CN111171137A - T cell receptor for identifying AFP antigen short peptide and its coding sequence - Google Patents

Abstract

The present invention provides a T Cell Receptor (TCR) capable of specifically binding short peptide FMNKFIYEI derived from AFP antigen, said antigen short peptide FMNKFIYEI being capable of forming a complex with HLA a0201 and being presented together on the cell surface. The invention also provides nucleic acid molecules encoding the TCRs and vectors comprising the nucleic acid molecules. In addition, the invention provides cells that transduce a TCR of the invention.

Description

T cell receptor for identifying AFP antigen short peptide and its coding sequence

Technical Field

The present invention relates to a TCR capable of recognizing a short peptide derived from an AFP antigen and the coding sequence thereof, to AFP-specific T cells obtained by transduction of the above TCR, and to their use in the prevention and treatment of AFP-related diseases.

Background

AFP (α Fetoprotein), also called α Fetoprotein, is a protein expressed during embryonic development and is a major component of embryonic serum, during development, AFP has relatively high expression levels in the yolk sac and liver, and is subsequently inhibited, in hepatocellular carcinoma, AFP expression is activated (Butterfield et al.J. Immunol.,2001, Apr 15; 166(8): 5300-8). AFP, after intracellular production, is degraded into small polypeptides and bound to MHC (major histocompatibility Complex) molecules to form complexes, which are presented to the cell surface FMNKFIYEI (SEQ ID NO:9) is a short peptide derived from the AFP antigen, which is a target for the treatment of AFP-related diseases.

T cell adoptive immunotherapy is the transfer of reactive T cells specific for a target cell antigen into a patient to act on the target cell. The T Cell Receptor (TCR) is a membrane protein on the surface of T cells that recognizes a corresponding short peptide antigen on the surface of a target cell. In the immune system, the direct physical contact between T cells and Antigen Presenting Cells (APC) is initiated by the binding of antigen short peptide specific TCR and short peptide-major histocompatibility complex (pMHC complex), and then other cell membrane surface molecules of the T cells and APC interact to cause a series of subsequent cell signaling and other physiological reactions, so that T cells with different antigen specificities exert immune effects on their target cells. Accordingly, those skilled in the art have focused on isolating TCRs specific for short AFP antigen peptides and transducing the TCRs into T cells to obtain T cells specific for short AFP antigen peptides, thereby allowing them to function in cellular immunotherapy.

Disclosure of Invention

The invention aims to provide a T cell receptor for recognizing AFP antigen short peptide.

In a first aspect of the invention, there is provided a T Cell Receptor (TCR) capable of binding to the FMNKFIYEI-HLAA0201 complex.

in another preferred embodiment, the TCR comprises a TCR β chain variable domain and a TCR beta chain variable domain, the amino acid sequence of CDR3 of the TCR β chain variable domain is CAVLDNYGQNFVF (SEQ ID NO:12) and/or the amino acid sequence of CDR3 of the TCR beta chain variable domain is CASSLGPYEQYF (SEQ ID NO: 15).

in another preferred embodiment, the 3 Complementarity Determining Regions (CDRs) of the TCR α chain variable domain are:

αCDR1-YGATPY(SEQ ID NO:10)

αCDR2-YFSGDTLV(SEQ ID NO:11)

α CDR3-CAVLDNYGQNFVF (SEQ ID NO:12), and/or

the 3 complementarity determining regions of the TCR β chain variable domain are:

βCDR1-SGHAT(SEQ ID NO:13)

βCDR2-FQNNGV(SEQ ID NO:14)

βCDR3-CASSLGPYEQYF(SEQ ID NO:15)。

in another preferred embodiment, the TCR comprises a TCR α chain variable domain which is an amino acid sequence having at least 90% sequence identity to SEQ ID No. 1 and a TCR beta chain variable domain which is an amino acid sequence having at least 90% sequence identity to SEQ ID No. 5.

in another preferred embodiment, the TCR comprises the α chain variable domain amino acid sequence SEQ ID NO 1.

in another preferred embodiment, the TCR comprises the β chain variable domain amino acid sequence SEQ ID NO 5.

in another preferred embodiment, the TCR is an α β heterodimer comprising a TCR α chain constant region TRAC 01 and a TCR β chain constant region TRBC1 01 or TRBC2 01.

in another preferred embodiment, the α chain amino acid sequence of the TCR is SEQ ID NO 3 and/or the β chain amino acid sequence of the TCR is SEQ ID NO 7.

In another preferred embodiment, the TCR is soluble.

In another preferred embodiment, the TCR is single chain.

in another preferred embodiment, the TCR is formed by linking an α chain variable domain to a β chain variable domain via a peptide linker.

in another preferred embodiment, the TCR has one or more mutations in the β chain variable region amino acid position 11, 13, 19, 21, 53, 76, 89, 91, or 94, and/or the β chain J gene short peptide amino acid position 3 last, 5 last or 7 last, and/or the TCR has one or more mutations in beta chain variable region amino acid position 11, 13, 19, 21, 53, 76, 89, 91, or 94, and/or beta chain J gene short peptide amino acid position 2 last, 4 last or 6 last, wherein the amino acid position numbering is according to the position numbering listed in IMGT (International immunogenetics information System).

in another preferred embodiment, the TCR comprises (a) all or part of a TCR β chain except for the transmembrane domain and (b) all or part of a TCR beta chain except for the transmembrane domain;

and (a) and (b) each comprise a functional variable domain, or comprise a functional variable domain and at least a portion of the TCR chain constant domain.

in another preferred embodiment, the cysteine residues form an artificial disulfide bond between the alpha and β chain constant domains of the TCR.

In another preferred embodiment, the cysteine residues forming the artificial disulfide bond in the TCR are substituted at one or more groups of sites selected from the group consisting of:

thr48 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser57 of TRBC2 × 01 exon 1;

thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser77 of TRBC2 × 01 exon 1;

tyr10 and TRBC1 x 01 of exon 1 of TRAC x 01 or Ser17 of exon 1 of TRBC2 x 01;

thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Asp59 of TRBC2 × 01 exon 1;

ser15 and TRBC1 × 01 of TRAC × 01 exon 1 or Glu15 of TRBC2 × 01 exon 1;

arg53 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser54 of TRBC2 × 01 exon 1;

pro89 and TRBC1 and 01 of exon 1 of TRAC 01 or Ala19 of exon 1 of TRBC2 and 01; and

tyr10 and TRBC1 × 01 of exon 1 of TRAC × 01 or Glu20 of exon 1 of TRBC2 × 01.

in another preferred embodiment, the α chain amino acid sequence of the TCR is SEQ ID NO 26 and/or the β chain amino acid sequence of the TCR is SEQ ID NO 28.

in another preferred embodiment, the TCR comprises an artificial interchain disulfide bond between the α chain variable region and the β chain constant region.

In another preferred embodiment, the cysteine residues that form the artificial interchain disulfide bond in the TCR replace one or more groups of sites selected from the group consisting of:

amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01;

amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC2 x 01;

amino acid 46 of TRAV and amino acid 61 of TRBC1 x 01 or TRBC2 x 01 exon 1; or

Amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC2 x 01.

in another preferred embodiment, the TCR comprises α chain variable domain and an β chain variable domain and all or part of the beta chain constant domain, excluding the transmembrane domain, but which does not comprise α chain constant domain, the alpha chain variable domain of the TCR forming a heterodimer with the beta chain.

in another preferred embodiment, the TCR has a conjugate attached to the C-or N-terminus of the β chain and/or beta chain.

In another preferred embodiment, the conjugate that binds to the T cell receptor is a detectable label, a therapeutic agent, a PK modifying moiety or a combination of any of these. Preferably, the therapeutic agent is an anti-CD 3 antibody.

In a second aspect of the invention, there is provided a multivalent TCR complex comprising at least two TCR molecules, and wherein at least one of the TCR molecules is a TCR according to the first aspect of the invention.

In a third aspect of the invention, there is provided a nucleic acid molecule comprising a nucleic acid sequence encoding a TCR molecule according to the first aspect of the invention, or the complement thereof.

in another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO 2 encoding the variable domain of the TCR α chain.

in another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO 6 encoding the variable domain of the TCR β chain.

in another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO. 4 encoding the TCR β chain and/or comprises the nucleotide sequence SEQ ID NO. 8 encoding the TCR beta chain.

In a fourth aspect of the invention, there is provided a vector comprising a nucleic acid molecule according to the third aspect of the invention; preferably, the vector is a viral vector; more preferably, the vector is a lentiviral vector.

In a fifth aspect of the invention, there is provided an isolated host cell comprising a vector according to the fourth aspect of the invention or a genome into which has been integrated an exogenous nucleic acid molecule according to the third aspect of the invention.

In a sixth aspect of the invention, there is provided a cell which transduces a nucleic acid molecule according to the third aspect of the invention or a vector according to the fourth aspect of the invention; preferably, the cell is a T cell or a stem cell.

In a seventh aspect of the invention, there is provided a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a TCR according to the first aspect of the invention, a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention.

In an eighth aspect, the invention provides the use of a T cell receptor according to the first aspect of the invention, or a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention, for the manufacture of a medicament for the treatment of a tumour or an autoimmune disease.

In a ninth aspect of the invention, there is provided a method of treating a disease comprising administering to a subject in need thereof an amount of a T cell receptor according to the first aspect of the invention, or a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention, or a pharmaceutical composition according to the seventh aspect of the invention;

preferably, the disease is a tumor, preferably the tumor is hepatocellular carcinoma.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1a, FIG. 1b, FIG. 1c, FIG. 1d, FIG. 1e and FIG. 1f are the amino acid sequence of the TCR α chain variable domain, the nucleotide sequence of the TCR α chain variable domain, the amino acid sequence of the TCR α chain, the nucleotide sequence of the TCR α chain, the amino acid sequence of the TCR α chain with leader sequence and the nucleotide sequence of the TCR α chain with leader sequence, respectively.

fig. 2a, fig. 2b, fig. 2c, fig. 2d, fig. 2e and fig. 2f are a TCR β chain variable domain amino acid sequence, a TCR β chain variable domain nucleotide sequence, a TCR β chain amino acid sequence, a TCR β chain nucleotide sequence, a TCR β chain amino acid sequence with a leader sequence and a TCR β chain nucleotide sequence with a leader sequence, respectively.

FIG. 3 is CD8 of monoclonal cells⁺And tetramer-PE double positive staining results.

fig. 4a and 4b are the amino acid and nucleotide sequences, respectively, of a soluble TCR α chain.

fig. 5a and 5b are the amino acid and nucleotide sequences, respectively, of a soluble TCR β chain.

FIG. 6 is a gel diagram of the soluble TCR obtained after purification, wherein the leftmost lane is a molecular weight marker (marker), the middle lane is a non-reducing gel, which shows the complete TCR obtained by renaturation and purification of the two TCR chains, the molecular weight is 50kDa, and the rightmost lane is a reducing gel, which shows that the two TCR chains are separated under the action of DTT (dithiothreitol), the molecular weight of α chain is about 23kDa, and the molecular weight of the β chain is about 27 kDa.

FIG. 7 is a BIAcore kinetic profile of soluble TCR binding to FMNKFIYEI-HLA A0201 complex of the invention, showing the binding capacity of soluble TCR molecules to AFP-MHC molecules at different concentrationsThereby obtaining the TCR molecule K of the invention_D(M)＝4.375E-05。

FIG. 8 is a graph showing the results of tetramer staining of TCR transduced primary T cells stained with AFP-tetramer-PE and anti-mouse β chain antibody-APC, a blank control without TCR transduction had no double positive cells, TCR transduced T cells showed double positive, and non-specific tetramer (tetramer) and anti-mouse β chain antibody had no double positive, indicating that transduced TCR could be stably expressed in primary T cells.

FIG. 9 shows the results of functional verification of the ELISPOT activation of the resulting T cell clones.

FIG. 10 shows the identification and killing function of primary T cells transduced by soluble TCR of the invention against antigen positive tumor cells. The TCR transduced CD8+ T cells had significant killing on AFP positive cell lines (HepG2), no significant killing on AFP negative cell lines (HLF, Mel526), and non-TCR transduced CD8+ T cells had no killing on AFP positive cells.

Detailed Description

The present inventors have extensively and intensively studied to find a TCR capable of specifically binding to AFP antigen short peptide FMNKFIYEI (SEQ ID NO:9), which antigen short peptide FMNKFIYEI can form a complex with HLA A0201 and be presented together on the cell surface. The invention also provides nucleic acid molecules encoding the TCRs and vectors comprising the nucleic acid molecules. In addition, the invention provides cells that transduce a TCR of the invention.

Term(s) for

MHC molecules are proteins of the immunoglobulin superfamily, which may be MHC class I or class II molecules. Therefore, it is specific for antigen presentation, different individuals have different MHC, and different short peptides in one protein antigen can be presented on the cell surface of respective APC. Human MHC is commonly referred to as an HLA gene or HLA complex.

The T Cell Receptor (TCR), is the only receptor for a specific antigenic peptide presented on the Major Histocompatibility Complex (MHC). In the immune system, direct physical contact between T cells and Antigen Presenting Cells (APCs) is initiated by the binding of antigen-specific TCRs to pMHC complexes, and then other cell membrane surface molecules of both T cells and APCs interact, which causes a series of subsequent cell signaling and other physiological reactions, thereby allowing T cells of different antigen specificities to exert immune effects on their target cells.

broadly, each of the α and β chains comprises variable, connecting and constant regions, the β chain usually also comprising a short diversity region between the variable and connecting regions, but the diversity region is often considered to be part of the connecting region, each variable region comprises 3 CDRs (complementarity determining regions) which are chimeric in a framework structure (framework regions), CDR1, CDR2 and CDR 3. the CDR regions determine the binding of the TCR to the pMHC complex, wherein CDR3 is composed of variable and connecting regions, the two domains referred to as hypervariable and β chains are known as TCR domains "and the variable domain of the α and β chains" TCR 01 "are known as TCR domains, and the TCR domains of the variable and β chains are known as TCR domain sequences" TCR 01 "and TCR domain sequences of the variable domain of the framework region", the TCR domains of the variable and β chains "TCR 01" are known as TCR α and β 1 "TCR chains, and β 2 chains are known as TCR chains, and β 1 chains, and β chains are known as TCR chains.

In the present invention, the terms "polypeptide of the invention", "TCR of the invention", "T cell receptor of the invention" are used interchangeably.

Natural interchain disulfide bond and artificial interchain disulfide bond

in the present invention, the artificially introduced interchain covalent disulfide bond, which is located at a position different from that of the natural interchain disulfide bond, is referred to as an "artificial interchain disulfide bond".

For convenience of description of the positions of disulfide bonds, the positions of the amino acid sequences of TRAC 01 and TRBC1 × 01 or TRBC2 × 01 are numbered in the order from the N-terminus to the C-terminus, such as in TRBC1 × 01 or TRBC2 × 01, and the 60 th amino acid in the order from the N-terminus to the C-terminus is P (proline), and thus in the present invention it can be described as Pro60 of TRBC1 × 01 or TRBC2 × 01 exon 1, and also as the 60 th amino acid of TRBC1 × 01 or TRBC2 × 01 exon 1, and as in 737bc 3 × 01 or TRBC2 × 01, and the 61 th amino acid in the order from the N-terminus to the C-terminus is Q (glutamine), and thus in the present invention it can be described as TRBC1 × 01 or TRBC 6301 × 01, or TRBC 8501, and similarly as TRBC 8261 or glbc 891. In the present invention, the position numbering of the amino acid sequences of the variable regions TRAV and TRBV follows the position numbering listed in IMGT. If an amino acid in TRAV, the position listed in IMGT is numbered 46, it is described herein as the 46 th amino acid of TRAV, and so on. In the present invention, the sequence position numbers of other amino acids are specifically described.

Detailed Description

TCR molecules

thus, in a first aspect of the invention there is provided a TCR molecule which is capable of binding FMNKFIYEI-HLA A0201 complex, preferably the TCR molecule is isolated or purified, the α and β chains of the TCR having 3 Complementarity Determining Regions (CDRs) each.

in a preferred embodiment of the invention, the α chain of the TCR comprises CDRs having the amino acid sequence:

αCDR1-YGATPY(SEQ ID NO:10)

αCDR2-YFSGDTLV(SEQ ID NO:11)

α CDR3-CAVLDNYGQNFVF (SEQ ID NO:12), and/or

the 3 complementarity determining regions of the TCR β chain variable domain are:

βCDR1-SGHAT(SEQ ID NO:13)

βCDR2-FQNNGV(SEQ ID NO:14)

βCDR3-CASSLGPYEQYF(SEQ ID NO:15)。

the TCR molecules of the invention are thus defined as TCR molecules comprising the α and/or β chain CDR region sequences and any suitable framework structure, the TCR alpha chain variable domain of the invention is an amino acid sequence having at least 90%, preferably 95%, more preferably 98% sequence identity to SEQ ID NO. 1, and/or the TCR β chain variable domain of the invention is an amino acid sequence having at least 90%, preferably 95%, more preferably 98% sequence identity to SEQ ID NO. 5.

in a preferred embodiment of the invention, the TCR molecule of the invention is a heterodimer consisting of α and β chains, in particular, the α chain of the heterodimeric TCR molecule comprises, on the one hand, a variable domain and a constant domain, the α chain variable domain amino acid sequence comprising CDR1(SEQ ID NO: 10), CDR2(SEQ ID NO: 11) and CDR3(SEQ ID NO:12) of the above-mentioned α chain, preferably the TCR molecule comprises the α chain variable domain amino acid sequence SEQ ID NO:1, more preferably the α chain variable domain amino acid sequence of the TCR molecule is SEQ ID NO:1, on the other hand, the β 0 chain of the heterodimeric TCR molecule comprises a variable domain and a constant domain, the β 1 chain variable domain amino acid sequence comprising CDR1(SEQ ID NO:13), CDR2(SEQ ID NO: 14) and CDR3(SEQ ID NO:15) of the above-mentioned β chain, preferably the TCR molecule comprises the β chain variable domain amino acid sequence, preferably the β chain variable domain amino acid sequence of the TCR molecule is SEQ ID NO:5, more preferably the β chain is SEQ ID NO: 5.

in a preferred embodiment of the invention, the TCR molecule of the invention is a single chain TCR molecule consisting of part or all of the β chain and/or part or all of the beta chain the description of single chain TCR molecules can be found in Chung et al (1994) Proc.Natl.Acad.Sci.USA 91, 12654-12658.

the α chain variable domain amino acid sequence of the single chain TCR molecule comprises the α chain CDR1(SEQ ID NO: 10), CDR2(SEQ ID NO: 11) and CDR3(SEQ ID NO:12) described above preferably the single chain TCR molecule comprises the α chain variable domain amino acid sequence SEQ ID NO:1, more preferably the α chain variable domain amino acid sequence of the single chain TCR molecule is SEQ ID NO:1 the β chain variable domain amino acid sequence of the single chain TCR molecule comprises the β chain CDR1(SEQ ID NO:13), CDR2(SEQ ID NO: 14) and CDR3(SEQ ID NO:15) described above preferably the single chain TCR molecule comprises the β chain variable domain amino acid sequence SEQ ID NO:5, more preferably the β chain variable domain amino acid sequence of the single chain TCR molecule is SEQ ID NO: 5.

for example, the constant domain sequence of the α chain of the TCR molecules of the invention may be "TRAC 01", the constant domain sequence of the β chain of the TCR molecules may be "TRBC 1 01" or "TRBC 2" 01 ", the amino acid sequence given in TRAC 01 of IMGT is Arg at position 53, here indicated as Arg53 of TRAC 01 exon 1, and so on, preferably the amino acid sequence of the α chain of the TCR molecules of the invention is SEQ ID NO:3, and/or the amino acid sequence of the β chain is SEQ ID NO: 7.

Naturally occurring TCRs are membrane proteins that are stabilized by their transmembrane regions. Like immunoglobulins (antibodies) as antigen recognition molecules, TCRs can also be developed for diagnostic and therapeutic applications, where soluble TCR molecules are required. Soluble TCR molecules do not include their transmembrane regions. Soluble TCRs have a wide range of uses, not only for studying the interaction of TCRs with pmhcs, but also as diagnostic tools for detecting infections or as markers for autoimmune diseases. Similarly, soluble TCRs can be used to deliver therapeutic agents (e.g., cytotoxic or immunostimulatory compounds) to cells presenting a specific antigen, and in addition, soluble TCRs can be conjugated to other molecules (e.g., anti-CD 3 antibodies) to redirect T cells to target them to cells presenting a particular antigen. The present invention also provides soluble TCRs with specificity for AFP antigen short peptides.

in a preferred embodiment of the invention, the amino acid sequence and nucleotide sequence of the soluble TCR β chain are shown in FIGS. 4a and 4b, the amino acid sequence and nucleotide sequence of the soluble TCR beta chain are shown in FIGS. 5a and 5b, and the gel map of the soluble TCR obtained after purification (FIG. 6) is provided, wherein the leftmost lane is a molecular weight marker (marker), the middle lane is non-reducing gel, the complete TCR obtained by renaturation purification of the two TCR chains is shown, the molecular weight is 50kDa, the rightmost lane is reducing gel, the two TCR chains of the TCR molecule are separated under the action of DTT (dithiothreitol, a protein reducing agent), the molecular weight of the β chain is about 23kDa, the molecular weight of the beta chain is about 27kDa, and the BIAcore kinetic map (FIG. 7) of the soluble TCR combined with FMNKFIYEI-HLA A0201 complex shows the binding capacity of soluble TCR molecules with AFP-MHC molecules at different concentrations, thereby obtaining the TCR K molecule of the invention_D(M)＝4.375E-05。

in order to obtain a soluble TCR, in one aspect, the TCR of the invention may be a TCR in which an artificial disulfide bond is introduced between residues of the α and β chains of the TCR, the cysteine residue may form an artificial interchain disulfide bond between the α and β chains of the TCR, the cysteine residue may be substituted for another amino acid residue at a suitable site in the native TCR to form an artificial interchain disulfide bond, for example, the cysteine residue of Ser57 of exon 1 of TRAC 01 may be substituted for Thr48 of exon 1 of TRAC 72 and the TRBC1 or TRBC2 to form a disulfide bond, the other site in which the cysteine residue is introduced to form a disulfide bond may be a Thr45 of exon 1 of TRAC 01 and a TRBC1 or Ser 2 of exon 1 of TRBC2, the Tyr 2 of exon 1 of TRAC 01 and the TR36363672 of the TRBC 3601 or a TR36363636363672 exon 1 of the TRBC2, or a TR36363672 may be a multiple of the above-mentioned exon, or more amino acid residues may be substituted for the natural interchain disulfide bond between the TRABC 72 and the TRABC 2, or the Tr3672, or the Tr36363636363672, or the TrBC 363636363636363672 of the Tr 3601 exon of the TrBC2, or TRBC 3636363672, or TRBC 363636363636363672, or more than the Tr 2, the Tr 2 of the above mentioned exon 1, or more than the TrBC2, or more of the Tr 2, or more of the TrBC 36363672, or more of the TSC 2, the TrBC 363636363636363672, or more of the TSC 36363672, or the TSC 363672, or the TrBC 363636363636363672, the TrBC 363672, the TrBC2, the Tr 2, or more of the TrBC2, the Tr 363636363636363672, or more of the TSC 363636363636363636.

it is noted that the constant domains may or may not contain the artificial disulfide bonds introduced above, and that the TCRs of the invention may contain TRAC constant domain sequences and TRBC1 or TRBC2 constant domain sequences.

to obtain a soluble TCR, on the other hand, the TCR of the invention also includes a TCR having mutations in its hydrophobic core region, preferably mutations which increase the stability of the soluble TCR of the invention, as described in the patent publication WO2014/206304, such a TCR may have mutations in the hydrophobic core positions of the following variable domains (α and/or β) variable region amino acids 11, 13, 19, 21, 53, 76, 89, 91, 94, and/or in the reciprocal positions 3,5,7 of the short peptide amino acid positions of the α chain J gene (TRAJ), and/or in the reciprocal positions 2,4,6 of the short peptide amino acid positions of the beta chain J gene (TRBJ), wherein the numbering of the amino acid sequences is according to the position numbering listed in the International Immunogenetic information System (IMGT.

the TCR with the mutated hydrophobic core region of the invention may be a stable soluble single chain TCR comprised of a flexible peptide chain linking the variable domains of the α and β chains of the TCR.

in addition, for stability, patent document 201680003540.2 also discloses that the introduction of an artificial interchain disulfide bond between the α chain variable region and the β chain constant region of the TCR can lead to a significant improvement in TCR stability, and thus, the β 0 chain variable region and the β 1 chain constant region of the high affinity TCR of the present invention may further comprise an artificial interchain disulfide bond, specifically, the cysteine residue forming an artificial interchain disulfide bond between the β 3 chain variable region and the β 2 chain constant region of the TCR replaces amino acid position 46 of TRAV and amino acid position 60 of TRBC1 x 01 or TRBC 201 exon 1, amino acid position 47 of TRAV and amino acid position 61 of TRBC1 x 01 or TRBC2 x 01 exon 1, amino acid position 46 of TRAV and amino acid position 61 of TRBC1 x 01 or TRBC2 exon 1, or amino acid position 47 of TRAV and amino acid position TRBC1 x 01 or TRBC2 x 01 exon 1, and may preferably comprise a portion of the transmembrane variable domain of TCR α chain and β chain (or β) which may form a heterodimer with at least a transmembrane domain (or a portion of the α chain variable domain, and β chain domain, and a portion of the TCR 5 chain variable domain (ii) of the TCR 5 chain, and a transmembrane domain of which may preferably comprise a portion of a transmembrane domain (or a transmembrane domain) of a transmembrane domain, and a portion of a transmembrane domain of a TCR 5 chain.

The TCRs of the invention may also be provided in the form of multivalent complexes. Multivalent TCR complexes of the invention comprise polymers formed by association of two, three, four or more TCRs of the invention, such as might be produced as a tetramer using the tetrameric domain of p53, or a complex formed by association of a plurality of TCRs of the invention with another molecule. The TCR complexes of the invention can be used to track or target cells presenting a particular antigen in vitro or in vivo, and can also be used to generate intermediates for other multivalent TCR complexes having such applications.

The TCRs of the invention may be used alone or in covalent or other association, preferably covalently, with a conjugate. The conjugates include a detectable label (for diagnostic purposes, wherein the TCR is used to detect the presence of cells presenting the FMNKFIYEI-HLA a0201 complex), a therapeutic agent, a PK (protein kinase) modifying moiety, or a combination of any of the above.

Detectable labels for diagnostic purposes include, but are not limited to: a fluorescent or luminescent label, a radioactive label, an MRI (magnetic resonance imaging) or CT (computed tomography) contrast agent, or an enzyme capable of producing a detectable product.

Therapeutic agents that may be associated or conjugated with the TCRs of the invention include, but are not limited to: 1. radionuclides (Koppe et al, 2005, Cancer metastasis reviews (Cancer metastasis) 24, 539); 2. biological toxins (Chaudhary et al, 1989, Nature 339, 394; Epel et al, 2002, Cancer Immunology and immunotherapy 51, 565); 3. cytokines such as IL-2 and the like (Gillies et al, 1992, Proc. Natl. Acad. Sci. USA (PNAS)89, 1428; Card et al, 2004, Cancer Immunology and immunotherapy (Cancer Immunology and Immunotherapy)53, 345; Halin et al, 2003, Cancer Research (Cancer Research)63, 3202); 4. antibody Fc fragment (Mosquera et al, 2005, Journal Of Immunology 174, 4381); 5. antibody scFv fragments (Zhu et al, 1995, International Journal of Cancer 62,319); 6. gold nanoparticles/nanorods (Lapotko et al, 2005, Cancer letters 239, 36; Huang et al, 2006, Journal of the American Chemical Society 128, 2115); 7. viral particles (Peng et al, 2004, Gene therapy 11, 1234); 8. liposomes (Mamot et al, 2005, Cancer research 65, 11631); 9. nano magnetic particles; 10. prodrug activating enzymes (e.g., DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL)); 11. chemotherapeutic agents (e.g., cisplatin) or nanoparticles in any form, and the like.

In addition, the TCRs of the invention may also be hybrid TCRs comprising sequences derived from more than one species. For example, studies have shown that murine TCRs are more efficiently expressed in human T cells than human TCRs. Thus, the inventive TCR may comprise a human variable domain and a murine constant domain. The drawback of this approach is the possibility of eliciting an immune response. Thus, there should be a regulatory regimen to immunosuppresse when it is used for adoptive T cell therapy to allow for the engraftment of murine expressing T cells.

It should be understood that the amino acid names herein are expressed in terms of international single-letter or three-letter english letters, and the single-letter english letter and three-letter english letters of the amino acid names correspond to the following relationships: ala (A), Arg (R), Asn (N), Asp (D), Cys (C), Gln (Q), Glu (E), Gly (G), His (H), Ile (I), Leu (L), Lys (K), Met (M), Phe (F), Pro (P), Ser (S), Thr (T), Trp (W), Tyr (Y), Val (V).

Nucleic acid molecules

a second aspect of the invention provides a nucleic acid molecule encoding a TCR molecule of the first aspect of the invention or a portion thereof, which may be one or more CDRs, variable domains of α chains and/or β chains, and α chains and/or β chains.

the nucleotide sequence encoding the α chain CDR regions of the TCR molecules of the first aspect of the invention is as follows:

αCDR1-tatggggcaacaccttat(SEQ ID NO:16)

αCDR2-tacttttcaggagacactctggtt(SEQ ID NO:17)

αCDR3-tgtgctgtactggataactatggtcagaattttgtcttt(SEQ ID NO:18)

the nucleotide sequence encoding the β chain CDR regions of the TCR molecules of the first aspect of the invention is as follows:

βCDR1-tctggccatgctacc(SEQ ID NO:19)

βCDR2-tttcagaataacggtgta(SEQ ID NO:20)

βCDR3-tgtgccagcagcttggggccctacgagcagtacttc(SEQ ID NO:21)

thus, the nucleotide sequence of the nucleic acid molecule of the invention encoding the TCR β chain of the invention comprises SEQ ID NO 16, SEQ ID NO 17 and SEQ ID NO 18 and/or the nucleotide sequence of the nucleic acid molecule of the invention encoding the TCR beta chain of the invention comprises SEQ ID NO 19, SEQ ID NO 20 and SEQ ID NO 21.

preferably, the nucleotide sequence of the nucleic acid molecule of the invention does not comprise an intron but is capable of encoding α polypeptide of the invention, e.g. the nucleotide sequence of the nucleic acid molecule of the invention encoding α TCR α chain variable domain of the invention comprises SEQ ID No. 2 and/or the nucleotide sequence of the nucleic acid molecule of the invention encoding α TCR β chain variable domain of the invention comprises SEQ ID No. 6. more preferably, the nucleotide sequence of the nucleic acid molecule of the invention comprises SEQ ID No. 4 and/or SEQ ID No. 8.

It will be appreciated that, due to the degeneracy of the genetic code, different nucleotide sequences may encode the same polypeptide. Thus, the nucleic acid sequence encoding the TCR of the present invention may be identical to or a degenerate variant of the nucleic acid sequences shown in the figures of the present invention. As illustrated by one of the examples herein, a "degenerate variant" refers to a nucleic acid sequence that encodes a protein sequence having SEQ ID NO. 1, but differs from the sequence of SEQ ID NO. 2.

The nucleotide sequence may be codon optimized. Different cells differ in the utilization of specific codons, and the expression level can be increased by changing the codons in the sequence according to the type of the cell. Codon usage tables for mammalian cells as well as for various other organisms are well known to those skilled in the art.

The full-length sequence of the nucleic acid molecule of the present invention or a fragment thereof can be obtained by, but not limited to, PCR amplification, recombination, or artificial synthesis. At present, DNA sequences encoding the TCRs of the invention (or fragments or derivatives thereof) have been obtained entirely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art. The DNA may be the coding strand or the non-coding strand.

Carrier

The invention also relates to vectors comprising the nucleic acid molecules of the invention, including expression vectors, i.e. constructs capable of expression in vivo or in vitro. Commonly used vectors include bacterial plasmids, bacteriophages and animal and plant viruses.

Viral delivery systems include, but are not limited to, adenoviral vectors, adeno-associated virus (AAV) vectors, herpes viral vectors, retroviral vectors, lentiviral vectors, baculoviral vectors.

Preferably, the vector can transfer the nucleotide of the invention into a cell, e.g., a T cell, such that the cell expresses a TCR specific for the AFP antigen. Ideally, the vector should be capable of sustained high level expression in T cells.

Cells

The invention also relates to genetically engineered host cells that have been engineered with the vectors or coding sequences of the invention. The host cell comprises a vector of the invention or has integrated into its chromosome a nucleic acid molecule of the invention. The host cell is selected from: prokaryotic and eukaryotic cells, such as E.coli, yeast cells, CHO cells, and the like.

In addition, the invention also includes isolated cells, particularly T cells, that express the TCRs of the invention. The T cell may be derived from a T cell isolated from a subject, or may be part of a mixed population of cells isolated from a subject, such as a population of Peripheral Blood Lymphocytes (PBLs). For example, the cells may be isolated from Peripheral Blood Mononuclear Cells (PBMC), which may be CD4⁺Helper T cell or CD8⁺Cytotoxic T cells. The cell may be in CD4⁺Helper T cell/CD 8⁺A mixed population of cytotoxic T cells. Generally, the cells can be activated with an antibody (e.g., an anti-CD 3 or anti-CD 28 antibody) to render them more amenable to transfection, e.g., transfection with a vector comprising a nucleotide sequence encoding a TCR molecule of the invention.

Alternatively, the cell of the invention may also be or be derived from a stem cell, such as a Hematopoietic Stem Cell (HSC). Gene transfer to HSCs does not result in TCR expression on the cell surface, since the CD3 molecule is not expressed on the stem cell surface. However, when stem cells differentiate into lymphoid precursors (lymphoid precursors) that migrate to the thymus, expression of the CD3 molecule will initiate expression of the introduced TCR molecule on the surface of the thymocytes.

There are many methods suitable for T cell transfection using DNA or RNA encoding the TCR of the invention (e.g., Robbins et al, (2008) J.Immunol.180: 6116-6131). T cells expressing the TCRs of the invention may be used for adoptive immunotherapy. One skilled in the art will be aware of many suitable methods for adoptive therapy (e.g., Rosenberg et al, (2008) Nat Revcancer8 (4): 299-308).

AFP antigen associated diseases

The present invention also relates to a method for the treatment and/or prevention of a disease associated with AFP in a subject, comprising the step of adoptive transfer of AFP-specific T cells to the subject. The AFP-specific T cells recognize FMNKFIYEI-HLA A0201 complex.

The AFP-specific T-cells of the invention can be used to treat any AFP-related disease presenting an AFP antigen short peptide FMNKFIYEI-HLAA0201 complex. Including but not limited to tumors such as hepatocellular carcinoma and the like.

Method of treatment

Treatment may be effected by isolating T cells from patients or volunteers suffering from a disease associated with the AFP antigen and introducing the TCR of the invention into such T cells, followed by reinfusion of these genetically engineered cells into the patient. Accordingly, the present invention provides a method of treating an AFP-related disease comprising infusing into a patient an isolated T cell expressing a TCR of the invention, preferably, the T cell is derived from the patient itself. Generally, this involves (1) isolating T cells from the patient, (2) transducing T cells in vitro with a nucleic acid molecule of the invention or a nucleic acid molecule capable of encoding a TCR molecule of the invention, and (3) infusing the genetically modified T cells into the patient. The number of cells isolated, transfected and transfused can be determined by a physician.

The main advantages of the invention are:

(1) the inventive TCR was capable of binding to the AFP antigen short peptide complex FMNKFIYEI-HLA a0201, while cells transduced with the inventive TCR were capable of being specifically activated.

The following specific examples further illustrate the invention. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not indicated in the following examples, are generally carried out according to conventional conditions, for example as described in Sambrook and Russell et al, Molecular Cloning: A laboratory Manual (third edition) (2001) CSHL Press, or according to the conditions as recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. Unless otherwise indicated, percentages and parts are by weight. The test materials and reagents used in the following examples are commercially available without specific reference.

EXAMPLE 1 cloning of AFP-specific T cells

Peripheral Blood Lymphocytes (PBLs) from healthy volunteers of genotype HLA-A02 were stimulated with the synthetic short peptide AFP158-166FMNKFIYEI (Nanjing Kingskan Biotech Co., Ltd.). 3 the 3AFP 3 158 3- 3 166 3 FMNKFIYEI 3 short 3 peptide 3 is 3 renatured 3 with 3 HLA 3- 3A 3 0201 3 with 3 biotin 3 labels 3 to 3 prepare 3 pHLA 3 haploids 3. 3 These haploids were combined with streptavidin labeled with PE (BD Co.) to form PE-labeled tetramers, which were sorted for double positive anti-CD 8-APC cells. The sorted cells were expanded and subjected to secondary sorting as described above, followed by single cloning by limiting dilution. Monoclonal cells were stained with tetramer and double positive clones were selected as shown in FIG. 3.

Example 2 construction of TCR Gene and vector for obtaining AFP-specific T cell clones

Using Quick-RNA^TM 3 Synthesis 3 of 3 cDNA 3 from 3 the 3AFP 3 158 3- 3 166 3 specific 3, 3 HLA 3- 3A 3 0201 3 restricted 3T 3 cell 3 clone 3 selected 3 in 3 MiniPrep 3( 3 ZYMO 3 research 3) 3 the 3 cDNA 3 was 3 amplified 3 using 3a 3 Clontech 3 SMART 3 RACECDNA 3 amplification 3 kit 3 using 3 primers 3 designed 3 to 3 preserve 3 the 3 C 3- 3 terminal 3 conserved 3 region 3 of 3 the 3 human 3 TCR 3 gene 3, 3 cloning 3 the 3 sequence 3 onto 3a 3T 3 vector 3( 3 TAKARA 3) 3 for 3 sequencing 3, 3 and 3 the 3 α 3- 3 and 3 β 3- 3 chain 3 sequence 3 structures 3 of 3 the 3 TCR 3 expressed 3 by 3 the 3 double 3 positive 3 clones 3 were 3 shown 3 in 3 FIGS. 31 3 and 32 3, 3 respectively 3, 3 the 3 TCR 3 α 3- 3 chain 3 nucleotide 3 sequence 3 with 3 the 3 leader 3 sequence 3, 3 the 3 TCR 3 α 3- 3 chain 3 variable 3 domain 3 nucleotide 3 sequence 3, 3 the 3 TCR 3 α 3- 3 chain 3 amino 3 acid 3 sequence 3 and 3 the 3 TCR 3 α 3- 3 chain 3 nucleotide 3 sequence 3 with 3 the 3 leader 3 sequence 3, 3 the 3 TCR 3 α 3- 3 chain 3 amino 3 acid 3 sequence 3 with 3 the 3 leader 3 sequence 3, 3 and 3 the 3 TCR 3 α 3- 3 chain 3 nucleotide 3 sequence 3 with 3 the 3 leader 3 sequence 3, 3 the 3 TCR 3 α 3- 3 chain 3 nucleotide 3 sequence 3, 3 the 3 TCR 3 β 3- 3 chain 3 variable 3 domain 3 nucleotide 3 sequence 3 with 3 the 3 leader 3 sequence 3, 3 the 3 TCR 3 α 3- 3 chain 3 nucleotide 3 sequence 3 with 3 the 3 leader 3 sequence 3, 3 and 3 the 3 TCR 3 β 3- 3 chain 3 variable 3 domain 3 nucleotide 3 sequence 3 with 3 the 3 leader 3 sequence 3, 3 the 3 TCR 3 α 3- 3 chain 3 nucleotide 3 sequence 3, 3 the 3 TCR 3- 3 chain 3 nucleotide 3 sequence 3 with 3 the 3 leader 3 sequence 3, 3 the 3 TCR 3- 3 chain 3 nucleotide 3 sequence 3, 3 the 3 TCR 3. 3

the α chain was identified to comprise CDRs having the following amino acid sequences:

αCDR1-YGATPY(SEQ ID NO:10)

αCDR2-YFSGDTLV(SEQ ID NO:11)

αCDR3-CAVLDNYGQNFVF(SEQ ID NO:12)

the beta chain comprises CDRs having the amino acid sequences:

βCDR1-SGHAT(SEQ ID NO:13)

βCDR2-FQNNGV(SEQ ID NO:14)

βCDR3-CASSLGPYEQYF(SEQ ID NO:15)。

respectively cloning the full-length genes of a TCR α chain and a β chain to a lentivirus expression vector pLenti (adddge) by overlapping (overlap) PCR, specifically, connecting the V region genes of the TCR α chain and the β chain with the C region of a mouse TCR α chain and a β chain respectively by using overlap PCR to obtain a TCR α -2A-TCR beta fragment, carrying out enzyme digestion connection on the lentivirus expression vector and the TCR α -2A-TCR beta to obtain pLenti-AFP TRA-2A-TRB-IRES-NGFR plasmid, serving as a contrast, simultaneously constructing a lentivirus vector pLenti-eGFP expressing eGFP, and then packaging a pseudovirus by 293T/17.

Example 3 AFP-specific T cell receptor Lentiviral packaging and Primary T cell transfection of AFP TCR

(a) Production of lentiviruses by Rapid-mediated transient transfection of 293T/17 cells

A third generation lentiviral packaging system was used to package lentiviruses containing the gene encoding the desired TCR. 293T/17 cells were transfected with 4 plasmids (one lentiviral vector containing pLenti-AFP TRA-2A-TRB-IRES-NGFR described In example 2, and 3 plasmids containing other components necessary for the construction of infectious but non-replicating lentiviral particles) using rapid-mediated transient transfection (Express-In-mediated transfection) (open biosystems).

For transfection, cells were seeded at day 0 on a 15 cm petri dish at 1.7X 10⁷293T/17 cells, which were distributed evenly on the culture dish with a degree of confluence slightly higher than 50%. On day 1, plasmids were transfected, pLenti-AFP TRA-2A-TRB-IRES-NGFR and pLenti-eGFP pseudoviruses were packaged, and the above expression plasmids were mixed with packaging plasmids pMDLg/pRRE, pRSV-REV and pMD.2G, in a 15 cm diameter plate in the following amounts: 22.5 microgram: 15 microgram: 7.5 micrograms. The ratio of the transfection reagent PEI-MAX to the plasmid was 2:1 and the amount used was 114.75. mu.g per dish. The specific operation is as follows: the expression plasmid and packaging plasmid were added to 1800. mu.l of OPTI-MEMGibco, Cat No. 31985-070) medium, and standing at room temperature for 5 minutes to obtain a DNA mixture; a corresponding amount of PEI was mixed with 1800. mu.l of OPTI-MEM medium and allowed to stand at room temperature for 5 minutes to prepare a PEI mixture. Mixing the DNA mixture and PEI mixture, standing at room temperature for 30 min, adding 3150. mu.l of OPTI-MEM medium, mixing well, adding into 293T/17 cells converted into 11.25 ml of OPTI-MEM, gently shaking the culture dish to mix the medium well, 37 ℃/5% CO₂And (5) culturing. 5-7 hours of transfection, the transfection medium was removed and replaced with DMEM (Gibbo, Cat. C11995500bt) complete medium containing 10% fetal bovine serum at 37 deg.C/5% CO₂And (5) culturing. Culture supernatants containing packaged lentiviruses were collected on days 3 and 4. To harvest the packaged lentivirus, the collected culture supernatant was centrifuged at 3000g for 15 min to remove cell debris, filtered through a 0.45 micron filter (Merck Millipore, catalog # SLGP033RB) and finally concentrated using a 50KD cut-off concentrator tube (Merck Millipore), catalog # UFC905096 to remove most of the supernatant, and finally concentrated to 1 ml, aliquots were frozen at-80 ℃. Pseudovirus samples were taken for virus titer determination, procedures were referenced to p24ELISA (Clontech, cat # 632200) kit instructions. As a control, a pseudovirus transformed with pLenti-eGFP was also included.

(b) Transduction of primary T cells with lentiviruses containing AFP-specific T cell receptor genes

CD8 isolated from blood of healthy volunteers⁺T cells, then transduced with the packaged lentivirus. These cells were counted in 24-well plates in a 1X 10 format in 1640 (Gibbo, Cat. No. C11875500bt) medium containing 30IU/ml IL-2 with 10% FBS (Gibbo, Cat. No. C10010500BT)⁶Cells/ml (0.5 ml/well) were incubated with pre-washed anti-CD 3/CD28 antibody-coated beads (T cell amplicons, life technologies, cat No. 11452D) overnight for stimulation, cells: bead 3: 1.

after overnight stimulation, concentrated AFPeter was added at an MOI of 10 based on the viral titer measured in the p24ELISA kitLentiviral infection of the heterologous T cell receptor gene was performed at 32 ℃ for 1 hour by centrifugation at 900 g. After infection, the lentivirus infection solution was removed and the cells were resuspended in 1640 medium containing 10% FBS containing 30IU/ml IL-2 at 37 ℃/5% CO₂The cells were cultured for 3 days. Cells were counted 3 days after transduction and diluted to 0.5X 10⁶Individual cells/ml. The cells were counted every two days, replaced or added with fresh medium containing 30IU/ml IL-2, maintaining the cells at 0.5X 10⁶-1×10⁶Individual cells/ml. Cells were analyzed by flow cytometry starting on day 3 and starting on day 5 for functional assays (e.g., ELISPOT for IFN- γ release and non-radioactive cytotoxicity assays). Freezing storage of aliquots of cells, at least 4X 10, from day 10 or as the cells slow down division and become smaller in size⁶Individual cell/tube (1X 10)⁷Individual cells/ml, 90% FBS/10% DMSO).

(c) Tetramer staining of TCR transduced primary T cells

3AFP 3 158 3- 3 166 3 FMNKFIYEI 3 short 3 peptide 3 was 3 renatured 3 with 3 HLA 3- 3A 3 0201 3 with 3 biotin 3 labeling 3 to 3 prepare 3 pHLA 3 haploids 3 which 3 were 3 combined 3 with 3 PE 3 labeled 3 streptavidin 3( 3 BD 3) 3 into 3 PE 3 labeled 3 tetramers 3 called 3AFP 3- 3 tetramer 3- 3 PE. 3 which 3 labeled 3 positive 3 cells 3 for 3T 3 cells 3 expressing 3AFP 3 specific 3T 3 cell 3 receptor 3 genes.A 3 sample 3 of 3 transfected 3T 3 cells 3 from 3( 3 b 3) 3 was 3 incubated 3 with 3AFP 3- 3 tetramer 3- 3 PE 3 on 3 ice 3 for 3 30 3 minutes 3, 3 then 3 anti 3- 3 mouse 3 beta 3 chain 3- 3 APC 3( 3 biolegend 3) 3 antibody 3 was 3 added 3 and 3 incubation 3 on 3 ice 3 was 3 continued 3 for 315 3 minutes.the 3 sample 3 was 3 washed 32 3 times 3 with 3 PBS 3 containing 32 3% 3 FBS 3 followed 3 by 3 either 3 Milliporegavava 3 flow 3 cytometer 3 or 3 BD 3 Arial 3 III 3 flow 3 cytometer 3 to 3 detect 3 or 3 sort 3AFP 3- 3 tetramer 3- 3 PE 3 expressing 3AFP 3 specific 3T 3 cell 3 receptor 3 genes 3 and 3 anti 3- 3 mouse 3 beta 3 chain 3- 3 APC 3 double 3 positive 3T 3 cells 3 and 3 data 3 analysis 3 was 3 performed 3 using 3 guavasa 3 software 3( 3( 3 Memerck 3 densitometry 3) 3 or 3 Treohle 3, 3 Inc 3) 3 software 3. 3

the results of the assay are shown in FIG. 8, after staining with AFP-tetramer-PE and anti-mouse β chain antibody, the NC group T cells without TCR lentivirus infection were free of AFP-tetramer-PE and anti-mouse β chain-APC double positive cells, while the T cells with TCR lentivirus infection appeared with AFP-tetramer-PE and anti-mouse β chain-APC double positive cells expressing TCR, with only a few non-specific double positive cells when staining with other tetramer-PE than AFP-tetramer-PE.

Example 4 validation of AFP-specific TCR function

ELISPOT scheme

The following assay was performed to demonstrate activation of TCR-transduced T cells in response specifically to target cells. IFN-. gamma.production as measured by the ELISPOT assay was used as a readout for T cell activation.

Reagent

Test medium: 10% FBS (Gibbo, Cat. No. 16000-044), RPMI1640 (Gibbo, Cat. No. C11875500bt)

Washing buffer solution: 0.01M PBS/0.05% Tween 20

PBS (Gibbo Co., catalog number C10010500BT)

PVDF ELISPOT 96-well plate (Merck Millipore, Cat. No. MSIPS4510)

The human IFN-. gamma.ELISPOT PVDF-enzyme kit (BD) contains all the other reagents required (capture and detection antibodies, streptavidin-alkaline phosphatase and BCIP/NBT solution).

Method of producing a composite material

Target cell preparation

The target cells of this example were Epstein-Barr virus (EBV) transformed immortalized Lymphoblastoid Cell Lines (LCLs). B95-8 cells were induced to produce EBV-containing culture supernatants by phorbol myristate acetate (TPA), centrifuged at 4 deg.C/600 g for 10 min to remove impurities, filtered through 0.22 μm filter, and aliquoted for-70 deg.C storage. From Peripheral Blood Lymphocytes (PBLs) of healthy volunteers of the genotype HLA-A11/A02/A24 (both homozygote and heterozygote), 10 ml of 2X 10-concentration blood was taken⁷One ml PBL suspension in 25 cm square culture flask, adding cyclosporine at 37 deg.C/CO₂Incubating for 1 hour in incubator, rapidly thawing an EBV aliquot, diluting with 1/10 of EBV, adding to the cells, shaking gently, and standing the flask at 37 deg.C/CO₂Culturing in an incubator. After 12 days of culture, the culture was continued by adding 10 ml of a medium, and after about 30 days, the culture was further expanded and subjected to flow assay, in which CD19 was present⁺CD23^hiCD58⁺Is an immortalized Lymphoblastoid Cell Line (LCL). The ELISPOT test uses HLA-A02LCL as target cells.

Effector cell preparation

The effector cells (T cells) of this assay were CD8 expressing an AFP-specific TCR as analyzed by flow cytometry in example 3⁺T cells and CD8 of the same volunteer⁺T served as negative control effector cells. T cells were stimulated with anti-CD 3/CD28 coated beads (T cell amplicons, life technologies), transduced with lentiviruses carrying the AFP specific TCR gene (according to example 3), expanded in 1640 medium containing 10% FBS with 30IU/ml IL-2 until 9-12 days post transduction, then placed in assay medium and washed by centrifugation at 300g for 10 min at RT. The cells were then resuspended in the test medium at 2 × the desired final concentration. Negative control effector cells were treated as well.

ELISPOT

The well plate was prepared as follows according to the manufacturer's instructions: 10 ml of sterile PBS per plate 1: anti-human IFN-. gamma.capture antibody was diluted at 200, and 100. mu.l of the diluted capture antibody was aliquoted into each well. The plates were incubated overnight at 4 ℃. After incubation, the well plates were washed to remove excess capture antibody. 100 μ l/well of RPMI1640 medium containing 10% FBS was added and the well plates were incubated at room temperature for 2 hours to close the well plates. The media was then washed from the well plate, and any residual wash buffer was removed by flicking and tapping the ELISPOT well plate on paper.

AFP CD8⁺T cells (AFP TCR transduced T cells, Effector cells), CD8⁺T cells (negative control effector cells) and LCL-A02/A11 (target cells) were prepared as described in example 4, and corresponding short peptides were added to the respective experimental groups, wherein AFP was AFP158-166FMNKFIYEI short peptide (denoted as PX551), and the remainder was non-AFP TCR-specific binding short peptide (denoted as PA02-1, PA02-2, PA02-3, PA11-1, respectively).

The components of the assay were then added to ELISPOT well plates in the following order:

77000 cells/ml of 130 microliters of target cells (resulting in a total of about 10000 target cells/well).

50 microliter of effector cells (1000 AFP TCR positive T cells).

20 microliter 10^-5Mol/l AFP158-166 FMNKFIYEI/other short peptide solution (final concentration of 10)^-6Moles/liter).

All wells were made in triplicate for addition.

The plates were then incubated overnight (37 ℃/5% CO2) for the next day, the medium was discarded, the plates were washed 2 times with double distilled water and 3 times with wash buffer, and tapped on a paper towel to remove residual wash buffer. Primary antibody was then detected by dilution with PBS containing 10% FBS and added to each well at 100. mu.l/well. The well plate was incubated at room temperature for 2 hours, washed 3 times with wash buffer and the well plate was tapped on a paper towel to remove excess wash buffer.

PBS containing 10% FBS was used at 1: streptavidin-alkaline phosphatase was diluted 100, 100 microliters of diluted streptavidin-alkaline phosphatase was added to each well and the wells were incubated for 1 hour at room temperature. The plate was then washed 3 times with wash buffer and 2 times with PBS, and the excess wash buffer and PBS was removed by tapping the plate on a paper towel. After washing, 100 microliter of BCIP/NBT solution provided by the kit is added for development. And covering the well plate with tinfoil paper in the developing period, keeping the well plate in the dark, and standing for 5-15 minutes. Spots on the developing plate were routinely detected during this period to determine the optimum time for terminating the reaction. The BCIP/NBT solution was removed and the well plate was rinsed with double-distilled water to stop the development reaction, spun-dried, then the bottom of the well plate was removed, the well plate was dried at room temperature until each well was completely dried, and then the spots formed in the bottom film of the well plate were counted using an immune spot plate counter (CTL, cell technology limited).

Results

AFP TCR transduced T cells were tested for IFN- γ release by ELISPOT assay (described above) in response to AFP158-166FMNKFIYEI short peptide loaded target cells and non-specific short peptide loaded target cells. The number of ELSPOT spots observed in each well was plotted using graphpadprist 6.

The results of the experiment are shown in FIG. 9, AFPCD8 alone⁺Addition of the corresponding short peptides by T cells (effector cells) or LCL cells (target cells) releases little IFN-. gamma..

AFP CD8⁺T cells (effector cells) were able to react with LCL-A02/A11 cells with added AFP to release more IFN-. gamma.s.

AFP CD8⁺T cells (effector cells) released little IFN-. gamma.from LCL-A02/A11 cells supplemented with other short peptides.

CD8⁺T cells (negative control effector cells) released very little IFN-. gamma.from LCL-A02/A11 cells supplemented with AFP.

Non-radioactive cytotoxicity assay protocol

This test is a colorimetric substitution test for the 51Cr release cytotoxicity test, and quantitatively determines Lactate Dehydrogenase (LDH) released after cell lysis. LDH released in the medium was detected using a 30 min coupled enzymatic reaction in which LDH converted a tetrazolium salt (INT) to red formazan (formazan). The amount of red product produced is proportional to the number of cells lysed. 490nm visible absorbance data can be collected using a standard 96-well plate reader.

Material

CytoTox

Non-radioactive cytotoxicity assays (Promega, G1780) contained a substrate mixture, assay buffer, lysis solution and stop buffer.

Test medium: 5% FBS (heat-inactivated, Gibbo, Cat. No. 16000-044), 95% RPMI1640 without phenol red (Gibbo, Cat. No. 11835-030), 1% penicillin/streptomycin (Gibbo, Cat. No. 15070-063).

Microwell round bottom 96 well tissue culture plates (Nunc, Cat. No. 163320)

96-well immunoplate Maxisorb (Nunc, Cat. No. 442404)

Method of producing a composite material

Target cell preparation

The target cells used in this experiment were HepG2 (conventional cell line, purchased from ATCC), HLF (conventional cell line, purchased from ATCC), Mel526 (conventional cell line, purchased from ATCC). Preparation of targets in test mediaCell: the concentration of the target cells is adjusted to 1.5X 10⁵One/ml, 100. mu.l/well to obtain 1.5X 10⁴Individual cells/well.

Effector cell preparation

The effector cells (T cells) of this assay were CD8 expressing an AFP-specific TCR as analyzed by flow cytometry in example 3⁺T cells. Effector cell to target cell ratio 10:1,5: 1,2.5: 1,1.25:1 (diluted to 1.5X 10 if 10:1)⁶One/ml, 100. mu.l/well to obtain 1.5X 10⁵Individual cells/well).

(a) Detection of effector cell killing by target cells expressing different antigens

Preparation of the test

The components of the assay were added to round bottom 96 well tissue culture plates as follows:

experimental groups: contains 100ul effector cells and 100ul target cells.

Effector cells release spontaneously: there were only 100ul of effector cells.

Target cells release: there are only 100ul target cells.

Maximum release of target cells: there are only 100ul target cells.

Reagent medium control: there were only 200ul of medium.

All wells were made in triplicate with a final volume of 200ul (insufficient media make-up).

Incubate at 37 ℃ for 24 hours. Before collecting the supernatants from all wells, the target cells maximum release control wells were placed on the cells at-70 ℃ for approximately 30 minutes and thawed at 37 ℃ for 15 minutes to allow total lysis of the target cells.

The plate was centrifuged at 250g for 4 min. 50ul of supernatant from each well of the assay plate was transferred to the corresponding well of a 96-well immunoplate Maxisorb plate. The substrate mixture was reconstituted with assay buffer (12ml) and 50ul was added to each well of the plate. The plate was covered and incubated in the dark at room temperature for 30 minutes. 50ul of stop solution was added to each well of the plate to stop the reaction. The absorbance at 490nm was recorded counted over 1 hour after addition of the stop solution.

Calculation results

The absorbance values of the medium background were subtracted from all the absorbance values of the experimental, target cell spontaneous release and effector cell spontaneous release groups.

The corrected values obtained above were substituted into the following formula to calculate the percent cytotoxicity resulting from each effect-to-target ratio.

% cytotoxicity 100 × (experiment-effector cell spontaneous-target cell spontaneous)/(target cell maximal-target cell spontaneous)

Results

The AFP TCR transduced T cells were tested for LDH release in response to AFP positive and non-specific target cells by a non-radioactive cytotoxicity assay (as described above). The absorbance of 490nm visible light in each well was plotted using graphpad prism 6.

The statistical result of the experimental data is shown in fig. 10, the killing effect of AFP CD8+ T cells on AFP positive target cells HepG2 is obvious, and the killing effect is gradually enhanced along with the increase of an effective target ratio E: T (1.25:1, 2.5:1, 5:1, 10: 1); has no obvious killing effect on nonspecific target cells HLF and Mel 526. The T cells (Non-AFP TCR-T, effector cells expressing other TCR) transduced by Non-AFP TCR in the control group have no obvious killing effect on AFP positive tumor cells HepG2, and thus the Non-AFP TCR cells have no recognition effect on AFP158-166FMNKFIYEI short peptides.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Guangzhou biomedical and health research institute of Chinese academy of sciences

<120> T cell receptor for identifying AFP antigen short peptide and its coding sequence

<130>P2018-0551

<160>29

<170>SIPOSequenceListing 1.0

<210>1

<211>114

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>1

Ala Gln Ser Val Thr Gln Pro Asp Ile His Ile Thr Val Ser Glu Gly

1 5 10 15

Ala Ser Leu Glu Leu Arg Cys Asn Tyr Ser Tyr Gly Ala Thr Pro Tyr

20 25 30

Leu Phe Trp Tyr Val Gln Ser Pro Gly Gln Gly Leu Gln Leu Leu Leu

35 40 45

Lys Tyr Phe Ser Gly Asp Thr Leu Val Gln Gly Ile Lys Gly Phe Glu

50 55 60

Ala Glu Phe Lys Arg Ser Gln Ser Ser Phe Asn Leu Arg Lys Pro Ser

65 70 75 80

Val His Trp Ser Asp Ala Ala Glu Tyr Phe Cys Ala Val Leu Asp Asn

85 90 95

Tyr Gly Gln Asn Phe Val Phe Gly Pro Gly Thr Arg Leu Ser Val Leu

100 105 110

Pro Tyr

<210>2

<211>342

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>2

gcccagtcag tgacccagcc tgacatccac atcactgtct ctgaaggagc ctcactggag 60

ttgagatgta actattccta tggggcaaca ccttatctct tctggtatgt ccagtccccc 120

ggccaaggcc tccagctgct cctgaagtac ttttcaggag acactctggt tcaaggcatt 180

aaaggctttg aggctgaatt taagaggagt caatcttcct tcaacctgag gaaaccctct 240

gtgcattgga gtgatgctgc tgagtacttc tgtgctgtac tggataacta tggtcagaat 300

tttgtctttg gtcccggaac cagattgtcc gtgctgccct at 342

<210>3

<211>254

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>3

Ala Gln Ser Val Thr Gln Pro Asp Ile His Ile Thr Val Ser Glu Gly

1 5 10 15

Ala Ser Leu Glu Leu Arg Cys Asn Tyr Ser Tyr Gly Ala Thr Pro Tyr

20 25 30

Leu Phe Trp Tyr Val Gln Ser Pro Gly Gln Gly Leu Gln Leu Leu Leu

35 40 45

Lys Tyr Phe Ser Gly Asp Thr Leu Val Gln Gly Ile Lys Gly Phe Glu

50 55 60

Ala Glu Phe Lys Arg Ser Gln Ser Ser Phe Asn Leu Arg Lys Pro Ser

65 70 75 80

Val His Trp Ser Asp Ala Ala Glu Tyr Phe Cys Ala Val Leu Asp Asn

85 90 95

Tyr Gly Gln Asn Phe Val Phe Gly Pro Gly Thr Arg Leu Ser Val Leu

100 105 110

Pro Tyr Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp Ser

115 120 125

Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln

130 135 140

Thr Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys

145 150 155 160

Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val

165 170 175

Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn

180 185 190

Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys

195 200 205

Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn

210 215 220

Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val

225 230 235 240

Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser

245 250

<210>4

<211>762

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>4

gcccagtcag tgacccagcc tgacatccac atcactgtct ctgaaggagc ctcactggag 60

ttgagatgta actattccta tggggcaaca ccttatctct tctggtatgt ccagtccccc 120

ggccaaggcc tccagctgct cctgaagtac ttttcaggag acactctggt tcaaggcatt 180

aaaggctttg aggctgaatt taagaggagt caatcttcct tcaacctgag gaaaccctct 240

gtgcattgga gtgatgctgc tgagtacttc tgtgctgtac tggataacta tggtcagaat 300

tttgtctttg gtcccggaac cagattgtcc gtgctgccct atatccagaa ccctgaccct 360

gccgtgtacc agctgagaga ctctaaatcc agtgacaagt ctgtctgcct attcaccgat 420

tttgattctc aaacaaatgt gtcacaaagt aaggattctg atgtgtatat cacagacaaa 480

actgtgctag acatgaggtc tatggacttc aagagcaaca gtgctgtggc ctggagcaac 540

aaatctgact ttgcatgtgc aaacgccttc aacaacagca ttattccaga agacaccttc 600

ttccccagcc cagaaagttc ctgtgatgtc aagctggtcg agaaaagctt tgaaacagat 660

acgaacctaa actttcaaaa cctgtcagtg attgggttcc gaatcctcct cctgaaagtg 720

gccgggttta atctgctcat gacgctgcgg ctgtggtcca gc 762

<210>5

<211>112

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>5

Glu Ala Gly Val Ala Gln Ser Pro Arg Tyr Lys Ile Ile Glu Lys Arg

1 5 10 15

Gln Ser Val Ala Phe Trp Cys Asn Pro Ile Ser Gly His Ala Thr Leu

20 25 30

Tyr Trp Tyr Gln Gln Ile Leu Gly Gln Gly Pro Lys Leu Leu Ile Gln

35 40 45

Phe Gln Asn Asn Gly Val Val Asp Asp Ser Gln Leu Pro Lys Asp Arg

50 55 60

Phe Ser Ala Glu Arg Leu Lys Gly Val Asp Ser Thr Leu Lys Ile Gln

65 70 75 80

Pro Ala Lys Leu Glu Asp Ser Ala Val Tyr Leu Cys Ala Ser Ser Leu

85 90 95

Gly Pro Tyr Glu Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val Thr

100 105 110

<210>6

<211>336

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>6

gaagctggag ttgcccagtc tcccagatat aagattatag agaaaaggca gagtgtggct 60

ttttggtgca atcctatatc tggccatgct accctttact ggtaccagca gatcctggga 120

cagggcccaa agcttctgat tcagtttcag aataacggtg tagtggatga ttcacagttg 180

cctaaggatc gattttctgc agagaggctc aaaggagtag actccactct caagatccaa 240

cctgcaaagc ttgaggactc ggccgtgtat ctctgtgcca gcagcttggg gccctacgag 300

cagtacttcg ggccgggcac caggctcacg gtcaca 336

<210>7

<211>290

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>7

Glu Ala Gly Val Ala Gln Ser Pro Arg Tyr Lys Ile Ile Glu Lys Arg

1 5 10 15

Gln Ser Val Ala Phe Trp Cys Asn Pro Ile Ser Gly His Ala Thr Leu

20 25 30

Tyr Trp Tyr Gln Gln Ile Leu Gly Gln Gly Pro Lys Leu Leu Ile Gln

35 40 45

Phe Gln Asn Asn Gly Val Val Asp Asp Ser Gln Leu Pro Lys Asp Arg

50 55 60

Phe Ser Ala Glu Arg Leu Lys Gly Val Asp Ser Thr Leu Lys Ile Gln

65 70 75 80

Pro Ala Lys Leu Glu Asp Ser Ala Val Tyr Leu Cys Ala Ser Ser Leu

85 90 95

Gly Pro Tyr Glu Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val Thr

100 105 110

Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu Pro

115 120 125

Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys Leu

130 135 140

Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val Asn

145 150 155 160

Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro Leu Lys

165 170 175

Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg Leu

180 185 190

Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe Arg Cys

195 200 205

Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln Asp

210 215 220

Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg

225 230 235 240

Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser

245 250 255

Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala

260 265 270

Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp

275 280 285

Ser Arg

290

<210>8

<211>873

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>8

gaagctggag ttgcccagtc tcccagatat aagattatag agaaaaggca gagtgtggct 60

ttttggtgca atcctatatc tggccatgct accctttact ggtaccagca gatcctggga 120

cagggcccaa agcttctgat tcagtttcag aataacggtg tagtggatga ttcacagttg 180

cctaaggatc gattttctgc agagaggctc aaaggagtag actccactct caagatccaa 240

cctgcaaagc ttgaggactc ggccgtgtat ctctgtgcca gcagcttggg gccctacgag 300

cagtacttcg ggccgggcac caggctcacg gtcacagagg acctgaaaaa cgtgttccca 360

cccgaggtcg ctgtgtttga gccatcagaa gcagagatct cccacaccca aaaggccaca 420

ctggtgtgcc tggccacagg cttctacccc gaccacgtgg agctgagctg gtgggtgaat 480

gggaaggagg tgcacagtgg ggtcagcaca gacccgcagc ccctcaagga gcagcccgcc 540

ctcaatgact ccagatactg cctgagcagc cgcctgaggg tctcggccac cttctggcag 600

aacccccgca accacttccg ctgtcaagtc cagttctacg ggctctcgga gaatgacgag 660

tggacccagg atagggccaa acctgtcacc cagatcgtca gcgccgaggc ctggggtaga 720

gcagactgtg gcttcacctc cgagtcttac cagcaagggg tcctgtctgc caccatcctc 780

tatgagatct tgctagggaa ggccaccttg tatgccgtgc tggtcagtgc cctcgtgctg 840

atggccatgg tcaagagaaa ggattccaga ggc 873

<210>9

<211>9

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>9

Phe Met Asn Lys Phe Ile Tyr Glu Ile

1 5

<210>10

<211>6

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>10

Tyr Gly Ala Thr Pro Tyr

1 5

<210>11

<211>8

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>11

Tyr Phe Ser Gly Asp Thr Leu Val

1 5

<210>12

<211>13

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>12

Cys Ala Val Leu Asp Asn Tyr Gly Gln Asn Phe Val Phe

1 5 10

<210>13

<211>5

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>13

Ser Gly His Ala Thr

1 5

<210>14

<211>6

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>14

Phe Gln Asn Asn Gly Val

1 5

<210>15

<211>12

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>15

Cys Ala Ser Ser Leu Gly Pro Tyr Glu Gln Tyr Phe

1 5 10

<210>16

<211>18

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>16

tatggggcaa caccttat 18

<210>17

<211>24

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>17

tacttttcag gagacactct ggtt 24

<210>18

<211>39

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>18

tgtgctgtac tggataacta tggtcagaat tttgtcttt 39

<210>19

<211>15

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>19

tctggccatg ctacc 15

<210>20

<211>18

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>20

tttcagaata acggtgta 18

<210>21

<211>36

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>21

tgtgccagca gcttggggcc ctacgagcag tacttc 36

<210>22

<211>273

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>22

Met Leu Leu Glu Leu Ile Pro Leu Leu Gly Ile His Phe Val Leu Arg

1 5 10 15

Thr Ala Arg Ala Gln Ser Val Thr Gln Pro Asp Ile His Ile Thr Val

20 25 30

Ser Glu Gly Ala Ser Leu Glu Leu Arg Cys Asn Tyr Ser Tyr Gly Ala

35 40 45

Thr Pro Tyr Leu Phe Trp Tyr Val Gln Ser Pro Gly Gln Gly Leu Gln

50 55 60

Leu Leu Leu Lys Tyr Phe Ser Gly Asp Thr Leu Val Gln Gly Ile Lys

65 70 75 80

Gly Phe Glu Ala Glu Phe Lys Arg Ser Gln Ser Ser Phe Asn Leu Arg

85 90 95

Lys Pro Ser Val His Trp Ser Asp Ala Ala Glu Tyr Phe Cys Ala Val

100 105 110

Leu Asp Asn Tyr Gly Gln Asn Phe Val Phe Gly Pro Gly Thr Arg Leu

115 120 125

Ser Val Leu Pro Tyr Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu

130 135 140

Arg Asp Ser Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe

145 150 155 160

Asp Ser Gln Thr Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile

165 170 175

Thr Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn

180 185 190

Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala

195 200 205

Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu

210 215 220

Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr

225 230 235 240

Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu

245 250 255

Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser

260 265 270

Ser

<210>23

<211>819

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>23

atgctcctgg agcttatccc actgctgggg atacattttg tcctgagaac tgccagagcc 60

cagtcagtga cccagcctga catccacatc actgtctctg aaggagcctc actggagttg 120

agatgtaact attcctatgg ggcaacacct tatctcttct ggtatgtcca gtcccccggc 180

caaggcctcc agctgctcct gaagtacttt tcaggagaca ctctggttca aggcattaaa 240

ggctttgagg ctgaatttaa gaggagtcaa tcttccttca acctgaggaa accctctgtg 300

cattggagtg atgctgctga gtacttctgt gctgtactgg ataactatgg tcagaatttt 360

gtctttggtc ccggaaccag attgtccgtg ctgccctata tccagaaccc tgaccctgcc 420

gtgtaccagc tgagagactc taaatccagt gacaagtctg tctgcctatt caccgatttt 480

gattctcaaa caaatgtgtc acaaagtaag gattctgatg tgtatatcac agacaaaact 540

gtgctagaca tgaggtctat ggacttcaag agcaacagtg ctgtggcctg gagcaacaaa 600

tctgactttg catgtgcaaa cgccttcaac aacagcatta ttccagaaga caccttcttc 660

cccagcccag aaagttcctg tgatgtcaag ctggtcgaga aaagctttga aacagatacg 720

aacctaaact ttcaaaacct gtcagtgatt gggttccgaa tcctcctcct gaaagtggcc 780

gggtttaatc tgctcatgac gctgcggctg tggtccagc 819

<210>24

<211>309

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>24

Met Gly Thr Arg Leu Leu Cys Trp Ala Ala Leu Cys Leu Leu Gly Ala

1 5 10 15

Glu Leu Thr Glu Ala Gly Val Ala Gln Ser Pro Arg Tyr Lys Ile Ile

20 25 30

Glu Lys Arg Gln Ser Val Ala Phe Trp Cys Asn Pro Ile Ser Gly His

35 40 45

Ala Thr Leu Tyr Trp Tyr Gln Gln Ile Leu Gly Gln Gly Pro Lys Leu

50 55 60

Leu Ile Gln Phe Gln Asn Asn Gly Val Val Asp Asp Ser Gln Leu Pro

65 70 75 80

Lys Asp Arg Phe Ser Ala Glu Arg Leu Lys Gly Val Asp Ser Thr Leu

85 90 95

Lys Ile Gln Pro Ala Lys Leu Glu Asp Ser Ala Val Tyr Leu Cys Ala

100 105 110

Ser Ser Leu Gly Pro Tyr Glu Gln Tyr Phe Gly Pro Gly Thr Arg Leu

115 120 125

Thr Val Thr Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val

130 135 140

Phe Glu Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu

145 150 155 160

Val Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp

165 170 175

Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln

180 185 190

Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser

195 200 205

Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His

210 215 220

Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp

225 230 235 240

Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala

245 250 255

Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly

260 265 270

Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr

275 280 285

Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys

290 295 300

Arg Lys Asp Ser Arg

305

<210>25

<211>930

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>25

atgggcacca ggctcctctg ctgggcggcc ctctgtctcc tgggagcaga actcacagaa 60

gctggagttg cccagtctcc cagatataag attatagaga aaaggcagag tgtggctttt 120

tggtgcaatc ctatatctgg ccatgctacc ctttactggt accagcagat cctgggacag 180

ggcccaaagc ttctgattca gtttcagaat aacggtgtag tggatgattc acagttgcct 240

aaggatcgat tttctgcaga gaggctcaaa ggagtagact ccactctcaa gatccaacct 300

gcaaagcttg aggactcggc cgtgtatctc tgtgccagca gcttggggcc ctacgagcag 360

tacttcgggc cgggcaccag gctcacggtc acagaggacc tgaaaaacgt gttcccaccc 420

gaggtcgctg tgtttgagcc atcagaagca gagatctccc acacccaaaa ggccacactg 480

gtgtgcctgg ccacaggctt ctaccccgac cacgtggagc tgagctggtg ggtgaatggg 540

aaggaggtgc acagtggggt cagcacagac ccgcagcccc tcaaggagca gcccgccctc 600

aatgactcca gatactgcct gagcagccgc ctgagggtct cggccacctt ctggcagaac 660

ccccgcaacc acttccgctg tcaagtccag ttctacgggc tctcggagaa tgacgagtgg 720

acccaggata gggccaaacc tgtcacccag atcgtcagcg ccgaggcctg gggtagagca 780

gactgtggct tcacctccga gtcttaccag caaggggtcc tgtctgccac catcctctat 840

gagatcttgc tagggaaggc caccttgtat gccgtgctgg tcagtgccct cgtgctgatg 900

gccatggtca agagaaagga ttccagaggc 930

<210>26

<211>208

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>26

Met Ala Gln Ser Val Thr Gln Pro Asp Ile His Ile Thr Val Ser Glu

1 5 10 15

Gly Ala Ser Leu Glu Leu Arg Cys Asn Tyr Ser Tyr Gly Ala Thr Pro

20 25 30

Tyr Leu Phe Trp Tyr Val Gln Ser Pro Gly Gln Gly Leu Gln Leu Leu

35 40 45

Leu Lys Tyr Phe Ser Gly Asp Thr Leu Val Gln Gly Ile Lys Gly Phe

50 55 60

Glu Ala Glu Phe Lys Arg Ser Gln Ser Ser Phe Asn Leu Arg Lys Pro

65 70 75 80

Ser Val His Trp Ser Asp Ala Ala Glu Tyr Phe Cys Ala Val Leu Asp

85 90 95

Asn Tyr Gly Gln Asn Phe Val Phe Gly Pro Gly Thr Arg Leu Ser Val

100 105 110

Leu Pro Tyr Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp

115 120 125

Ser Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser

130 135 140

Gln Thr Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp

145 150 155 160

Lys Cys Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala

165 170 175

Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn

180 185 190

Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser

195 200 205

<210>27

<211>627

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>27

atggcacaat cagttaccca gcctgacatc cacatcactg tctctgaagg agcctcactg 60

gagttgagat gtaactattc ctatggggca acaccttatc tcttctggta tgtccagtcc 120

cccggccaag gcctccagct gctcctgaag tacttttcag gagacactct ggttcaaggc 180

attaaaggct ttgaggctga atttaagagg agtcaatctt ccttcaacct gaggaaaccc 240

tctgtgcatt ggagtgatgc tgctgagtac ttctgtgctg tactggataa ctatggtcag 300

aattttgtct ttggtcccggaaccagattg tccgtgctgc cctatatcca gaaccctgac 360

cctgccgtgt accagctgag agactctaag tcgagtgaca agtctgtctg cctattcacc 420

gattttgatt ctcaaacaaa tgtgtcacaa agtaaggatt ctgatgtgta tatcacagac 480

aaatgtgtgc tagacatgag gtctatggac ttcaagagca acagtgctgt ggcctggagc 540

aacaaatctg actttgcatg tgcaaacgcc ttcaacaaca gcattattcc agaagacacc 600

ttcttcccca gcccagaaag ttcctaa 627

<210>28

<211>243

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>28

Met Glu Ala Gly Val Ala Gln Ser Pro Arg Tyr Lys Ile Ile Glu Lys

1 5 10 15

Arg Gln Ser Val Ala Phe Trp Cys Asn Pro Ile Ser Gly His Ala Thr

20 25 30

Leu Tyr Trp Tyr Gln Gln Ile Leu Gly Gln Gly Pro Lys Leu Leu Ile

35 40 45

Gln Phe Gln Asn Asn Gly Val Val Asp Asp Ser Gln Leu Pro Lys Asp

50 55 60

Arg Phe Ser Ala Glu Arg Leu Lys Gly Val Asp Ser Thr Leu Lys Ile

65 70 75 80

Gln Pro Ala Lys Leu Glu Asp Ser Ala Val Tyr Leu Cys Ala Ser Ser

85 90 95

Leu Gly Pro Tyr Glu Gln Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val

100 105 110

Thr Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu

115 120 125

Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys

130 135 140

Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val

145 150 155 160

Asn Gly Lys Glu Val His Ser Gly Val Cys Thr Asp Pro Gln Pro Leu

165 170 175

Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Ala Leu Ser Ser Arg

180 185 190

Leu Arg Val Ser Ala Thr Phe Trp Gln Asp Pro Arg Asn His Phe Arg

195 200 205

Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln

210 215 220

Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly

225 230 235 240

Arg Ala Asp

<210>29

<211>732

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>29

atggaagctg gagttgcaca gtctcccaga tataagatta tagagaaaag gcagagtgtg 60

gctttttggt gcaatcctat atctggccat gctacccttt actggtacca gcagatcctg 120

ggacagggcc caaagcttct gattcagttt cagaataacg gtgtagtgga tgattcacag 180

ttgcctaagg atcgattttc tgcagagagg ctcaaaggag tagactccac tctcaagatc 240

caacctgcaa agcttgagga ctcggccgtg tatctctgtg ccagcagctt ggggccctac 300

gagcagtact tcgggccggg caccaggctc acggtcacag aggacctgaa aaacgtgttc 360

ccacccgagg tcgctgtgtt tgagccatca gaagcagaga tctcccacac ccaaaaggcc 420

acactggtgt gcctggccac cggtttctac cccgaccacg tggagctgag ctggtgggtg 480

aatgggaagg aggtgcacag tggggtctgc acagacccgc agcccctcaa ggagcagccc 540

gccctcaatg actccagata cgctctgagc agccgcctga gggtctcggc caccttctgg 600

caggaccccc gcaaccactt ccgctgtcaa gtccagttct acgggctctc ggagaatgac 660

gagtggaccc aggatagggc caaacccgtc acccagatcg tcagcgccga ggcctggggt 720

agagcagact aa 732

Claims (10)

1. A T Cell Receptor (TCR) capable of binding to the FMNKFIYEI-HLA A0201 complex, preferably the TCR comprises a TCR β chain variable domain and a TCR beta chain variable domain, wherein the amino acid sequence of CDR3 of the TCR β chain variable domain is CAVLDNYGQNFVF (SEQ ID NO:12) and/or the amino acid sequence of CDR3 of the TCR beta chain variable domain is CASSLGPYEQYF (SEQ ID NO: 15);

more preferably, the 3 Complementarity Determining Regions (CDRs) of the TCR α chain variable domain are:

αCDR1-YGATPY(SEQ ID NO:10)

αCDR2-YFSGDTLV(SEQ ID NO:11)

α CDR3-CAVLDNYGQNFVF (SEQ ID NO:12), and/or

the 3 complementarity determining regions of the TCR β chain variable domain are:

βCDR1-SGHAT(SEQ ID NO:13)

βCDR2-FQNNGV(SEQ ID NO:14)

βCDR3-CASSLGPYEQYF(SEQ ID NO:15)。

2. a TCR as claimed in claim 1 which comprises a TCR α chain variable domain which is an amino acid sequence having at least 90% sequence identity to SEQ ID No. 1 and a TCR β chain variable domain which is an amino acid sequence having at least 90% sequence identity to SEQ ID No. 5.

3. a TCR as claimed in claim 1 wherein a conjugate is attached to the C-or N-terminus of the α and/or β chains of the TCR, preferably wherein the conjugate which binds to the T cell receptor is a detectable label, a therapeutic agent, a PK modifying moiety or a combination of any of these, preferably wherein the therapeutic agent is an anti-CD 3 antibody.

4. A multivalent TCR complex comprising at least two TCR molecules, at least one of which is a TCR as claimed in any one of the preceding claims.

5. A nucleic acid molecule comprising a nucleic acid sequence encoding a TCR molecule according to any preceding claim, or the complement thereof;

preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO 2 encoding the variable domain of the TCR α chain and/or

the nucleic acid molecule comprises a nucleotide sequence SEQ ID NO 6 encoding the variable domain of the TCR β chain.

6. A vector comprising the nucleic acid molecule of claim 5; preferably, the vector is a viral vector; more preferably, the vector is a lentiviral vector.

7. An isolated host cell comprising the vector of claim 6 or a nucleic acid molecule of claim 5 integrated into the chromosome.

8. A cell which transduces the nucleic acid molecule of claim 5 or the vector of claim 6; preferably, the cell is a T cell or a stem cell.

9. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a TCR according to any one of claims 1-3, a TCR complex according to claim 4, a nucleic acid molecule according to claim 5, or a cell according to claim 8.

10. Use of a T cell receptor according to any one of claims 1 to 3, or a TCR complex according to claim 4 or a cell according to claim 8, for the preparation of a medicament for the treatment of a tumour or an autoimmune disease.

Images