CN111172317A - Molecular marker HSRC3911 closely linked with major QTL site in flowering phase of sesame and application thereof - Google Patents
Molecular marker HSRC3911 closely linked with major QTL site in flowering phase of sesame and application thereof Download PDFInfo
- Publication number
- CN111172317A CN111172317A CN202010177574.1A CN202010177574A CN111172317A CN 111172317 A CN111172317 A CN 111172317A CN 202010177574 A CN202010177574 A CN 202010177574A CN 111172317 A CN111172317 A CN 111172317A
- Authority
- CN
- China
- Prior art keywords
- sesame
- molecular marker
- hsrc3911
- qft
- flowering
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of molecular biology and genetic breeding, and relates to a molecular marker HSRC3911 closely linked with a main effect QTL site in the flowering period of sesame and application thereof. The invention utilizes BC1 population and BC1F2 family to position a main effect QTL locus for controlling flowering phase in sesame LG08 linkage group, can explain 41.50% -57.55% of phenotypic variation in different environments, is named as qFT _ LG08, develops SSR molecular marker closely linked with qFT _ LG08, the molecular marker is HSRC3911, the nucleotide sequence is shown as SEQ ID No.1 or SEQ ID No.2, the primer sequence is: HSRC 3911F: 5'-GTTCTAATCAGCTATCGCATTTCTT-3', HSRC 3911R: 5'-ACACACGCACATACACCACGCACAC-3' are provided. By applying the molecular marker, the flowering period of the sesame genetic separation material can be effectively predicted, and the flowering period of the breeding material can be rapidly, accurately and efficiently screened in low generations by molecular marker-assisted selection.
Description
Technical Field
The invention belongs to the technical field of molecular biology and genetic breeding, and particularly relates to a molecular marker HSRC3911 closely linked with a main effect QTL site in a flowering period of sesame and application thereof.
Background
Sesame (Sesamum indicum L.) is an important characteristic high-quality oil crop in China, the planting area of the sesame in the year is about 53.3 million hectares, and the annual yield is about 60-80 million tons. The sesame seed has an oil content of about 55 percent, and unsaturated fatty acids such as oleic acid, linoleic acid and the like reach 85 percent, so the sesame seed oil is an important source of high-quality edible oil. In addition, sesame is rich in a special natural antioxidant substance, namely lignan compounds, and has attracted extensive attention in the aspects of human nutrition and health care, medical treatment, aging resistance and the like. With the improvement of the living standard of people, the yield of the sesame in China is difficult to meet the increasing market demand, and 90 ten thousand tons of sesame are broken through in 2018 in China.
Like most crops, the problem of extremely narrow genetic basis of bred varieties caused by repeated utilization of a few excellent backbone parents also exists in sesame breeding in China, the genetic improvement progress is seriously influenced, and the sesame variety breeding enters a long-term platform period. The foreign germplasm is considered as an important gene resource for widening the genetic basis of crop varieties, and the introduction and utilization of the foreign germplasm can continuously and effectively improve the agronomic characters of local varieties and improve the adaptability of the varieties to the existing biotic or abiotic adversity stress and future environmental changes. In recent years, with the subsidies of the projects of the state '948 (introducing the international advanced agricultural science and technology project)' and the state 'construction of the modern agricultural industry and technology system', the sesame research center of the academy of agricultural sciences in Henan province collects a batch of sesame germplasm resources from Africa, America, south Asia and subtropical regions in China. The resources have wide geographical sources, have rich genetic diversity on the characters of yield, quality, stress resistance and the like, and are rare exotic germplasm in sesame breeding in China. However, the germplasm from tropical zone and subtropical zone has strong photoperiod sensitivity, and under the long-day environment of the temperate zone, the germplasm grows vigorously and flowers late, and some extremely sensitive materials cannot flower at all, so that the method is a limiting factor for effectively utilizing external germplasm. Flowering time is an important character for researching photoperiod sensitivity, and has close relation with important breeding target characters such as crop maturity, yield, quality and the like. In Arabidopsis and rice, the study of flowering (heading) related genes and their regulatory networks has been clarified. Research on the flowering period of sesame is very weak compared to model plants and major crops. Rhind (1935) first reported that short-day flowering of sesame was advanced, that long-day flowering of sesame was delayed, and that sesame was considered as a typical short-day crop. Then, scholars at home and abroad study the influence of the length of sunshine, temperature and the like on the flowering time and the agronomic characters of the sesame, consider that different sesame germplasm resources have difference in photoperiod sensitivity degree, and confirm that the flowering period is complex quantitative characters.
Disclosure of Invention
One of the purposes of the invention is to provide a sesame flowering phase major QTL site qFT _ LG08, which is located in the 8 th linkage group.
The invention also aims to provide a molecular marker HSRC3911 closely linked with the major QTL site in the flowering period of sesame and a primer thereof.
The invention also aims to provide an application method of the molecular marker HSRC3911 in auxiliary selection of sesame flowering phase markers.
In order to achieve the purpose, the technical scheme adopted by the invention is as follows:
the method for obtaining the major QTL site qFT _ LG08 in the flowering period of the sesame comprises the following steps of:
(1) hybridizing a sesame variety Yuzhi No. 4 with obvious difference in flowering periods with a small Bengal seed to obtain an F1 seed, backcrossing with Yuzhi No. 4 as a male parent to obtain a BC1 group, and then selfing to obtain a BC1F2 family;
(2) planting BC1F2 family groups in Henan Pingyu, Nanyang and Luhe respectively, and investigating flowering period to obtain phenotype data;
(3) extracting the total DNA of Yuzhi No. 4, Bengal small seeds and BC1 group leaf genome;
(4) performing PCR amplification on parent DNA by using an SSR marker primer which is autonomously designed and developed, performing electrophoresis on a product in modified polyacrylamide gel, judging the size of a band after dyeing and developing, and screening SSR markers with polymorphism among parents;
(5) carrying out PCR amplification on the BC1 population DNA by using the screened polymorphic SSR marker primers to obtain the genotype data of the BC1 population;
(6) inputting the BC1 population genotype data into IcMapping software to construct a genetic linkage map;
(7) inputting the BC1 population genotype, genetic linkage map and flowering period phenotype data into IcMapping software for QTL positioning; wherein a main effect QTL on LG08 linkage group can be detected in the 3 environments of Henan Pingyu, Nanyang and Luwo, and respectively explains the 41.50%, 57.55% and 45.14% of phenotypic variation, and is named as qFT _ LG 08.
The molecular marker HSR3911 is closely linked with qFT _ LG08 (the genetic distance is 0.8cM), and is a codominant SSR marker designed for autonomous development, a primer of the marker can only amplify a 289bp product in the early flowering variety Yuzhi No. 4, can only amplify a 267bp product in the late flowering variety Menglai small seed, and can amplify 289bp and 267bp products in a heterozygous genotype, wherein nucleotide sequences of the marker are respectively shown as SEQ ID No.1 and SEQ ID No. 2; the primer sequence of HSR3911 is:
HSR3911F:5'–GTTCTAATCAGCTATCGCATTTCTT–3',
HSR3911R:5'–ACACACGCACATACACCACGCACAC–3'。
the application method of the molecular marker HSRC3911 in the auxiliary selection of the sesame flowering phase marker comprises the following steps: the total DNA of the leaves or other tissues of sesame breeding progeny material is amplified by using primers HSR3911F and HSR3911R, and if only 289bp of amplified fragments are obtained, only the allele which is the same as Yuzhi No. 4 exists on the qFT _ LG08 site, so that the material flowers earlier; if only 267bp of amplified fragment is obtained, only the same allele as that of the small Bengal seed exists at the qFT _ LG08 site, and the material blooms late; if two amplified fragments of 289bp and 267bp are obtained, two heterozygous alleles exist at the qFT _ LG08 locus at the same time, and further selfing and selection are still needed.
The invention has the positive beneficial effects that:
(1) according to the invention, a main QTL site qFT _ LG08 for controlling flowering phase is positioned in sesame for the first time, so that 41.50% -57.55% of phenotypic variation can be explained, and an SSR molecular marker HSR3911 closely linked with qFT _ LG08 (genetic distance of 0.8cM) is obtained.
(2) In traditional breeding, the flowering phase is greatly influenced by environmental factors such as the length of sunlight, temperature and the like, and is easily coupled with other yield and quality traits, so that the application of foreign germplasm is seriously influenced. The SSR marker HSR3911 is closely linked with the sesame flowering phase main effect QTL and is a codominant molecular marker, and the allelic state of qFT _ LG08 in the material can be determined by detecting the amplification product of the HSR3911 in the breeding material; the marker can be used for accurately predicting the flowering phase of the sesame breeding material and carrying out marker-assisted selection in early generations, is not influenced by environment, and obviously improves the breeding efficiency.
Drawings
FIG. 1 controls the genomic position of the major QTL locus qFT _ LG08 at anthesis.
FIG. 2 photograph of gel plate of amplified products of primers of molecular marker HSR3911 in BC1 population (Yuzhi No. 4 XMengla small seed) by polyacrylamide gel electrophoresis.
Detailed Description
The following examples are intended to illustrate the invention, all reagent components involved in the practice being commercially available and used according to the conditions in the laboratory manual or as recommended by the manufacturer of the reagents used.
The invention takes sesame varieties Yuzhi No. 4 and small Bengal seeds with obvious difference in flowering time as research materials, and aims to provide a new method for effectively utilizing the external sesame seeds. Yuzhi No. 4 is a good sesame variety cultivated in the last 80 th century of the institute of agricultural science of Temmanen shop, Henan province, and widely planted in Huang-Huai sesame production areas in China in the last 30 years, and is still a reference variety for testing Huang-Huai river basin areas at present; meanwhile, Yuzhi No. 4 is also an important parent in Chinese sesame breeding, and more than 30% of bred varieties have close relationship with the parent. The small Bengal seeds are systematically selected from commercial sesame imported from Bengal, have the advantages of large capsule number, small seeds and high lignan content, but can not normally fruit in middle and high latitude areas after late flowering. The two materials represent two types of sesame germplasm resource light period sensitivity, and are stored in a germplasm resource library of sesame research center of agricultural academy of sciences in Henan province.
Example 1
Obtaining a molecular marker HSR3911 closely linked with a main effect QTL locus in the flowering period of sesame:
(1) BC1 population construction: taking Yuzhi No. 4 as a female parent and Mengla small seeds as male parents to obtain F1 seeds, taking Yuzhi No. 4 as a male parent to carry out backcross to obtain a BC1 population, and then carrying out selfing to obtain a BC1F2 family.
(2) And (3) carrying out phenotype identification at flowering stage: BC1F2 family groups are planted in Henan Pingyu, Nanyang and Luhe respectively, and the phenotype data is obtained by arranging the families in a random block mode, arranging the families in a single-row mode and repeating the families in a triple mode and investigating the flowering period.
(3) DNA extraction: and extracting the DNA of Yunzhi No. 4, Bengal small seeds and BC1 group leaves by adopting a CTAB method. The method comprises the following specific steps: grinding 0.5g of leaves by using liquid nitrogen, adding the powder into a 2ml centrifuge tube, adding 1ml of extraction buffer solution, standing on ice for 10min, centrifuging at 12000rpm for 5min, and removing supernatant; adding 600 mul of lysis buffer solution, mixing uniformly, and carrying out water bath at 65 ℃ for 30-60 min; 1ml of phenol was added: chloroform: mixing isoamyl alcohol (25:24:1, V/V/V) for 30 times, standing for 5min, centrifuging at 12000rpm for 5min, and sucking supernatant; adding isopropanol with the same volume, mixing uniformly, standing for 10min, centrifuging at 12000rpm for 5min, and removing supernatant; two washes with 75% ethanol, blow dried in a fume hood, dissolve with 1 × TE (500 μ l), add two volumes of phenol: chloroform: isoamyl alcohol (25:24:1, V/V/V), mixing uniformly for 50 times, standing for 5min, and centrifuging at 12000rpm for 5 min; sucking supernatant, adding equal volume of chloroform, mixing for 50 times, standing for 5min, and centrifuging at 12000rpm for 5 min; absorbing the supernatant, adding 3mol/L NaAc (pH 5.2) of one tenth of the volume, adding equal volume of isopropanol, mixing uniformly, centrifuging at 12000rpm for 5min, removing the supernatant, washing twice with 75% ethanol, drying in a fume hood, adding a proper amount of TE (50 mu L) containing RNase to dissolve and precipitate, carrying out water bath at 37 ℃ for 30min, and digesting RNA. Detecting DNA concentration with a Nanodrop analyzer, detecting DNA integrity with agarose gel electrophoresis, and storing at-20 deg.C for use.
(4) SSR marker development by genome re-sequencing: the DNA of Yunzhi No. 4 and Bengal small seeds was broken by ultrasound, and a sequencing library was constructed and sequenced on the Illumina HiSeq 2000 platform (completed in Baimichek Biotech, Inc., Beijing). The double-ended Reads is compared with the genome of Zhongzhi No. 13 (Wang et al.2014) by BWA software, InDel and SSR scanning is carried out by utilizing GATK3.7 and MISA respectively, and an SSR region with InDel between Yuzhi No. 4 and Bengal small seeds is screened as a polymorphism candidate SSR marker. SSRs uniformly distributed in the whole genome are selected, primers are designed by using Primer5.0 software, and 1024 pairs of SSR primers are designed in total.
(5) Polymorphism primer screening and group genotype identification: amplifying Yuzhi No. 4 and Bengal small seed DNA by using the synthesized SSR primers, screening a polymorphic SSR primer 315 pair together, and respectively carrying out PCR amplification on BC1 population DNA by using the screened polymorphic SSR marker primers to obtain BC1 population genotype data. The PCR reaction system was 10. mu.L, and contained 1. mu.L of template DNA (25-50 ng/. mu.L), 0.1. mu.L of Taq enzyme (5U/. mu.L), 1. mu.L of 10 XPCR buffer, 0.2. mu.L of dNTPs (10 mM/. mu.L), 0.2. mu.L of forward primer (10. mu.M/. mu.L), 0.2. mu.L of reverse primer (10. mu.M/. mu.L), 7.3. mu.L of ddH2O; the amplification procedure was: pre-denaturation at 94 ℃ for 1 min; denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 30s, 35 cycles, extension at 72 ℃ for 10 min; the amplification product was subjected to 9% non-denaturing polymerizationAnd (3) performing electrophoretic separation on acrylamide gel, wherein the electrophoretic buffer solution is 0.5 xTBE, performing electrophoretic separation for 70min at constant power of 150V, performing silver staining for color development after electrophoresis, and observing the band type.
(6) Genetic linkage map and QTL mapping: inputting the BC1 population genotype data into IcMapping software to construct a genetic map; inputting the BC1 population genotype, genetic linkage map and flowering period phenotype data into IcMapping software for QTL positioning; wherein a main effect QTL on LG08 linkage group can be detected in the 3 environments of Henan Pingyu, Nanyang and Luwo, and respectively explains the 41.50%, 57.55% and 45.14% of phenotypic variation, and is named as qFT _ LG 08.
(7) Acquisition of markers closely linked to major QTLs: HSR3911 is closely linked with qFT _ LG08 (the genetic distance is 0.8cM), only 289bp products can be amplified in the early flowering variety Yuzhi No. 4, only 267bp products can be amplified in the late flowering variety Mengla small seed, and two products of 289bp and 267bp can be amplified in the heterozygous genotype; the primer sequence of the HSR3911 is HSR3911F: 5'-GTTCTAATCAGCTATCGCATTTCTT-3', HSR3916R: 5'-ACACACGCACATACACCACGCACAC-3'.
Example 2
The F2 population is used for verifying the auxiliary selection effect of the molecular marker HSR 3911:
(1) population F2 construction: f1 seeds are obtained by taking Yuzhi No. 4 as a female parent and small Bengal seeds as male parents through hybridization and are selfed to obtain an F2 population.
(2) DNA extraction: f2 population was planted in Hainan, and DNA was extracted from individual plants in the same manner as in example 1.
(3) Genotyping of population F2: f2 single DNA was amplified using HSR3911 primer to identify genotype of F2 population, PCR reaction system, gel and product observation method were the same as example 1. Among 152F 2 individuals, 37 individuals amplified 289bp products, 41 individuals amplified 267bp products, and 74 individuals amplified 289bp and 267bp products simultaneously, which meet the separation ratio of 1:2: 1.
(4) Auxiliary selection effect of molecular marker HSR 3911: 152 individual phenotype data were obtained at the flowering stage of the Hainan trilinear survey (see Table 1, where A represents 289bp product, B represents 267bp product, and H represents 289bp and 267bp products simultaneously). The average flowering days of 37 single plants which only amplified the 289bp product is 37.35 days, the average flowering days of 74 single plants which simultaneously amplified the 289bp and 267bp products is 40.47 days, and the average flowering days of 41 single plants which amplified the 267bp product is 52.12 days, and the difference reaches a very significant level (P is less than or equal to 0.01). The molecular marker HSR3911 is used for auxiliary selection of sesame in the flowering phase, and the effect is better.
TABLE 1152 genotypes of F2 individuals and days to flowering
Sequence listing
<110> sesame research center of academy of agricultural sciences of Henan province
<120> molecular marker HSRC3911 closely linked with major QTL site in sesame flowering phase and application thereof
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>289
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
gttctaatcagctatcgcatttctttttcaattttatcgaccacaaacttgagaagttttgctgaatgataccccctccttgttctggctttcctatttccatgttagtgcgtctttttttgtgtatgtgggtgtgtgtgagggtgtgtgtgtgtgtgtgcgagcgtgtgtgagtgtgattgtgtgtgtgtgtgtgtgtgtgtgagggtatgtgtgtgtgtgcgagcgtgtgtgtatgtgtgtgtggggtgtgtgcggtggtgtgtgtgcgtggtgtatgtgcgtgtgt
289
<210>2
<211>267
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
gttctaatcagctatcgcatttctttttcaattttatcgaccacaaacttgagaagttttgctgaatgataccccctccttgttctggctttcctatttccatgttagtgcgtctttttttgtgtatgtgggtgtgtgtgagggtgtgtgtgtgtgtgtgcgagcgtgtgtgagtgtgattgtgtgtatgtgtgtgtgtgcgagcgtgtgtgtatgtgtgtgtggggtgtgtgcggtggtgtgtgtgcgtggtgtatgtgcgtgtgt
267
<210>3
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
gttctaatcagctatcgcatttctt 25
<210>4
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
acacacgcacatacaccacgcacac 25
Claims (7)
1. A molecular marker HSRC3911 closely linked with a main QTL site qFT _ LG08 in the flowering period of sesame has a genetic distance of 0.8cM from qFT _ LG 08.
2. The molecular marker HSRC3911 according to claim 1, which has a nucleotide sequence shown in SEQ ID No.1 or SEQ ID No. 2.
3. The molecular marker HSRC3911 according to claim 1, wherein the primer sequence is:
HSR3911F:5'–GTTCTAATCAGCTATCGCATTTCTT–3',
HSR3911R:5'–ACACACGCACATACACCACGCACAC–3'。
4. the use of the molecular marker HSRC3911 of claim 1 in marker-assisted selection of sesame flowering stage.
5. The application method of the molecular marker HSRC3911 in the marker-assisted selection of sesame flowering stage of claim 3 comprises the following steps:
the primers are used for amplifying the total DNA of leaves or other tissues of sesame breeding progeny materials, and if only 289bp amplified fragment is obtained, the fact that only the allele which is the same as Yuzhi No. 4 exists at the qFT _ LG08 site of the amplified fragment indicates that the materials bloom earlier; if only 267bp of amplified fragment was obtained, indicating that only the same allele as in young Bengal seed was present at its qFT _ LG08 site, the material bloomed later.
6. The method of application according to claim 5, characterized in that: the PCR reaction system in the amplification process is 10 mu L, and comprises 1 mu L of template DNA, 0.1 mu L of Taq enzyme, 1 mu L of 10 XPCR buffer, 0.2 mu L of dNTPs, 0.2 mu L of forward primer, 0.2 mu L of reverse primer and 7.3 mu L of ddH2O; the amplification procedure was: pre-denaturation at 94 ℃ for 1 min; denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 30s, elongation at 72 ℃ for 30s, 35 cycles, and re-elongation at 72 ℃ for 10 min.
7. The method of application according to claim 6, characterized in that: the concentration of the template DNA is 25-50 ng/mu L, and the Taq enzyme is 5U/mu L; the concentration of the dNTPs is 10 mM/mu L; the concentration of the forward primer and the reverse primer is 10 mu M/mu L.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2020100561637 | 2020-01-18 | ||
CN202010056163 | 2020-01-18 |
Publications (2)
Publication Number | Publication Date |
---|---|
CN111172317A true CN111172317A (en) | 2020-05-19 |
CN111172317B CN111172317B (en) | 2022-08-12 |
Family
ID=70653426
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202010177574.1A Active CN111172317B (en) | 2020-01-18 | 2020-03-14 | Molecular marker HSRC3911 closely linked with major QTL site in flowering phase of sesame and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN111172317B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113215297A (en) * | 2021-05-19 | 2021-08-06 | 中国农业科学院油料作物研究所 | Molecular marker ID0159 closely linked with major QTL site of sesame oil content and application thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2017092110A1 (en) * | 2015-12-03 | 2017-06-08 | 河南省农业科学院芝麻研究中心 | Sesamum indicum inflorescence definite gene sidt1 and snp marker thereof |
CN107287208A (en) * | 2016-03-31 | 2017-10-24 | 未名生物农业集团有限公司 | Florescence control gene and relevant carriers and its application |
-
2020
- 2020-03-14 CN CN202010177574.1A patent/CN111172317B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2017092110A1 (en) * | 2015-12-03 | 2017-06-08 | 河南省农业科学院芝麻研究中心 | Sesamum indicum inflorescence definite gene sidt1 and snp marker thereof |
CN107287208A (en) * | 2016-03-31 | 2017-10-24 | 未名生物农业集团有限公司 | Florescence control gene and relevant carriers and its application |
Non-Patent Citations (3)
Title |
---|
HONGXIAN MEI ET AL.: "High-Density Genetic Map Construction and Gene Mapping of Basal Branching Habit and Flowers per Leaf Axil in Sesame", 《FRONTIERS IN PLANT SCIENCE|》 * |
张体德等: "芝麻开花时间的主基因+多基因遗传分析", 《河南农业科学》 * |
王瑾等: "DNA分子标记技术在芝麻中的应用", 《中国农学通报》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113215297A (en) * | 2021-05-19 | 2021-08-06 | 中国农业科学院油料作物研究所 | Molecular marker ID0159 closely linked with major QTL site of sesame oil content and application thereof |
CN113215297B (en) * | 2021-05-19 | 2022-08-26 | 中国农业科学院油料作物研究所 | Molecular marker ID0159 closely linked with major QTL site of sesame oil content and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN111172317B (en) | 2022-08-12 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Gady et al. | Implementation of two high through-put techniques in a novel application: detecting point mutations in large EMS mutated plant populations | |
kumar Ganesan et al. | Genetic diversity and population structure study of drumstick (Moringa oleifera Lam.) using morphological and SSR markers | |
CN108165653B (en) | InDel molecular marker for identifying pepper maturity and application thereof | |
CN109055395B (en) | Photoperiod insensitive Hd1 allele and molecular marker and application thereof | |
CN106754954B (en) | A kind of corn MS8 gene mutation bodies and its method for identifying molecules and application | |
CN106916897B (en) | Molecular marker for identifying purity of pumpkin hybrid seeds 'Yinhui No. three' of Indian pumpkin and application of molecular marker | |
CN114717355A (en) | Watermelon whole genome SNP-Panel | |
CN107022634A (en) | A kind of molecule labelling method for differentiating rice ear sprouting period gene qHD7.4 | |
CN106929594A (en) | The molecular labeling of the complete red bud mutation character site of the operatic circle skin and its primer and application | |
CN111172317B (en) | Molecular marker HSRC3911 closely linked with major QTL site in flowering phase of sesame and application thereof | |
CN110527741A (en) | A kind of molecular labeling, primer and application with american pumpkin mildew-resistance biological strain 2F gene close linkage | |
CN110607391A (en) | Molecular marker closely linked with character control of Indian pumpkin red fruit peel, primer and application | |
CN113881801B (en) | Molecular marker composition closely linked with deep green stem traits of cucurbita moschata and application of molecular marker composition | |
CN115011717A (en) | Development and detection method and breeding application of watermelon whole-genome SNP-Panel | |
CN111394502B (en) | InDel marker and method for identifying RN type CMS (cytoplasmic male sterility) restoring gene of soybean | |
CN112575101B (en) | Molecular marker related to resistance of Cucurbita pepo PRSV-W virus disease and application thereof | |
CN108018290A (en) | Anthocyanin synthesis control gene and its application | |
CN110106270B (en) | Molecular marker coseparated from melon yellow seed coat and application thereof | |
CN111004857A (en) | Molecular marker primer of major QTL (quantitative trait locus) site of soybean branch number and application of molecular marker primer | |
JP6566479B2 (en) | Four-seasonal markers related to strawberry genus plants and their use | |
Prasad et al. | Advancement in molecular tools of plant population genetics | |
CN113151563B (en) | Method, primer pair and kit for identifying watermelon pulp color and application of kit | |
CN114836560B (en) | SNP molecular marker linked with broccoli hypocotyl color traits and application and method thereof | |
CN113151573B (en) | Sesame seed roundness main effect QTL (quantitative trait locus), molecular marker closely linked with QTL, molecular marker primer and application | |
CN112626256B (en) | Sesame seedling stage drought tolerance molecular marker and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |