatt ctataccagc atctattttg attctttgga 300
cacccagaag tttata 316
<210>14
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
ggtgcgtctg ttgacctagc tatttttagt cttcacataa caggagtctc ctcaatttta 60
ggggccatca actttatctc aacaattatc aatatacacc ctgcagggat aaaacctgaa 120
caactttctc tttttacttg atctgttaaa attacagcca tcctgcttct tctatctcta 180
cctgttctag caggaggaat tactatatta ttaacagatc gaaatatcaa tacatcattt 240
tttgacccag ccggcggggg ggatccaatt ttataccaac acttattttg attttttgga 300
catccagaag tttaca 316
<210>15
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>15
ggtgcgtctg ttgacctagc tatttttagt cttcacataa caggagtctc ctcaatttta 60
ggggccatca actttatctc aacaattatc aatatacacc ccgcaggaat aaaacctgaa 120
caactttctc tttttacttg atctgttaaa attacagcca tcctgcttct tctatctcta 180
cctgttctag caggaggaat tactatatta ttaacagatc gaaatatcaa tacatcattt 240
tttgacccag ccggcggggg ggatccaatt ttataccagc acttattttg attttttgga 300
catccagaag tttaca 316
<210>16
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>16
ggtgcatctg ttgacctagc tatttttagt ctacacataa caggagtctc ctcaatttta 60
ggggccatca actttatctc aacaattatc aatatacacc ctgcaggaat aaaacctgaa 120
caactttctc tttttacttg atctgttaaa attacagcca tcctgcttct tctatctcta 180
cctgttctag cgggaggaat tactatatta ttaacagatc gaaatattaa tacatcattt 240
tttgacccag ccggcggagg ggacccaatt ttataccagc acttattttg attttttgga 300
cacccagaag tttaca 316
<210>17
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>17
ggtgcatctg ttgatctagc tatttttagt cttcacatat caggagtctc ctcaatttta 60
ggggctatca actttatctc aacaattatc aatatacacc ctgcaggaat aaaacctgaa 120
caactttctc tttttacttg atctgttaaa attacagcca ttctgcttct tttgtctctt 180
cctgttctgg caggaggaat tactatatta ttaacagatc gaaatatcaa tacatcattt 240
tttgacccag ccggcggagg ggatccaatt ttataccaac acttattttg attttttgga 300
catccagaag tttaca 316
<210>18
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>18
ggtgcatctg ttgatctagc tatttttagt cttcacatat caggagtctc ctcaatttta 60
ggggctatca actttatctc aacaattatc aatatacacc ctgcaggaat aaaacctgaa 120
caactttctc tttttacttg atctgttaaa attacagcca ttctgcttct tttgtctctt 180
cctgttctgg caggaggaat tactatatta ttaacagatc gaaatatcaa tacatcattt 240
tttgacccag ccggcggagg ggatccaatt ttataccaac acttattttg attttttgga 300
catccagaag tttaca 316
<210>19
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>19
ggtgcatctg ttgatctagc tatttttagt cttcacatat caggagtctc ctcaatttta 60
ggggctatca actttatctc aacaattatc aatatacacc ctgcaggaat aaaacctgaa 120
caactttctc tttttacttg atctgttaaa attacagcca ttctgcttct tttgtctctt 180
cctgttctgg caggaggaat tactatatta ttaacagatc gaaatatcaa tacatcattt 240
tttgacccag ccggcggagg ggatccaatt ttataccaac acttattttg attttttgga 300
catccagaag tttaca 316
<210>20
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>20
ggagcatctg ttgatttagc tatttttagt cttcatatat ctggagtatc ttcaatytta 60
ggagctatta actttatttc aacaattatt aatatgcacc ccgcagggat aaaacctgaa 120
caactatctc tttttacttg atctgtcaaa attacagcaa ttttacttct tctttctcta 180
cccgtactag caggaggaat caccatatta ttaacagatc gaaatattaa tacatcattt 240
tttgatccag ccggaggagg cgacccaatc ttatatcaac accttttctg attctttgga 300
cacccagaag tttata 316
<210>21
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>21
ggagcatctg ttgacttagc tatttttagt cttcatatat ctggagtatc ttcaatttta 60
ggagctatta actttatttc aacaattatt aatatacacc ccgcaggaat aaaacctgaa 120
caactatctc tttttacttg atctgtcaaa attacagcaa ttttacttct tctttctcta 180
cccgtactag caggaggaat caccatatta ttaacagatc gaaatattaa tacatcattt 240
tttgatccag ccggaggagg cgacccaatc ttatatcaac accttttctg attttttgga 300
cacccagaag tttata 316
<210>22
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>22
ggagcatctg ttgacttagc tatttttagtcttcatatat ctggagtatc ttcaatttta 60
ggagctatta actttatttc aacaattatt aatatacacc ccgcaggaat aaaacctgaa 120
caactatctc tttttacttg atctgtcaaa attacagcaa ttttacttct tctttctcta 180
cccgtactag caggaggaat caccatatta ttaacagatc gaaatattaa tacatcattt 240
tttgatccag ccggaggagg cgacccaatc ttatatcaac accttttctg attttttgga 300
cacccagaag tttata 316
<210>23
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>23
ggagcatctg ttgatttagc tatttttagt cttcatatat ctggagtatc ttcaatytta 60
ggagctatta actttatttc aacaattatt aatatgcacc ccgcagggat aaaacctgaa 120
caactatctc tttttacttg atctgtcaaa attacagcaa ttttacttct tctttctcta 180
cccgtactag caggaggaat caccatatta ttaacagatc gaaatattaa tacatcattt 240
tttgatccag ccggaggagg cgacccaatc ttatatcaac accttttctg attctttgga 300
cacccagaag tttata 316
<210>24
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>24
ggagcttctg tagatttagc tatttttagt cttcacatat caggagtctc ctcaatctta 60
ggggccatta actttatttc aacaattatt aatatacacc ccgcaggaat aaaatctgaa 120
caactatctc tttttacttg atctgttaaa attacagcaa ttttacttct tttatctcta 180
cctgttctag caggaggaat tactatacta ttaacagatc gaaatattaa tacatcattt 240
tttgatccag ctgggggagg agacccaatt ttataccagc acttattttg attttttgga 300
cacccagaag tttata 316
<210>25
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>25
ggagcttctg tngatttngc tatttttagc cttcatatat caggagtctc ctcaatctta 60
ggggccatta actttatttc aacaattatt aatatacacc ccgcaggaat aaaatctgag 120
caactatccc tttttacttg atctgttaaa attacagcaa ttttactcct tttatctcta 180
cctgttctag caggaggaat tactatatta ttaacagatc gaaatattaa cacatcattt 240
tttgatccag ctggaggagg ggacccaatt ttataccagc acttattttg attttttggg 300
cacccagaag tctata 316
<210>26
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>26
ggagcctctg ttgacttagc aatttttagt ttacatatat ctggggtttc ctcaatttta 60
ggggcaatta attttatctc aacagttatc aatatgcacc ccgcaggaat aaaacctgaa 120
caactctcac tctttacatg agcagtaaaa attacagcca ttcttctctt gttatccctc 180
cctgtgttgg cggggggaat tactatacta ttaacagatc gaaatattaa tacatcattt 240
tttgaccctg ctgggggagg agatcccatc ctataccaac acctattttg attctttggc 300
cacccagaag tatata 316
<210>27
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>27
ggagcttctg tngatttngc tatttttagc cttcatatat caggagtctc ctcaatctta 60
ggggccatta actttatttc aacaattatt aatatacacc ccgcaggaat aaaatctgag 120
caactatccc tttttacttg atctgttaaa attacagcaa ttttactcct tttatctcta 180
cctgttctag caggaggaat tactatatta ttaacagatc gaaatattaa cacatcattt 240
tttgatccag ctggaggagg ggacccaatt ttataccagc acttattttg attttttggg 300
cacccagaag tctata 316
<210>28
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>28
ggagcttctg tagatttagc tatttttagt cttcacatat caggagtctc ctcaatctta 60
ggggccatta actttatttc aacaattatt aatatacacc ccgcaggaat aaaatctgaa 120
caactatctc tttttacttg atctgttaaa attacagcaa ttttacttct tttatctcta 180
cctgttctag caggaggaat tactatacta ttaacagatc gaaatattaa tacatcattt 240
tttgatccag ctgggggagg agacccaatt ttataccagc acttattttg attttttgga 300
cacccagaag tttata 316
<210>29
<211>314
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>29
gacaccttta tgtagtggcc catttccact ttttatctat ggggggtatt cgcaattctt 60
gcaggaattg tactgattcc ccctattcac aggactaact cttaataata agtacctaaa 120
aattcaattc tactctatat ttattggagt aaacttaact ttttttcccc agcacttctt 180
agggctaaga ggtatacctc gacgatactc agactaccct gatgcttaca ttttattatt 240
gtatcttcaa ttggaagatt aatctccctc attagagtgt tttattttat ttttatttta 300
tgagaaagat tcgc 314
<210>30
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>30
ggggcctctg ttgacttagc aatttttaga ctccatatat ctggtgtatc atcaatctta 60
ggggcaatca acttcatttc aacaattatt aacatgcacc ccaaaggaat aaaacctgaa 120
caactgtccc tttttacatg agcagtaaaa atcactgcaa tccttctttt actatcactt 180
cctgttttag ccggaggaat tactatatta ttaactgatc gaaatattaa tacatcattt 240
tttgacccag ctggaggtgg tgatcctatc ttataccaac atttattttg gttttttggg 300
caccctgaag tttata 316
<210>31
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>31
ggggcctctg ttgacttagc aatttttaga ctccatatat ctggtgtatc atcaatctta 60
ggggcaatca acttcatttc aacaattatt aacatgcacc ccaaaggaat aaaacctgaa 120
caactgtccc tttttacatg agcagtaaaa atcactgcaa tccttctttt actatcactt 180
cctgttttag ccggaggaat tactatatta ttaactgatc gaaatattaa tacatcattt 240
tttgacccag ctggaggtgg tgatcctatc ttataccaac atttattttg gttttttggg 300
caccctgaag tttata 316
<210>32
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>32
ggagcctctg ttgatttagc aatctttaga cttcacatat ctggagtatc atcaatttta 60
ggagcaatta attttatttc aacaattatt aatatacacc ccgcaggaat aaaacctgaa 120
cagctttctc tttttacctg agcagtaaaa attacagcag tccttctttt attatcccta 180
cccgttctag caggaggtat caccatatta ttaacagacc gaaatattaa tacatcattt 240
tttgacccag ctggaggagg agacccgatt ttatatcaac atttattttg attttttggg 300
caccctgaag tatata 316
<210>33
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>33
ggagcctctg ttgatttagc aatctttaga cttcacatat ctggagtatc atcaatttta 60
ggagcaatta attttatttc aacaattatt aatatacacc ccgcaggaat aaaacctgaa 120
cagctttctc tttttacctg agcagtaaaa attacagcag tccttctttt attatcccta 180
cccgttctag caggaggtat caccatatta ttaacagacc gaaatattaa tacatcattt 240
tttgacccag ctggaggagg agacccgatt ttatatcaac atttattttg attttttggg 300
caccctgaag tatata 316
<210>34
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>34
ggagcatctg ttgacttagc aatctttaga cttcacatat ctggagtatc atcaatttta 60
ggagcaatta attttatttc aacaattatt aatatacacc ccgcaggaat aaaacctgaa 120
cagctttctc tttttacctg agcagtaaaa attacagcag tccttctttt attatcccta 180
cccgttctag caggaggtat caccatatta ttaacagacc gaaatattaa tacatcattt 240
tttgacccag ctggaggagg agacccgatt ttatatcaac atttattttg attttttgga 300
cacccagaag tttata 316
<210>35
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>35
ggagcctctg ttgatttagc aatctttaga cttcacatat ctggagtatc atcaatttta 60
ggagcaatta attttatttc aacaattatt aatatacacc ccgcaggaat aaaacctgaa 120
cagctttctc tttttacctg agcagtaaaa attacagcag tccttctttt attatcccta 180
cccgttctag caggaggtat caccatatta ttaacagacc gaaatattaa tacatcattt 240
tttgacccag ctggaggagg agacccgatt ttatatcaac atttattttg attttttggg 300
caccctgaag tatata 316
<210>36
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>36
ggagcatcag tagatctagc catttttagt cttcatatag caggaatttc ctctatcctc 60
ggggcagtta actttatttc aacaattaac aacatacacc cagcaggaat aaagcctgaa 120
caactttctt tatttacttg agctgtaaaa attacagcaa ttcttctttt attatccctc 180
ccagttctag caggaggaat tactatacta ttaactgatc gaaatatcaa tacctcattt 240
tttgatcctg caggaggagg ggatccaatt ctatatcaac acttattctg attttttggc 300
catccagaag tataca 316
<210>37
<211>288
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>37
ggagcatcag tagatctagc catttttagt cttcatatag caggaatttc ctctatcctc 60
ggggcagtta actttatttc aacaattatc aacatacacc cagcaggaat aaagcctgaa 120
caactttctt tatttacttg agctgtnaaa attacagcaa ttcttctttt attatccctc 180
ccagttctag caggaggaat tactatacta ttaactgatc gaaatatcaa tacctcattt 240
tttgatcctg caggaggagg agatccaatt ctatatcaac acttattc 288
<210>38
<211>288
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>38
ggagcatcag tagatctagc catttttagt cttcatatag caggaatttc ctctatcctc 60
ggggcagtta actttatttc aacaattaac aacatacacc cagcaggaat aaagcctgaa 120
caactttctt tatttacttg agctgtaaaa attacagcaa ttcttctttt attatccctc 180
ccagttctag caggaggaat tactatacta ttaactgatc gaaatatcaa tacctcattt 240
tttgatcctg caggaggagg ggatccaatt ctatatcaac acttattc 288
<210>39
<211>288
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>39
ggagcatcag tagatctagc catttttagt cttcatatag caggaatttc ctctatcctc 60
ggggcagtta actttatttc aacaattaac aacatacacc cagcaggaat aaagcctgaa 120
caactttctt tatttacttg agctgtaaaa attacagcaa ttcttctttt attatccctc 180
ccagttctag caggaggaat tactatacta ttaactgatc gaaatatcaa tacctcattt 240
tttgatcctg caggaggagg ggatccaatt ctatatcaac acttattc 288
<210>40
<211>288
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>40
ggaacatcag tagatctagc catttttagt cttcatatag caggaatttc ctctatcctc 60
ggggcagtta actttatttc aacaattatc aacatacacc cagcaggaat aaagcctgaa 120
caactttctt tatttacttg agctgtaaaa attacagcaa ttcttctttt attatccctc 180
ccagttttag cgggaggaat tactatacta ttaactgatc gaaatatcaa tacctcattt 240
tttgatcctg caggaggagg agatccaatt ctatatcaac acttattc 288
<210>41
<211>288
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>41
ggagcatcag tagatctagc catttttagt cttcatatag caggaatttc ctctatcctc 60
ggggcagtta actttatttc aacaattatc aacatacacc cagcaggaat aaagcctgaa 120
caactttctt tatttacttg agctgtaaaa attacagcaa ttcttctttt attatccctc 180
ccagttctag cnggaggaat tactatacta ttaactgatc gaaatatcaa tacctcattt 240
tttgatcctg caggaggagg agatccaatt ctatatcaac acttattc 288
<210>42
<211>288
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>42
ggagcatcag tagatctagc catttttagt cttcatatag caggaatttc ctctatcctc 60
ggggcagtta actttatttc aacaattaac aacatacacc cagcaggaat aaagcctgaa 120
caactttctt tatttacttg agctgtaaaa attacagcaa ttcttctttt attatccctc 180
ccagttctag caggaggaat tactatacta ttaactgatc gaaatatcaa tacctcattt 240
tttgatcctg caggaggagg ggatccaatt ctatatcaac acttattc 288
<210>43
<211>288
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>43
ggagcatcag tagatctagc catttttagt cttcatatag caggaatttc ctctatcctc 60
ggggcagtta actttatttc aacaattatc aacatacacc cagcaggaat aaagcctgaa 120
caactttctt tatttacttg agctgtaaaa attacagcaa ttcttctttt attatccctc 180
ccagttctag caggaggaat tactatacta ttaactgatc gaaatatcaa tacctcattt 240
tttgatcctg caggaggagg ggatccaatt ctatatcaac acttattc 288
<210>44
<211>288
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>44
ggagcatcag tagatctagc catttttagt cttcatatag caggaatttc ctctatcctc 60
ggggcagtta actttatttc aacaattatc aacatacacc cagcaggaat aaagcctgaa 120
caactttctt tatttacttg agctgtaaaa attacagcaa ttcttctttt attatccctc 180
ccagttctag caggaggaat tactatacta ttaactgatc gaaatatcaa tacctcattt 240
tttgatcctg caggaggagg ggatccaatt ctatatcaac acttattc 288
<210>45
<211>316
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>45
ggagcatcag tagatctagc catttttagt cttcatatag caggaatttc ctctatcctc 60
ggggcagtta actttatttc aacaattaac aacatacacc cagcaggaat aaagcctgaa 120
caactttctt tatttacttg agctgtaaaa attacagcaa ttcttctttt attatccctc 180
ccagttctag caggaggaat tactatacta ttaactgatc gaaatatcaa tacctcattt 240
tttgatcctg caggaggagg ggatccaatt ctatatcaac acttattctg attttttggc 300
catccagaag tataca 316
Claims (9)
1. A gene bar code detection kit for ips insects is characterized by at least comprising a gene bar code sequence disc and a primer DRI/DYI reagent; the primer DRI/DYI sequence is as follows:
primer DRI sequence: 5' -AGGAGCATCTGTTGACTT-3 of the formula I,
primer DYI sequence: 5'-ATAAACTTCTGGGTGTCC-3' are provided.
2. The gene barcode detection kit of the ips insect of claim 1, wherein 45 standard barcode sequences are stored in the gene barcode sequence, and the detailed sequences are shown in SEQ ID No.1 to SEQ ID No. 45.
3. The ips insect gene barcode detection kit of claim 1, further comprising the following reagents: taq buffer, MgCl2dNTP mix, Taq DNA polymerase, ddH2O, DNA standards.
4. The gene barcode detection kit for ips according to claim 1, which is characterized by being capable of rapidly detecting 9 ips, wherein the 9 ips specifically is: fir bark beetle, spruce bark beetle, birch bark beetle, Dolomorph bark beetle, nephrolepis bark beetle, mixed bark beetle, frontal bark beetle, pine bark beetle.
5. A method for detecting a gene bar code detection kit of a bark beetle insect is characterized by comprising the following steps:
extracting DNA of a sample to be detected;
using a sample DNA to be detected as a template, carrying out PCR amplification reaction by using the primer of claim 1, carrying out agarose gel electrophoresis on an amplification product, and placing the gel in an imaging system for photographing; the photos show that the bark beetle and the standard DNA sample have clear amplified bands at the position of 316bp, namely the target band;
sequencing the PCR product to obtain a gene sequence;
and comparing the sequence obtained by sequencing the bark beetle to be detected with a standard gene bar code sequence in the gene bar code sequence disk, and judging whether the sequence is the target species.
6. The method for detecting the ips insect gene barcode detection kit according to claim 5, wherein the GenMagBio animal cell tissue/cell genome DNA magnetic bead extraction kit is used to extract the sample to be detected.
7. The method for detecting the ips insect by using the gene barcode detection kit of the ips insect as claimed in claim 5, wherein the PCR amplification reaction system is as follows: the total volume is 50 muL, wherein the total volume contains 5 muL 10 XTaq buffer with KCl and 2mmol/L MgCl2200 mu mol/L dNTP mix, 2U Taq DNA polymerase, 3 mu L DNA template and 1 mu mol/L primer.
8. The method for detecting the ips insect by using the gene barcode detection kit of the ips insect as claimed in claim 5, wherein the PCR amplification reaction procedure is as follows: pre-denaturation at 95 ℃ for 2min before circulation; denaturation at 95 ℃ for 30s, annealing at 52 ℃ for 30s, and extension at 72 ℃ for 45s, and performing 35 cycles; after circulation, the product is extended at 72 deg.C for 10min and stored at-20 deg.C.
9. The method for detecting the ips insect by using the gene barcode detection kit of the ips insect as claimed in claim 5, wherein the specific method for comparing the sequence obtained by sequencing the ips to be detected with the standard gene barcode sequence in the gene barcode sequence disk is as follows:
a: if the similarity of the standard gene barcode sequence is 100%, the standard gene barcode sequence is determined as the type;
b: if the similarity between the gene sequence of the bark beetle to be detected and any standard bar code sequence does not reach 100 percent, translating the gene sequence of the bark beetle to be detected into amino acid according to an invertebrate codon, calculating the genetic distance by using a P-distance model with the amino acid sequence corresponding to the standard gene bar code sequence, and obtaining a standard gene bar code type with the genetic distance between the gene sequence of the bark beetle of unknown species being less than 2 percent, namely a target type; if the genetic distance is more than 2%, judging that the species of the unknown bark beetle is not in the 9 bark beetle range.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010045283.7A CN111187844B (en) | 2020-01-16 | 2020-01-16 | Gene bar code detection kit and detection method for bark beetle insects |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010045283.7A CN111187844B (en) | 2020-01-16 | 2020-01-16 | Gene bar code detection kit and detection method for bark beetle insects |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111187844A true CN111187844A (en) | 2020-05-22 |
| CN111187844B CN111187844B (en) | 2023-09-19 |
Family
ID=70706341
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010045283.7A Active CN111187844B (en) | 2020-01-16 | 2020-01-16 | Gene bar code detection kit and detection method for bark beetle insects |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111187844B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111748638A (en) * | 2020-07-28 | 2020-10-09 | 南京海关动植物与食品检测中心 | Specific primer, kit and method for identifying ips insects based on DNA bar code |
| CN113025724A (en) * | 2021-03-10 | 2021-06-25 | 华南农业大学 | Dual PCR primer, method and kit for identifying small pissodes punctatus |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146811A (en) * | 2012-12-28 | 2013-06-12 | 北京林业大学 | Method to detect dendroctonus valens and detection kit |
| CN104846082A (en) * | 2015-04-29 | 2015-08-19 | 苏州市外来有害生物防控技术中心 | Genetic bar code detection kit of dermestidae insect |
| CN105925697A (en) * | 2016-06-01 | 2016-09-07 | 苏州市外来有害生物防控技术中心 | Pseudococcidae insect gene barcode detection kit and detection method thereof |
| CN106636411A (en) * | 2016-12-28 | 2017-05-10 | 中华人民共和国连云港出入境检验检疫局 | Xyleborus sp insect gene barcode detection kit and detection method thereof |
-
2020
- 2020-01-16 CN CN202010045283.7A patent/CN111187844B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146811A (en) * | 2012-12-28 | 2013-06-12 | 北京林业大学 | Method to detect dendroctonus valens and detection kit |
| CN104846082A (en) * | 2015-04-29 | 2015-08-19 | 苏州市外来有害生物防控技术中心 | Genetic bar code detection kit of dermestidae insect |
| CN105925697A (en) * | 2016-06-01 | 2016-09-07 | 苏州市外来有害生物防控技术中心 | Pseudococcidae insect gene barcode detection kit and detection method thereof |
| CN106636411A (en) * | 2016-12-28 | 2017-05-10 | 中华人民共和国连云港出入境检验检疫局 | Xyleborus sp insect gene barcode detection kit and detection method thereof |
Non-Patent Citations (2)
| Title |
|---|
| ASHFAQ MUHAMMAD等: "DNA barcodes for bio-surveillance: regulated and economically important arthropod plant pests" * |
| 叶兼菱;安榆林;钱路;杨晓军;徐梅;吴翠萍;魏春艳;牛磊;甘英俊;: "检疫性昆虫DNA条形码检测技术的研发与应用实例" * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111748638A (en) * | 2020-07-28 | 2020-10-09 | 南京海关动植物与食品检测中心 | Specific primer, kit and method for identifying ips insects based on DNA bar code |
| CN113025724A (en) * | 2021-03-10 | 2021-06-25 | 华南农业大学 | Dual PCR primer, method and kit for identifying small pissodes punctatus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111187844B (en) | 2023-09-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110551853B (en) | Triple PCR detection primer and kit for rapidly distinguishing African swine fever virus wild strain and gene deletion strain | |
| CN105925697B (en) | A kind of Pseudococcidae insect genes barcode detection kit and its detection method | |
| CN111187844A (en) | Gene bar code detection kit and detection method for ips insect | |
| CN104673932A (en) | Characteristic nucleotide sequence as well as nucleic acid molecular probe and method for identifying ganoderma leucocontextum | |
| CN105821054B (en) | sinkiang bream DNA bar code standard detection sequence and application thereof | |
| CN111424110B (en) | Kit for identifying gleditsia sinensis and identification and quantification method | |
| A’Hara | Detection and identification of Phoma pathogens of potato | |
| CN113621734B (en) | Molecular marker primer combination for rapidly identifying super-large fruit type characters of waxberries and application thereof | |
| CN104846082B (en) | A kind of Dermestidae insect genes barcode detection kit | |
| Feau et al. | DNA-barcoding identification of plant pathogens for disease diagnostics | |
| US20240158783A1 (en) | Dna barcode for screening total soluble protein content index of floccularia luteovirens | |
| CN113151542B (en) | Development method and application of Huashansong genome SNP | |
| CN111748638A (en) | Specific primer, kit and method for identifying ips insects based on DNA bar code | |
| CN107955837B (en) | AFLP primer combination product, kit and method for identifying individual and variety of pig | |
| CN108531648B (en) | Oligonucleotide chip for synchronously detecting 4 porcine diarrheal viruses and application thereof | |
| CN101575651A (en) | LAMP detection kit of porcine parvovirus and detection method thereof | |
| CN114958875B (en) | Screening and application of reference gene metG of citrus yellow-long pathogen | |
| CN109971873A (en) | Identify the method for Listeria Monocytogenes, Yi Shi listeria spp and listeria innocua | |
| CN113025727A (en) | Real-time fluorescent PCR detection method for ips typographus and primer and probe for detection | |
| CN112921106A (en) | Real-time fluorescent PCR detection method for bark beetle of yellow fir, and primer and probe for detection | |
| CN112941207A (en) | Real-time fluorescent PCR detection method for bark beetle of Pinus massoniana, and primer and probe for detection | |
| JP2015154772A (en) | Method for identifying habitat of insect | |
| CN107488741B (en) | A kind of method and its application of double nest-type PRC detections Pseudorabies virus street strain and gene-deleted vaccine strain | |
| CN108456719B (en) | Reaction system and kit for analyzing moringa genetic relationship and application method of reaction system and kit | |
| CN113293223B (en) | Application of primer combination in preparation of reagent for detecting bovine babesia ovale and anaplasma by adopting double PCR (polymerase chain reaction) method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |