CN111171149A

CN111171149A - Humanized single-chain antibody of anti-complement C5 molecule and application thereof

Info

Publication number: CN111171149A
Application number: CN202010110221.XA
Authority: CN
Inventors: 唐晓敏; 杜兰英
Original assignee: Beijing Kangpu Meite Innovation Pharmaceutical Technology Co ltd
Current assignee: Beijing Kangpu Meite Innovation Pharmaceutical Technology Co ltd
Priority date: 2020-02-23
Filing date: 2020-02-23
Publication date: 2020-05-19
Anticipated expiration: 2040-02-23
Also published as: CN111171149B; WO2021164527A1

Abstract

The invention discloses a single-chain antibody of a human anti-complement C5 molecule, wherein a light chain and a heavy chain of the antibody have unique CDR regions, excellent antigen binding activity and an equilibrium dissociation constant K_D(m) to 2.74X 10^‑11In the treatment of MRL/lpr lupus erythematosus mice, the anti-C5 single-chain antibody provided by the invention can obviously improve the survival rate of the mice, and the proteinuria, glomerular score, interstitial inflammation, vasculitis, crescent/necrosis and the like of a treatment groupThe symptoms are obviously improved, and the anti-C5 single-chain antibody provided by the invention has excellent application prospect in preparation of autoimmune disease treatment medicines.

Description

Humanized single-chain antibody of anti-complement C5 molecule and application thereof

Technical Field

The invention discloses a polypeptide, and more particularly discloses an antibody.

Background

The complement system is composed of more than 30 soluble protein molecules, is a part of the natural immune system, and comprises more than 30 molecules such as complement inherent components, various regulatory factors, complement receptors and the like. The complement system can be activated by 3 independent and interconnected pathways, thereby exerting various biological effects such as opsonophagocytosis, cell lysis, inflammation mediation, immunoregulation and immune complex removal, including phagocytosis enhancement, phagocyte chemotaxis enhancement, vascular permeability enhancement, virus neutralization, cytolysis, immune response regulation, and the like. While complement activation provides a valuable first-line defense against potential pathogens, complement activation that promotes a protective inflammatory response may also represent a potential threat to the host. Complement activation and its deposition on target structures can also indirectly cause cell or tissue destruction. Complement activation products that mediate tissue damage are produced at various points in the complement pathway. Inappropriate complement activation on host tissues plays an important role in the pathology of many autoimmune and inflammatory diseases.

There are 3 pathways for complement activation, namely the classical pathway, the mannan-binding agglutination pathway and the alternative pathway. The classical complement activation pathway is activated by an antigen-antibody complex, and components involved in this pathway include C1-C9, which are artificially divided into three groups, i.e., recognition units (Clq, Clr, Cls), activation units (C4, C2, C3) and membrane attack units (C5-C9), according to their roles in the activation process, which play roles in different stages of activation, i.e., recognition stage, activation stage and membrane attack stage, respectively. The Mannan-Binding agglutination pathway is a change of the classical pathway, and Mannan-Binding Lectin (MBL) in plasma directly recognizes N-galactosamine or mannose on the surfaces of various pathogenic microorganisms, so that MASP-1, MASP-2, C4, C2 and C3 are sequentially activated, C3 and C5 convertases which are the same as those of the classical pathway are formed, and the activation pathway of complement cascade enzymatic reaction is activated. The alternative activation pathway is activated by foreign substances, dead tissues, cells, bacteria and the like, and is different from the classical activation pathway in that the activation is over three components of C1, C4 and C2, the C3 is directly activated, and then the chain reaction of the components of C5 to C9 is completed. Following activation of C3, a number of proteins are involved in the classical pathway, such as C1Q, C1r/C1s, C4 and C2. The classical pathway C3 convertase consists of C3bC4b2 a. During activation of the bypass pathway, C3B produced by the complement system can bind to properdin and factor B, forming the complex "PC 3 bB". Then, within this complex, factor D cleaves factor B into Bb and Ba. This cleavage allows Ba to be released from the complex and forms the alternative pathway C3 convertase PC3 bBb. PC3bBb cleaves C3 into C3a and C3b, establishing an amplification loop for the bypass pathway. In addition, in addition to the widely recognized role of the alternative pathway as an independent pathway in complement activation, the classical pathway and mannan-binding agglutination pathway may also provide an amplification loop for initiation of complement activation of the alternative pathway. In this alternative pathway mediated amplification mechanism, activation of the resulting C3 convertase C3bC4b2a cleaves C3 into two active fragments: anaphylatoxin C3a and C3b with opsonizing effect. C3a is a potent anaphylatoxin that can cause a variety of clinical conditions. C3a activates neutrophils, monocytes, platelets, mast cells and T cells. C3a has been shown to be critical for inducing paw edema in an adjuvant-induced arthritis model. Addition of newly formed C3b to the already produced C3 convertase can form C5 convertase, which can cleave C5 to produce C5b and C5 a.

C5 is a glycosylated β globulin having a molecular weight of 190kDa at a concentration of 75 μ g/ml in serum (0.4.mu.M), 1.5-3% of the molecular weight being carbohydrates mature C5 is a heterodimer consisting of a 999 amino acid long, about 115kDa chain α linked to a 656 amino acid long, 75kDa β, a single copy of the coding gene of C5 whose protein translation product is a 1659 amino acid long C5 precursor protein and an 18 amino acid long leader peptide, the C5 precursor protein is cleaved at 655 to 659 amino acids to produce a 1-655 amino acid long β chain and an chain α of 660-1658 amino acid residues, the middle four of which are cleaved (Haviland et al. J. Immunol.1991,146: 362-368).

C5a is generated from the first 74 amino acid residues of the amino terminus of the α chain by cleavage with C5 convertase, and if the cleavage effect of C5 convertase is blocked by binding of a specific molecule at the cleavage site, the molecule can act as a complement inhibitor.

C5a is also a potent anaphylatoxin that causes changes in smooth muscle, vascular tone and vascular permeability. It is also a potent chemokine and activator of neutrophils, monocytes, platelets, endothelial cells and T cells. C5 a-mediated cellular activation can significantly amplify the inflammatory response by inducing the release of other inflammatory mediators, including cytokines, hydrolases, arachidonic acid metabolites, and reactive oxygen species. The other cleavage product, C5b, was inserted into the lipid bilayer on the target cell surface and became the core of C6, C7, C8 and C9 deposition, forming a C5b-9 complex. C5b-9 is also known as the Membrane Attack Complex (MAC). There is evidence that MAC plays an important role in inflammation and in addition it plays a role in lysing the cell pore-forming complex.

While complement activation provides a valuable first-line defense against potential pathogens, complement activation that promotes a protective inflammatory response may also represent a potential threat to the host. For example, C3a and C5a anaphylatoxins may be recruited to the diseased site and activate neutrophils, monocytes, and platelets. These activated cells indiscriminately release destructive enzymes, which may cause organ damage. Therefore, based on the new attempt of downregulating or inhibiting complement activation to treat some inflammatory diseases caused by complement activation, studies have shown that downregulation or inhibition of complement activation is effective for treating some disease indications, such as rheumatoid arthritis, systemic lupus erythematosus, glomerulonephritis, etc., in animal models and in vitro studies. Several endogenous soluble complement inhibitors (C1-inhibitor, soluble complement receptor 1 or sCR1) have been evaluated as recombinant proteins in clinical studies. The anti-C5 recombinant humanized monoclonal antibody can be specifically bonded to human terminal complement protein C5, and can block the release of inflammatory factor C5a and the formation of C5b-9 by inhibiting the cleavage of human complement C5 to C5a and C5 b. Preclinical studies have shown that this antibody has a high affinity for C5, blocks the formation of C5a and C5b-9, and protects mammalian cells from C5b-9 mediated damage (Thomas et al, Mol Immunol 1996,33:1389), and the anti-C5 antibody disclosed in this document only shows properties in terms of affinity and inhibition of neutralization, and has not been demonstrated in terms of inhibition of complement-mediated pathological damage. The technology was obtained in 2002 as U.S. patent grant US6355245, 9 months 2011, and approved by the U.S. Food and Drug Administration (FDA) as an orphan drug for treating a typical hemolytic uremic syndrome (aHUS) patient, i.e., anti-C5 antibody marketed as Eculizumab (Eculizumab). However, the efficacy of eculizumab in the clinical application of treatment of hemolytic uremic syndrome is still controversial. The existing anti-C5 antibody still has some technical difficulties in inhibiting complement activation, such as difficulty in obtaining highly specific anti-C5 antibody, immunogenicity of the murine monoclonal antibody or chimeric antibody prepared by the prior art to human body, and difficulty in reaching some lesion tissues due to the overrun of molecular weight and the obstruction of space conformation of the antibody molecule. These technical problems limit, to varying degrees, the practical application of inhibition of complement activation by anti-C5 antibodies. There remains a need in the art to develop antibody drugs with targeted inhibitory effects for specific indications.

The single-chain antibody (ScFv) is a small-molecule antibody prepared by a genetic engineering method, is a recombinant antibody formed by connecting a heavy chain variable region (VH) and a light chain variable region (VL) of an antibody by a flexible polypeptide (generally 12-15 amino acids), and has the molecular weight which is only one sixth of that of the original natural antibody, but the single-chain antibody contains all antigen binding sites, so the single-chain antibody maximally retains the antigen binding activity of the antibody, is a small fragment with the antigen binding activity of a parent antibody, and can reach the lesion tissues which are difficult to reach by the conventional antibody.

The antibody library technology appeared in the last 90 th century bypasses the hybridoma approach necessary in the previous monoclonal antibody development process, and even does not need immunization, so that the preparation of humanized antibody reaches a brand-new level. More importantly, it makes the dream of long-term desire for obtaining therapeutic humanized antibodies. Phage antibody libraries were the earliest and most widely used antibody libraries at present. Phage display is a technique which is first established by Smith (Science,1985,228(4705):1315-1317) and in which a foreign protein gene is fused with a capsid protein gene of a phage so that the foreign protein is expressed and displayed on the surface of the phage. The phage antibody library utilizes the principle to express antibodies with different specificities on different phage surfaces and uses antigens to screen the antibodies(Science,1989, 246 (4935): 1275-1281; PNAS,1991, 88 (18): 7978-7982, Human Antibodies, 1997, 8 (4): 155-168). The target cells used to construct the phage antibody library can be hybridoma cells, immunized human B cells, or non-immunized human B cells. The nonimmunized human B lymphocytes are the most widely used target cells at present, have large library capacity and theoretically contain all human antibody genes. The screening of the phage antibody library is a process for simulating in vivo antibody affinity maturation, a phage library of which the surface expresses specific antibodies is adsorbed by immobilized antigens, then free phage is eluted, and host bacteria are infected by the phage adsorbed by the antigens for proliferation and amplification and then multiple rounds of adsorption-elution-amplification are carried out until specific humanized antibodies are screened. The establishment of large-capacity antibody library is the key to obtain high-affinity humanized antibody, if the capacity of constructed phage antibody library is more than 10¹⁰Then it is possible to screen for high affinity (. gtoreq.10)⁹M^－1) The specific antibody of (1).

The invention aims to provide a humanized single-chain antibody capable of being specifically combined with a C5 molecule by a phage antibody library technology, and further provides application of the humanized single-chain antibody in preparation of a medicament for treating autoimmune diseases.

Disclosure of Invention

In view of the above, the present invention provides, in a first aspect, a humanized single chain antibody against complement C5, wherein the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain variable region of the antibody are represented by the amino acid sequences at positions 25-35, 51-57 and 90-99 of SEQ ID No.1, respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain variable region of the antibody are represented by the amino acid sequences at positions 30-35, 50-66 and 99-108 of SEQ ID No.3, respectively.

In a preferred embodiment, the amino acid sequence of the antibody light chain variable region is shown in SEQ ID NO.1, and the amino acid sequence of the antibody heavy chain variable region is shown in SEQ ID NO. 3.

In a more preferred embodiment, the antibody light chain variable region is linked to the heavy chain variable region by a flexible polypeptide having the amino acid sequence shown in SEQ ID No. 5.

Secondly, the invention also provides a polynucleotide for coding the single-chain antibody, wherein the sequence of the polynucleotide for coding the variable region of the light chain of the antibody is shown by SEQ ID NO.2, and the sequence of the polynucleotide for coding the variable region of the heavy chain of the antibody is shown by SEQ ID NO. 4.

In a preferred embodiment, the polynucleotide encoding the variable region of the light chain of the antibody is linked to the polynucleotide encoding the variable region of the heavy chain of the antibody by a polynucleotide encoding a flexible polypeptide having the sequence shown in SEQ ID NO. 6.

The present invention also provides a vector expressing the polynucleotide encoding the single-chain antibody.

In a preferred embodiment, the vector is pEE14.1/V_L-Linker-V_H。

Still further, the present invention provides a host cell comprising the above vector, wherein the cell is a CHO cell.

Finally, the invention provides the application of the single-chain antibody in preparing the medicine for treating the autoimmune disease.

In a preferred embodiment, the disease is rheumatoid arthritis or systemic lupus erythematosus.

The light chain and the heavy chain of the single-chain antibody of the anti-C5 disclosed by the invention have unique CDR regions, show excellent antigen binding activity on antigen binding capacity and balance dissociation constant K_D(m) to 2.74X 10^-11. The anti-C5 single chain antibody disclosed by the invention can obviously improve the survival rate of mice in the treatment of MRL/lpr lupus erythematosus mice, the whole treatment process of a high-dose treatment group can completely protect the MRL/lpr lupus erythematosus mice, the survival rate is 100%, and the survival rate of a low-dose group can be maintained to be more than 80% even at the 24 th week. And the symptoms of proteinuria, glomerular score, interstitial inflammation, vasculitis, crescent/necrosis and the like of the treatment group are obviously improved, and the anti-C5 single-chain antibody provided by the invention has excellent application prospect in preparation of the autoimmune disease treatment drug.

Drawings

FIG. 1. 12% SDS-PAGE identification of anti-C5 antibody;

FIG. 2 Western Blot identification profile of anti-C5 antibody;

FIG. 3 is a graph of survival rates for single chain antibodies targeting C5 in MRL/lpr mice;

FIG. 4 is a graph comparing changes in proteinuria in MRL/lpr mice treated with single chain antibody targeting C5.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are only illustrative and do not limit the scope of protection of the invention as defined by the claims.

Example 1 preparation of anti-C5 Single chain antibody

The anti-C5 single-chain antibody is screened by the following method, which comprises the following steps:

1.1 construction and expression of single chain antibody phage expression libraries see example 1 of Chinese patent application CN109575132A, the disclosure of CN109575132A being incorporated by reference in the specification of the present application.

1.2 screening of recombinant phage antibodies: polyethylene dishes were coated with C5 antigen (complete Technology, Inc; cat # A120Lot, Access # P06684), and the supernatants containing the recombinant phages were incubated with the dishes for 2 hours at 37 ℃. The plate was washed 20 times with PBS, followed by 20 times with PBST (0.05% Tween 20 in PBS), and the PBST was discarded. 10mL of TG1 cells in logarithmic growth phase were added and cultured at 37 ℃ for 1 hour. Centrifuging, collecting the supernatant, and performing the next round of screening. The screening process of "adsorption-elution-propagation" was repeated 2 times. The phage surface display library of enriched clones can be generated by superinfection of M13K07 helper phage.

1.3 screening and identification of monoclonal recombinant phages: after the third round of selection, TG1 was diluted by 2 XYT to multiple degrees (stock solution, 1:10, 1:100, 1:1000) and spread on SOBAG solid medium (molecular cloning, third edition, translation of Huang Petang, etc.) and cultured overnight at 30 ℃. 94 single colonies were randomly picked from the plate and inoculated into 100. mu.l of 2 XYTAG (containing 100. mu.g/mL ampicillin and 100. mu.g/mL ampicillin)2% glucose) was added to the culture solution, and the mixture was cultured overnight at 30 ℃. 20 μ l of the culture medium was transferred to 200 μ l of a medium containing 5X 10⁸pfu/mL M13K07 in 2 XYTAG medium, cultured at 37 ℃ for 2 hours. Centrifugation was performed, and 200. mu.l of 2 XYTAK (2 XYT containing 100. mu.g/mL ampicillin and 50. mu.g/mL kanamycin) was used to resuspend the precipitated cells, and the cells were cultured overnight at 30 ℃. Centrifuging and collecting the supernatant to obtain the monoclonal recombinant phage.

The enzyme-linked plates were coated with C5 antigen, 0.5% BSA as a negative control, and goat anti-M13 phage antibody as a positive control. Blocking with 1% BSA at 37 ℃ for 1 hour. 100 μ l of an equal volume of the mixture of recombinant phage antibody supernatant and blocking solution was added to the enzyme-linked plate, and M13 phage was added to the control wells. After incubation at 37 ℃ for 1 hour, the plates were washed 3 times with PBST (PBS containing 0.05% Tween 20) and 3 times with PBS. Mu.l of goat anti-M13 phage antibody IgG-HRP (1:2000) was added to each well and incubated at 37 ℃ for 1 hour. PBST and PBS were washed 3 times each, and freshly prepared substrate H was added₂O₂OPD, reacting at room temperature for 20min, adding 50 μ l 2MH₂SO₄Terminating the reaction at A₄₉₀The light absorption value of each well was measured. Among the positive clones, those with the highest binding activity to C5 were selected, which had an optical absorption value of 2.1 times or more that of the negative control.

1.4 DNA sequence analysis of the recombinant plasmid of the positive clone: the DNA sequence of the anti-C5 single-chain antibody on the positive recombinant plasmid is determined by using a T7 DNA sequence TAATACGACTCACTATAGGG, and as a result, the gene has the nucleotide sequence shown in SEQ ID NO: 7 consisting of 756 bases, and the light chain variable region coding gene of which has the nucleotide sequence shown in SEQ ID NO: 2, the flexible polypeptide connecting and coding gene has a sequence shown in SEQ ID NO: 6, and the heavy chain variable region coding gene has a sequence shown in SEQ ID NO: 4. The anti-C5 single-chain antibody coding gene is connected in series in the form of SEQ ID NO: 2-SEQ ID NO: 6-SEQ ID NO: 4, is named V_L-Linker-V_H(also known as ScFv). V_L-Linker-V_HEncoding anti-C5 single chain antibody having the amino acid sequence of SEQ ID NO: 1-SEQ ID NO: 5-SEQ ID NO: 3 serial amino acid residue sequence. By further sequence analysis, the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain variable region are shown in SEQ ID NThe amino acid sequences of 25 th to 35 th, 51 th to 57 th and 90 th to 99 th positions of O.1, and the amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain variable region are shown as the amino acid sequences of 30 th to 35 th, 50 th to 66 th and 99 th to 108 th positions of SEQ ID NO.3, respectively.

1.5 construction of anti-C5 single-chain antibody ScFv eukaryotic expression vector and screening of high-efficiency expression cell strain

In order to obtain higher biological protein molecules which are closer to natural in terms of molecular structure, physicochemical properties and biological functions, the anti-C5 single-chain antibody V obtained in step 1.4_L-Linker-V_HCloning the fusion gene into a high-efficiency eukaryotic expression vector pEE14.1(Lonza) to obtain the single-chain antibody V carrying anti-C5_L-Linker-V_HThe recombinant expression vector of the fusion gene is named as pEE14.1/V_L-Linker-V_H. Then the recombinant plasmid pEE14.1/V is prepared by utilizing liposome_L-Linker-V_HTransfection into Chinese hamster ovary cells CHO. 24 hours after transfection, the medium was aspirated and 10mL of fresh selective medium DMEM + 10% FCS +25 μm MSX was added. In the presence of 5% CO₂The mixed gas of (2) was cultured in a 37 ℃ incubator with a humidity of 98%. After 2 weeks, about 1-2mm clones appeared, and the appeared clones were transferred to 24-well plates using cloning rings, and the culture was continued by adding 1mL of selective medium DMEM + 10% FCS +25 μm MSX per well. After the transformants had grown for 5 days, the supernatant was aspirated. Mu.l of the supernatant was added to an enzyme-linked plate coated with C5 antigen, incubated at 37 ℃ for 1 hour, and the plate was washed 3 times with PBS. Mu.l of HRP-labeled IgG secondary antibody (1:2000) was added to each well, and the mixture was incubated at 37 ℃ for 1 hour. The plate was washed 3 times with PBS and freshly prepared substrate H was added₂O₂OPD, reacted at room temperature for 20min, 50. mu.l of 2M H was added₂SO₄Terminating the reaction at A₄₉₀The light absorption value of each well was measured. The positive clones with the light absorption value more than 2.1 times of that of the negative control are selected, and the positive clones with the strongest binding activity with C5 are selected, namely the CHO cell strain for efficiently expressing the anti-C5 single-chain antibody.

1.6 purification of anti-C5 Single chain antibodies

The CHO cell strain with high expression efficiency is amplified and cultured, and the supernatant is harvested. The supernatant was slowly added to HiTrap N-hydroxysuccinimide column (Amersham Biosciences)) In (1), purifying the single-chain antibody. Eluting with 0.01mol/L PBS (pH7.4) at a flow rate of 1mL/min to obtain eluate OD₂₈₀<Up to 0.02. 0.1mol/L glycine-HCl buffer solution of pH 2.4 was added at a flow rate of 1mL/min, and the adsorbed fraction was collected and immediately neutralized with 1mol/L sodium carbonate to prevent protein denaturation. The results of SDS-PAGE and Western Blot are shown in figure 1 and figure 2, the target protein with about 26KD is obtained by expression, and the protein can be specifically combined with C5, which is consistent with the expected results, and the anti-C5 single-chain antibody with high purity is obtained.

Example 2 analysis of kinetics of interaction of anti-C5 Single-chain antibody with C5 ligand

The kinetic analysis of the interaction between the anti-C5 single-chain antibody and the C5 ligand is carried out by using a Surface Plasmon Resonance (SPR) detection system.

2.1 laboratory instruments and reagents

The instrument comprises the following steps: reichert2SPR (Reichert corporation), chip: SAM chip (for macromolecular detection), (ReichertInc., PART NO: 13206061).

Reagent: 500ml of 1xPBST (filtration, 0.22uM filter filtration), EDC (now ready for use), NHS (now ready for use), 1 mM pH8.5 ethanolamine (5-10ml), 10mM pH2.0 HCl (5-10ml), 10mM pH2.0 glycine (5-10 ml).

2.2. Experimental procedure

2.2.1 Pre-enrichment

2.2.1.1 proteins were diluted to 10. mu.g/mL, 200. mu.L with sodium acetate at different pH.

TABLE 1 sodium acetate pH selection Table

Name of protein	pH value of sodium acetate	Fixed channel
			Antigens	6.0/5.5/5.0/4.5/4.0	A certain channel

2.2.1.2 protein was injected in a channel, 25. mu.L/min, 2 min.

2.2.1.3 appropriate pH conditions (pH5.0) were selected.

2.2.2 protein immobilization

2.2.2.176.66 mg EDC and 11.52mg NHS were dissolved in 1mL ultrapure water, 200. mu.L was taken, and both the right and left channels were activated, 10. mu.L/min, 7 min.

2.2.2.2 antigens were diluted to 50. mu.g/mL, 200. mu.L with sodium acetate at the appropriate pH and immobilized separately in a channel. 10 μ L/min,7 min.

2.2.2.3 if the fixed amount is not sufficient at one time, the injection of antibody is repeated.

2.2.2.4 mu.L of 1M ethanolamine (pH8.5) was taken and the two channels were blocked at 10. mu.L/min for 7 min.

2.2.3 antibody-antigen binding preliminary experiments

2.2.3.1 antibodies were diluted with PBST to 100nM, 25. mu.L/min, bound for 3min, and dissociated for 5 min.

2.2.3.210 mM pH2.0 HCl (or 10mM pH2.0 glycine) regeneration for 2min, dissociation for 2 min.

2.2.4 official experiment

2.2.4.1 antibodies were diluted to 100nM with PBST, 2-fold more diluted, 7 gradients, 25 μ L/min, 3min binding, 5min dissociation.

2.2.4.210 mM pH2.0 HCl (or 10mM pH2.0 glycine) regeneration for 2min, dissociation for 2 min.

The SPR detection result is shown in Table 2, and the detection shows that the anti-C5 single-chain antibody provided by the invention shows excellent antigen binding efficiency.

TABLE 2 kinetic parameters for the binding of anti-C5 single chain antibodies to C5

Example 3 in vitro inhibition of complement activation by anti-C5 Single chain antibody

To determine complement inhibitory activity, 60% -80% of the fused CHO cells were separated with EDTA, washed 2 times with DMEM, and then resuspended in DMEM to a final concentration of 10⁶Individual cells/mL. Adding 100mL/L rabbit anti-CHO cell membrane antiserum into the cell suspension, and acting at 4 deg.C for 30min to sensitize the cells. The antiserum was then discarded and the cells resuspended in NHS diluted in DMEM to a final volume of 50. mu.L or 100. mu.L. The cells were incubated at 37 ℃ for 60min and finally cell viability was measured by the placental blue staining exclusion method (both live and dead cells were counted). The single-chain antibody was diluted with DEME, added to NHS, and then added to the CHO cell suspension. The final concentration was based on the control CHO cell lysis at which 100g/L NHS resulted in approximately 90% antibody sensitization. Complement-mediated inhibition of erythrolysis experiments sheep erythrocytes sensitized with antibody (EAs) were tested. Hemolysis assay was performed in gelatin phorona buffer (GVB)⁺⁺) In a final volume of 300. mu.L, containing 2.5X 10⁷EAs, NHS were diluted 1: 300. The reaction mixture was incubated at 37 ℃ for 60min and finally stopped by adding 300. mu.L of a solution containing 10mmol/L EDTA-PBS. Centrifuging, collecting supernatant, and quantitatively detecting heme in the supernatant with a spectral imager at 413nm wavelength.

Detecting the activity of the single-chain antibody complement inhibitor: the results of complement-mediated CHO cell and erythrocyte lysis experiments show that in cell lysis inhibition experiments, the anti-C5 single-chain antibody has obvious effect of inhibiting the antibody-sensitized CHO cell and erythrocyte lysis (see Table 3 in detail), and the anti-C5 single-chain antibody can effectively inhibit the classical complement activation pathway.

TABLE 3 concentration of complement inhibitor that inhibits lysis of 50% of cells

Example 4 therapeutic Effect of C5-Targeted Single chain antibodies on the MRL/lpr mouse model of lupus erythematosus

The MRL/lpr lupus erythematosus mouse model, which was first established in 1979 by Murphy and Roths, was made from multiple strains of mice through a complex hybridization process over 12 generations, and has 75% of its genes from LG/J, 12.6% from AKR/J, 12.1% from C3H/Di, and 0.3% from C57BL/6 strain mice. MRL/lpr mice contain recessive mutations in the Fas gene associated with spontaneous apoptosis of cells, the appearance of lymphoproliferative genes, resulting in T cell proliferation, generalized lymphadenectasis, and erosive arthritis, anti-DNA, anti-Sm, anti-Su, anti-nucleoside P antibodies, high titer ANA, hypergammaglobulinemia, and rheumatoid factor. The mouse was first developed at 8 weeks when autoantibodies were detectable in the serum. Lymphadenitis was observed at 12 weeks. At 12-16 weeks, MRL/lpr mice began to develop large amounts of autoantibodies, including anti-double stranded DNA antibodies. Multiple organs were involved at the age of approximately 16 weeks and stable deterioration of renal function characterized by severe proteinuria occurred. 16-24 weeks old mice develop proliferative immune complex mediated glomerulonephritis, vasculitis, and eventually death due to renal failure, with a mortality rate of 50%.

5.1 Single chain antibody targeting C5 significantly improved survival of MRL/lpr lupus erythematosus mice

In this example, 16-week MRL/lpr mice that had developed renal failure symptoms were randomly divided into two groups, the first group was a treatment group and received a high dose of 0.4mg/W (n-30) and a low dose of 0.1mg/W (n-30) ScFv weekly from week 16 to 24, and the second group (n-32) was a control group and received an equal amount of PBS weekly. Both groups were administered by tail vein injection. The protection rate of the single chain antibody targeting C5 against MRL/lpr lupus erythematosus mice was evaluated based on the survival rate of the administered group and the control group. As shown in fig. 3, in the mice treated with the single chain antibody targeting C5, since C5 in the complement activation pathway is effectively inhibited by the single chain antibody targeting C5, the survival rate of MRL/lpr lupus erythematosus mice is significantly improved, the whole treatment process of the high dose treatment group can completely protect the MRL/lpr lupus erythematosus mice, the survival rate is 100%, and the survival rate of the low dose group can be maintained at 80% or more even at week 24.

5.2 Single chain antibody targeting C5 significantly improved MRL/lpr lupus erythematosus mouse proteinuria symptoms

Mice were placed in metabolic cages to study the effect of single chain antibodies targeting C5 on urinary albumin secretion in MRL/lpr lupus erythematosus mice. 24 hour urine from mice was collected every two weeks starting at 16 weeks. To prevent bacterial growth ampicillin, gentamicin and chloramphenicol were added to the collection tubes. A standard curve was drawn by ELISA using mouse albumin samples of known concentration and urine albumin secretion was determined for the experimental mice and creatinine content in the mouse urine was determined using a Beckman biochemical analyzer (Beckman coulter). The final evaluation results are expressed as urinary albumin (mg) to creatinine (mg) ratio for 24 hours per experimental mouse. A higher urinary albumin creatinine ratio indicates impaired kidney function. As shown in fig. 4, the average urinary albumin creatinine ratio of the treatment group (0.1mg/W, n ═ 26) treated with the single-chain antibody targeting C5 was about 2.8 to 3.8 at

weeks

22 and 24, while the protein urine level of the treatment group (P <0.01) was significantly decreased at about 3.8 to 5.5 in the control group (n ═ 26), which proves that the single-chain antibody targeting C5 provided by the present invention can significantly improve the symptom of impaired renal function.

5.3 Single chain antibody targeting C5 significantly improved kidney inflammation in MRL/lpr lupus erythematosus mice

After the experiment is finished, the kidney of the excised mouse is longitudinally dissected into two halves, wherein one half is subjected to immunofluorescence analysis, the other half is fixed by 10% neutral formaldehyde, the other half is subjected to solid paraffin embedding and sectioning, the sectioning of the kidney tissue processed by paraffin is dyed by a hematoxylin-eosin dyeing method and a periodic acid snowflake dyeing method, glomerulonephritis, hyperplasia, crescent moon formation and necrosis symptoms observed by the sectioning are respectively graded by a blind method, and meanwhile, the change of renal interstitium is also graded. The scores were divided into five grades of 0, 1, 2, 3 and 4, with 0 being no damage and 4 being severe damage. Perivascular inflammatory exudation was evaluated in a semi-quantitative manner by blinding two independent observers on more than 10 vessels per section. Inflammation was scored as 0-3, 0 as no inflammation, 1 as less than 50% of the vessels surrounded by 3 layers of cells, 2 as more than 50% of the vessels surrounded by 3-6 layers, 3 as most severely represented, more than 6 layers surrounded by cells. The evaluation results are shown in Table 4.

TABLE 4 comparison of renal Damage in MRL/lpr mice between week 24 after 16 to 23 weeks of treatment and PBS control

As can be seen from the table, ScFv targeting C5 reduced the inflammatory response of the kidney in the treatment of MRL/lpr lupus erythematosus mice. The glomerular score, interstitial inflammation, vasculitis and crescentic/necrosis were significantly reduced in the treated group (0.1mg/W) compared to the control group (P < 0.05).

Sequence listing

<110> Beijing Congpumet Innovation medicine science and technology, Limited liability company

<120> humanized single-chain antibody of anti-complement C5 molecule and application thereof

<160>7

<170>SIPOSequenceListing 1.0

<210>1

<211>110

<212>PRT

<213>Homo sapiens

<400>1

Met Ala Ser Tyr Glu Leu Thr Gln Pro Pro Ser Val Ser Val Ala Pro

1 5 10 15

Gly Gln Thr Ala Arg Ile Thr Cys Ser Gly Asp Ala Leu Gly Asp Lys

20 25 30

Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val

35 40 45

Ile Tyr Glu Asp Ser Lys Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser

50 55 60

Gly Ser Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Thr Gln

65 70 75 80

Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Ala Trp Glu Asp Asp Ala

85 90 95

Glu His Gln Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

100 105 110

<210>2

<211>330

<212>DNA

<213>Homo sapiens

<400>2

atggccagct acgaactgac ccagccgccg agcgtgtcgg tggcgccggg tcagaccgcg 60

cgtatcacct gctcgggcga tgcgctgggc gataaatacg cgagctggta tcagcagaaa 120

ccgggtcagg caccggtgct ggtgatttac gaagattcta aacgcccgtc tggcatcccg 180

gaacgcttta gcggctcgaa ttcgggcaac accgcgaccc tgaccattag cggcacccag 240

gcggaggatg aggcggacta ttactgctcg gcgtgggagg acgacgctga gcatcaggtg 300

tttggcggtg gcaccaaact gaccgtgctg 330

<210>3

<211>120

<212>PRT

<213>Homo sapiens

<400>3

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg His Tyr Pro Gly Pro Tyr Ala Phe Asp Val Trp Gly Gln Gly

100 105 110

Thr Leu Val Thr Val Ser Ser Ala

115 120

<210>4

<211>360

<212>DNA

<213>Homo sapiens

<400>4

gaagtgcaat tggtggaaag cggtggcggt ctggtgcagc cgggtggcag cctgcgtctg 60

agctgcgcag cgagcggctt cacctttagc agctacgcga tgagctgggt gcgccaggca 120

ccgggtaaag gtctggaatg ggtgagcgcg attagcggta gcggcggcag cacctactat 180

gcggatagcg tgaaaggccg ttttaccatc tcgcgtgata actcgaaaaa caccctgtac 240

ctgcagatga acagcctgcg tgcggaagat accgcggtgt attattgcgc acgtcattat 300

cctggtccgt atgctttcga tgtctggggt cagggcactc tggtgaccgt gtcgagcgcg 360

<210>5

<211>22

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>5

Gly Ser Gly Gly Ser Thr Ile Thr Ser Tyr Asn Val Tyr Tyr Thr Lys

1 5 10 15

Leu Ser Ser Ser Gly Ser

20

<210>6

<211>66

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ggcagcggcg gctcgaccat aacttcgtat aatgtatact atacgaagtt atcgagctcg 60

ggcagc 66

<210>7

<211>756

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

atggccagct acgaactgac ccagccgccg agcgtgtcgg tggcgccggg tcagaccgcg 60

cgtatcacct gctcgggcga tgcgctgggc gataaatacg cgagctggta tcagcagaaa 120

ccgggtcagg caccggtgct ggtgatttac gaagattcta aacgcccgtc tggcatcccg 180

gaacgcttta gcggctcgaa ttcgggcaac accgcgaccc tgaccattag cggcacccag 240

gcggaggatg aggcggacta ttactgctcg gcgtgggagg acgacgctga gcatcaggtg 300

tttggcggtg gcaccaaact gaccgtgctg ggcagcggcg gctcgaccat aacttcgtat 360

aatgtatact atacgaagtt atcgagctcg ggcagcgaag tgcaattggt ggaaagcggt 420

ggcggtctgg tgcagccggg tggcagcctg cgtctgagct gcgcagcgag cggcttcacc 480

tttagcagct acgcgatgag ctgggtgcgc caggcaccgg gtaaaggtct ggaatgggtg 540

agcgcgatta gcggtagcgg cggcagcacc tactatgcgg atagcgtgaa aggccgtttt 600

accatctcgc gtgataactc gaaaaacacc ctgtacctgc agatgaacag cctgcgtgcg 660

gaagataccg cggtgtatta ttgcgcacgt cattatcctg gtccgtatgc tttcgatgtc 720

tggggtcagg gcactctggt gaccgtgtcg agcgcg 756

Claims

1. A humanized single-chain antibody of anti-complement C5 molecule, characterized in that the amino acid sequences of CDR1, CDR2 and CDR3 of the variable region of the antibody light chain are shown as the amino acid sequences at positions 25-35, 51-57 and 90-99 of SEQ ID NO.1, respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 of the variable region of the antibody heavy chain are shown as the amino acid sequences at positions 30-35, 50-66 and 99-108 of SEQ ID NO.3, respectively.

2. The single-chain antibody of claim 1, wherein the amino acid sequence of the variable region of the antibody light chain is shown as SEQ ID No.1, and the amino acid sequence of the variable region of the antibody heavy chain is shown as SEQ ID No. 3.

3. The single chain antibody of claim 2, wherein the antibody light chain variable region is linked to the heavy chain variable region by a flexible polypeptide having the amino acid sequence shown in SEQ ID No. 5.

4. A polynucleotide encoding the single chain antibody of any one of claims 1 to 3, wherein the sequence of the polynucleotide encoding the light chain variable region of the antibody is represented by SEQ ID No.2 and the sequence of the polynucleotide encoding the heavy chain variable region of the antibody is represented by SEQ ID No. 4.

5. The polynucleotide of claim 4, wherein the polynucleotide encoding the variable region of the light chain of the antibody is linked to the polynucleotide encoding the variable region of the heavy chain of the antibody by a polynucleotide encoding a flexible polypeptide having the sequence shown in SEQ ID No. 6.

6. A vector expressing the polynucleotide encoding a single chain antibody of claim 5.

7. The vector of claim 6, wherein the vector is pEE14.1/V_L-Linker-V_H。

8. A host cell comprising the vector of claim 7, wherein said cell is a CHO cell.

9. Use of a single chain antibody according to any one of claims 1 to 3 for the manufacture of a medicament for the treatment of an autoimmune disease.

10. Use according to claim 9, wherein the disease is rheumatoid arthritis or systemic lupus erythematosus.