CN111154777A

CN111154777A - Recombinant human papilloma virus protein expression

Info

Publication number: CN111154777A
Application number: CN202010040941.3A
Authority: CN
Inventors: 田平生; 仝鑫; 许丹; 丛薇; 刘瑞峰; 张梦华; 葛方昕; 魏健; 刘家骅; 邬丹丽; 曾宪放; 王子龙; 史力
Original assignee: Shanghai Zerun Biotech Co Ltd
Current assignee: Shanghai Zerun Biotech Co Ltd
Priority date: 2014-02-18
Filing date: 2014-02-18
Publication date: 2020-05-15
Anticipated expiration: 2034-02-18
Also published as: CN104845985A; CN104845985B; CN117187262A; CN111154777B

Abstract

The invention discloses a codon-optimized human papilloma virus major capsid protein L1 encoding gene, which can efficiently express recombinant human papilloma virus major capsid protein L1 after being transferred into yeast cells. The invention also discloses a macromolecule with immunogenicity, which is mainly generated by expressing the codon-optimized human papilloma virus main capsid protein L1 encoding gene in yeast cells. The invention also discloses the use and compositions of the immunogenic macromolecules.

Description

Recombinant human papilloma virus protein expression

The application is a divisional application of an invention patent with the application date of 2014, 2, and 18, the application number of 201410054725.9 and the name of 'recombinant human papilloma virus protein expression'.

Technical Field

The invention relates to the field of molecular biology, in particular to genes of various human papilloma virus main capsid protein L1 which are optimized by codons and are suitable for being expressed in pichia pastoris, a vector containing the human papilloma virus main capsid protein L1 gene, a strain, a method for expressing the genes and application thereof.

Background

Human Papilloma Virus (HPV) is a small non-enveloped double-stranded circular DNA virus of the polyomaviridae subfamily papovaviridae. HPV can be transmitted by the close contact between human bodies, which causes the skin of infected persons to have lesions such as verruca vulgaris and anogenital condyloma acuminata, and is classified as a sexually transmitted disease. In 1995, the results of studies published by the international cancer research center demonstrated that HPV has a close causal relationship with cervical cancer. It follows that HPV infection has become a serious human health-threatening pathogen. Therefore, the development of the high-efficiency and low-cost HPV vaccine has very important significance for preventing female cervical carcinoma and sexually transmitted diseases caused by HPV infection.

Over 100 HPV types have been identified. By adopting a sensitive detection method, high-risk HPV-DNA can be detected from almost 100 percent of lesion tissues of cervical cancer patients. HPV is classified into low-risk type and high-risk type according to the relation between HPV subtype and female genital tract malignant tumor. HPV6, 11, 34, 40, 42 and other types are often found in benign cervical lesions such as cervical condyloma and cervical epithelial mild atypical hyperplasia, and belong to HPV low-risk types; the severe cervical epithelial dysplasia and cervical cancer are more commonly infected by HPV16, 18, 31, 33, 35, 39, 45, 52 and 58 types, and the subtypes are high-risk types. A series of studies in different populations have demonstrated that HPV16, 18 type infections of the reproductive tract are highly correlated with the occurrence of cervical cancer, and are more closely related than other risk factors. Of patients with cervical cancer, about 50-60% are caused by HPV16 infection, HPV18 accounts for about 14%, HPV45 accounts for about 8%, HPV31 accounts for about 5%, and the remaining 23% (Wallboomers JM. et al. J Pathol 1999; 189: 12-19). According to the report of the world health organization WHO 2010, HPV58 is a high-risk type with the HPV detection rate of the 3 rd position in cervical cancer in the mainland China, the incidence rate is 11.7%, and belongs to HPV subtypes with high incidence in China (China Human Papillomavirus and related cancers, Fact Sheet 2010, WHO/ICO Information Centre on HPV and CervicalCancer, Sep 15,2010).

Cervical cancer is the second major gynecological malignancy to breast cancer, and more than 50 million women are diagnosed with cervical cancer worldwide each year, and 27 million women die of the disease, with an age-normalized infection rate of 10.5%. As early as the 80 s, Haraldzur Hausen found that Human Papilloma Virus (HPV) infection was associated with cervical cancer onset, and a large number of subsequent studies have also demonstrated that HPV is closely related to cervical cancer and its precancerous lesions. To date, hundreds of HPV genotypes have been found, of which about 40 can infect the genital tract mucosa. The cumulative probability of cervical infection with at least one HPV in a normal woman during life is about 40%.

There is no systematic condyloma acuminatum and HPV related survey at home, but separate surveys in various regions can basically explain the important role of HPV6 and 11 in condyloma acuminatum. Recent epidemiological survey results in Shenzhen show that HPV6 and 11 type infectors account for about 80% of condyloma acuminatum patients (data source: distribution and significance of genital tract human papilloma virus gene subtypes of condyloma acuminatum patients in 352 cases of Shenzhen's national hospital, Down-sensitive; brave; Luxian; Leiyuan; third Junyu university report, No. 2007, No. 21); the results of the investigation in the near-Yiyi region showed that HPV6 and type 11 infectors accounted for 85.19% of condyloma acuminatum patients (data sources: genotyping and clinical analysis of HPV in 108 condyloma acuminatum patients, Adam, Community journal of medicine, No. 17, 2007).

HPV is a non-enveloped icosahedral symmetric virus, the virus genome DNA of which is in a closed loop shape and has the length of about 7200-8000bp and consists of an early coding region (early region), a late coding region (late region) and a long regulatory region (long control region) positioned between the early coding region and the late coding region. The late coding region contains two Open Reading Frames (ORFs) encoding viral capsid proteins L1 and L2. The L1 protein has a molecular weight of about 55kDa, is a main capsid protein, supports the whole virus capsid structure in the form of 72 pentamers, has highly conserved amino acid sequences in different types, and can stimulate the organism to produce protective antibodies. The L2 protein has smaller molecular weight and is positioned in the L1 protein.

Various expression systems such as insect expression systems, yeast expression systems, prokaryotic expression systems, and mammalian cells can obtain virus-like particles (VLPs) by expressing the major capsid protein L1 alone or by expressing L1+ L2 in combination. VLPs expressed alone in L1 are structurally similar to the natural viral capsid and can be used to induce high titer virus neutralizing antibody responses associated with protection from viral challenge.

Therefore, the L1 protein has high feasibility as a target protein for HPV vaccine development, because the L1 protein is highly conserved in different genotypes and can be expressed to form VLPs independently. However, the commercial development and production of VLPs obtained by expressing recombinant viral proteins as HPV vaccines requires solving a number of technical problems, among which the first to be solved is how to increase the expression level of recombinant viral proteins. In expression systems such as escherichia coli, pichia pastoris and baculovirus, the L1 protein is limited by the codon usage frequency of amino acids in organisms, so that the expression level is low or even no expression is caused. As described in Merck, U.S. Pat. No.7,498,036, wild-type VLP protein was expressed in Saccharomyces cerevisiae at about 35. mu.g/mg (VLP in disrupted supernatant/total protein in disrupted supernatant).

Therefore, there is a need in the art for a method of expressing genes at high levels, which should enable high-level, easy-to-handle, and low-cost expression of HPV genes.

Disclosure of Invention

In order to solve the above technical problems, according to a first aspect of the present invention, there is provided an IIPV gene capable of being expressed in pichia pastoris, the gene having an amino acid sequence of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10, or a nucleotide sequence shown in the figure.

The pichia pastoris is used as an expression system for expressing recombinant protein, has the characteristics of high expression quantity, simple and convenient operation, low cost and the like, and is more beneficial to human scale industrial production compared with higher insect cells and mammalian cells. Because the codon usage frequency of amino acid is different among different species, when pichia pastoris is used for expressing recombinant protein, a DNA sequence which is more beneficial to translation is obtained after codon optimization and adjustment according to the amino acid sequence of target protein. Therefore, the HPV gene subjected to codon optimization can obtain higher expression level in pichia pastoris, and is more favorable for research, development and production of preventive vaccines aiming at HPV. As shown in the examples of the application, the expression amounts of the codon-optimized HPV6, 11, 16, 18 and 58 genes in Pichia pastoris can reach up to about 134. mu.g/mg, 123. mu.g/mg, 135. mu.g/mg, 125. mu.g/mg and 132. mu.g/mg (VLP in the waste supernatant/total protein in the waste supernatant), respectively.

According to a second aspect of the present invention, there is provided a method for expressing HPV L1 gene in pichia pastoris, comprising the following steps:

(1) respectively cloning the HPV L1 genes into expression vectors;

(2) transforming the expression vector obtained in the step (1) into a pichia pastoris strain;

(3) screening the transformed strains obtained in the step (2) by using antibiotics to obtain one or more strains with the best growth condition;

(4) further screening the strains obtained in the step (3) by testing the expression level of each HPV L1 gene to obtain one or more strains with the highest expression level;

(5) performing expression by using the strain obtained in the step (4) to respectively obtain HPV L1 proteins.

According to a specific embodiment of the present invention, the expression vector in step (1) is pPICZ α B vector, and the antibiotic used in step (3) is zeocin.

According to a specific embodiment of the present invention, the pichia pastoris strain used in the step (2) is a pichia pastoris X-33 strain.

According to a specific embodiment of the present invention, the operation of testing the expression level of HPV L1 gene in step (4) is performed by a Western blot method.

According to a particular embodiment of the invention, the expression step in step (5) is a fermentation step carried out in a fermenter.

According to a third aspect of the present invention, there is provided an expression vector comprising each HPV L1 gene of the present invention.

According to a specific embodiment of the present invention, the expression vector containing each HPV L1 gene of the present invention is derived from a pPICZ α B vector.

According to the fourth aspect of the invention, a pichia pastoris strain containing the HPV L1 gene or the expression vector of the invention is provided, and the strain can express and produce each HPV L1 protein at a high level, thereby being more beneficial to the research and development and production of preventive vaccines aiming at HPV.

Drawings

FIG. 1 shows agarose electrophoresis after double digestion of HPV6L1 gene, 1: DL5000DNA Marker (Takara Co., Ltd.), 2: BstBI + KpnI double digestion pPICZ α B-6L1 sample 1, 3: BstBI + KpnI double digestion pPICZ α B-6L1 sample 2.

FIG. 2 shows agarose electrophoresis after double digestion of HPV11L1 gene, 1: DL5000DNA Marker (Takara Co., Ltd.), 2: BstBI + KpnI double digestion pPICZ α B-11L1 sample 1.

FIG. 3 shows agarose electrophoresis after double digestion of HPV16L1 gene.1: DL5000DNA Marker (Takara Co., Ltd.); 2: pPICZ α B-16L1 sample 1; 3: pPICZ α B-16L1 sample 2; 4: BstBI + KpnI double digestion pPICZ α B-16L1 sample 1; BstBI + KpnI double digestion pPICZ α B-16L1 sample 2.

FIG. 4 shows agarose electrophoresis after double digestion of HPV18L1 gene 1: DL5000DNA Marker (Takara Co., Ltd.) 2: BstBI + KpnI double digested pPICZ α B-18L1 sample.

FIG. 5 shows agarose electrophoresis after double digestion of HPV58L1 gene 1: BstBI + KpnI double digestion pPICZ α B-58L1 sample 2: DL5000DNA Marker (Takara Co.).

FIG. 6 shows Western-blot identification of HPV6L1 supernatant after disruption. 1-8: recombinant expression strains; 9: PageRuler Prestated Protein Ladder; 10: an empty host bacterium.

FIG. 7 shows Western-blot identification of HPV11L1 supernatant after disruption. 1-8: recombinant expression strains; 9: PageRuler Prestated Protein Ladder; 10: an empty host bacterium.

FIG. 8 shows Western-blot identification of HPVL6L1 supernatant after disruption. 1-8: recombinant expression strains; 9: PageRuler Prestated Protein Ladder; 10: an empty host bacterium.

FIG. 9 shows Western-blot identification of HPV18L1 supernatant after disruption. 1: PageRuler PrestatinedProtein Ladder; 2-10: recombinant expression strains.

FIG. 10 shows Western-blot identification of HPV58L1h supernatant after disruption. 1: PageRuler PrestatinedProtein Ladder; 2-5: recombinant expression strains.

FIG. 11 shows SDS-PAGE of HPV6L1 protein samples. 1-9: recombinant purified protein samples; 10: PageRuler Prestained Protein Ladder.

FIG. 12 shows SDS-PAGE of HPV11L1 protein samples. 1- -4: recombinant purified protein samples; 5: PageRuler Prestated Protein Ladder; 6-8: recombinant purified protein samples.

FIG. 13 shows SDS-PAGE of HPV16L1 protein samples. 1-7: recombinant purified protein samples; 8: PageRuler Prestained Protein Ladder.

FIG. 14 shows SDS-PAGE of HPV18L1 protein samples. 1-4: recombinant purified protein samples; 5: PageRuler Prestated Protein Ladder; 6-7: recombinant purified protein samples.

FIG. 15 shows the SDS-PAGE of IIPV58L1 protein samples. 1-5: recombinant purified protein samples; 6: PageRuler Prestated Protein Ladder; 7-8: recombinant purified protein samples.

FIG. 16 shows a transmission electron micrograph of virus-like particles after HPV6L1 purification.

FIG. 17 shows a transmission electron micrograph of virus-like particles after HPV11L1 purification.

FIG. 18 shows a transmission electron micrograph of virus-like particles after HPV16L1 purification.

FIG. 19 shows a transmission electron micrograph of virus-like particles after HPV18L1 purification.

FIG. 20 shows a transmission electron micrograph of virus-like particles after HPV58L1 purification.

DESCRIPTION OF THE SEQUENCES

SEQ ID NO: 1 is wild type HPV6L1 amino acid sequence.

SEQ ID NO: 2 is wild type HPV11L1 amino acid sequence.

SEQ ID NO: 3 is wild type HPV16L1 amino acid sequence.

SEQ ID NO: 4 is wild type HPV18LI amino acid sequence.

SEQ ID NO: 5 is wild type HPV58L1 amino acid sequence.

SEQ ID NO: 6 is the nucleotide sequence of IIPV6L1 gene of the present invention.

SEQ ID NO: 7 is the nucleotide sequence of HPV11L1 gene of the invention.

SEQ ID NO: 8 is the nucleotide sequence of HPV16L1 gene of the invention.

SEQ ID NO: 9 is the nucleotide sequence of the HPvl8L1 gene of the invention.

SEQ ID NO: 10 is the nucleotide sequence of HPV58L1 gene of the invention.

Detailed Description

The present invention is described in detail by the following examples so that those skilled in the art can better understand the present invention. The following examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.) but some errors and deviations should be accounted for. Unless otherwise indicated, temperature is in degrees Celsius or is ambient and pressure is near or equal to atmospheric. Restriction enzymes used in the examples described below were purchased from New England Biolab, Inc., unless otherwise indicated. It is to be understood that the instrumentation used in the examples described below is conventional in the art, unless otherwise indicated. The medium used is, unless otherwise stated, a commercially available conventional medium, the constituents and amounts of which are well known to those skilled in the art. For the sake of brevity, various common abbreviations may be used herein, the meaning of which is fully understood by those skilled in the art.

Examples

Example 1: codon optimized design of HPVL1

The genetic code is 64, but most organisms tend to use some of these codons. Pichia and human genes have respective preferences for codon usage. Since the genetic code is degenerate, each amino acid is encoded by more than one codon, and the codons for the same amino acid are used with different frequencies in the wild-type gene. Codon bias of pichia pastoris may lead to low translation efficiency and expression level of recombinant proteins, the present inventors have performed gene sequence engineering based on wild-type HPV6L1 amino acid sequence (Genebank CBY85547.1), HPV11L1 amino acid sequence (Genebank CCE60515.1), HPV16L1 amino acid sequence (Genebank AAC09292.1), HPV18L1 amino acid sequence (Genebank AAP20601.1) and HPV58L1 amino acid sequence (Genebank BAA 31851.1): all the amino acid genes thereof adopt codons with the highest usage frequency and higher usage frequency. The codon usage frequencies of Pichia yeast are shown in Table 1 (see http:// www.kazusa.or.jp/codon /). Then, on the basis, in order to avoid that the GC proportion of the translated mRNA is too high, the secondary structure of the mRNA affects the translation efficiency and some commonly used enzyme cutting sites, the inventor carries out certain modification on codons with the highest frequency, such as modifying some asparagine (Asn) highest frequency codons AAC to AAT, lysine (Lys) highest frequency codons AAG to AAA, aspartic acid (Asp) highest frequency codons GAT to GAC, phenylalanine (Phe) highest frequency codons TTT to TTC, tyrosine (Tyr) highest frequency codons TAC to TAT, and glycine (Gly) highest frequency codons GGT to GGA. The modified HPVL1 gene sequence does not contain the following intron recognition sequences and transcription factor binding sites: ATGACTCAT and TGCTA (transcription factor GCN4 binding site); ATATAA (binding site for GAL 4); TATTTAA (TBP binding site); ttagataa and ttacaa (YAP1 binding site); ATGACTAAT, respectively; ACTAATTAGG are provided.

Therefore, the inventor optimally designs a plurality of nucleotide sequences of HPV L1 genes suitable for pichia pastoris expression, synthesizes HPV L1 genes completely according to the sequences, clones the HPV L1 genes into the existing pichia pastoris expression vector, and constructs a recombinant pichia pastoris expression strain through homologous recombination and high-concentration antibiotic screening; and performing fermentation culture and methanol induction on the recombinant pichia pastoris to express the HPV L1 protein intracellularly. The brand new nucleotide sequences of HPV L1 genes are respectively screened out, HPV L1 proteins can be respectively highly expressed in Pichia pastoris, virus-like particles (VLPs) are simultaneously formed in cells, after the broken bacteria supernatant is purified by a chromatography method, the purity of the purified virus-like particles is more than 90 percent, and after an aluminum adjuvant is adsorbed, the vaccine has extremely high immunogenicity and can be used as a vaccine for preventing cervical cancer for human. The nucleotide sequence of the HPV L1 gene which is optimally designed is shown as SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: shown at 10.

TABLE 1Pichia Yeast codon Table

Example 2: construction of HPV L1 recombinant expression vector

The resulting HPV L1 gene sequence was cloned into pPICZalphaB vector (Invitrogen) by PCR to obtain HPV L1DNA fragments with BstBI and KpnI at both ends, PCR primers HPV6L1, forward primer 5'-CGATGGAACTTCGAAACGATGTGGAGACC-3' (BstBI) (SEQ ID NO: 11), reverse primer 5'-GACCTGGGTACCCTATTATCTCTTGGTTTTAG-3' (KpnI) (SEQ ID NO: 12), HPV11L1, forward primer 5'-CGATGGAACTTCGAAACGATGTGGAGACC-3' (BstBI) (SEQ ID NO: 13), reverse primer 5'-GACCTGGGTACCCTATTATTTCTTGG-3' (KpnT) (SEQ ID NO: 14), HPV16L1, forward primer 5'-CGATGGAACTTCGAAACGATGATGTCCTTG-3' (BstBI) (SEQ ID NO: 15), reverse primer 5'-GACCTGGGTACCCTATTAAAGCTTTC-3' (KpnI) (SEQ ID NO: 16), HPV18L1, forward primer 5'-CGATGGAACTTCGAAACGATGGCTTTGTGG-3' (BstBI) (SEQ ID NO: 17), reverse primer 5'-GACCTGGGTACCCTATTATTTTCTGGC-3' (SEQ ID NO) (SEQ ID NO: 18, SEQ ID NO: 36018), PCR products were recovered by electrophoresis at the following cycle of PCR for about 20 min after the PCR with the PCR amplification with BstBulZ 5 and PCR amplification, and the PCR products were digested for about 20 min at the reverse PCR amplification with the PCR fragments of BstBugZalpha DNA fragments were recovered by PCR after the PCR amplification with the sequence of BstBugZalpha DNA fragments containing BstBI DNA fragments containing BstBstBstBstBI DNA fragments (SEQ ID NO: 26), the sequence of BstBstBstBI DNA fragments were digested at 35, the sequence of BstBI DNA fragments of BstBstBstBstBI DNA fragments of BstBstBstBstBstBstBI DNA fragments of BstBstDNA fragments of BstDNA fragments of BstBA 5, the sequence of BstDNA fragments of BstBI DNA fragments of BstBA 5, the cDNA sequence of the sequence of BstDNA fragments of SEQ ID NO: 26, the cDNA sequence of SEQ ID NO: 26, the sequence of BstDNA fragments of the cDNA of BstDNA fragments of the sequence of BstDNA fragments of the cDNA of BstDNA fragments of cDNA sequence of SEQ ID NO: 26, the cDNA sequence of SEQ ID NO: 26.

Example 3: construction and expression of HPV L1 recombinant expression strain

Linearization of pPICZ6L1 with SacI, phenol after the cleavage reaction: removing protein with chloroform, adding 2.5 times volume of anhydrous ethanol, 1/10 volume of 3M NaAc (pH5.2) to precipitate DNA, washing the obtained precipitate with 75% 2 alcohol, oven drying, dissolving the precipitate with small amount of sterile ddH20, transferring Pichia pastoris host bacteria (Invitrogen), coating on YPDS plate (containing 180. mu.g/mLzeocin), and culturing at 30 deg.C for 3 days to obtain hundreds of clones. Several tens of clones were selected and inoculated on YPD plates (containing 1500. mu.g/mLzeocin), and high-copy plasmid strains were selected and cultured at 30 ℃ for 2 days. Partial clones grow faster, several clones with the best growth condition are selected and inoculated in 5mL YPD liquid culture medium, BMMY culture medium is replaced after 24 hours, and thalli are collected after 0.5% methanol induction for 48 hours. After the thalli are crushed by glass beads, supernatant obtained by centrifugation is identified by Western-blot (figure 6), and the primary antibody is the home-made rabbit polyclonal antibody. The strain with the highest expression level is frozen and stored at-80 ℃ to be used as a fermentation tank culture working seed.

Linearization of pPICZ11L1 with SacI, phenol: removing protein with chloroform, adding 2.5 times volume of anhydrous ethanol, 1/10 volume of 3M NaAc (pH5.2) to precipitate DNA, washing the obtained precipitate with 75% ethanol, oven drying, dissolving the precipitate with small amount of sterile ddH20, transferring Pichia pastoris host bacteria (Invitrogen), coating on YPDS plate (containing 180. mu.g/mLzeocin), and culturing at 30 deg.C for 3 days to obtain hundreds of clones. Several tens of clones were selected and inoculated on YPD plates (containing 1500. mu.g/mLzeocin), and high-copy plasmid strains were selected and cultured at 30 ℃ for 2 days. Partial clones grow faster, several clones with the best growth condition are selected and inoculated in 5mL YPD liquid culture medium, BMMY culture medium is replaced after 24 hours, and thalli are collected after 0.5% methanol induction for 48 hours. After the thalli are crushed by glass beads, supernatant obtained by centrifugation is identified by Western-blot (figure 7), and the primary antibody is the home-made rabbit polyclonal antibody. The strain with the highest expression level is frozen and stored at-80 ℃ to be used as a fermentation tank culture working seed.

Linearization of pPICZ16L1 with SacI, phenol: removing protein with chloroform, adding 2.5 times volume of anhydrous ethanol, 1/10 volume of 3M NaAc (pH5.2) to precipitate DNA, washing the obtained precipitate with 75% ethanol, oven drying, dissolving the precipitate with small amount of sterile ddH20, transferring Pichia pastoris host bacteria (Invitrogen), coating on YPDS plate (containing 180. mu.g/mLzeocin), and culturing at 30 deg.C for 3 days to obtain hundreds of clones. Several tens of clones were selected and inoculated on YPD plates (containing 1500. mu.g/mLzeocin), and high-copy plasmid strains were selected and cultured at 30 ℃ for 2 days. Partial clones grow faster, several clones with the best growth condition are selected and inoculated in 5mL YPD liquid culture medium, BMMY culture medium is replaced after 24 hours, and thalli are collected after 0.5% methanol induction for 48 hours. After the thalli are crushed by glass beads, supernatant obtained by centrifugation is identified by Western-blot (figure 8), and the primary antibody is the home-made rabbit polyclonal antibody. The strain with the highest expression level is frozen and stored at-80 ℃ to be used as a fermentation tank culture working seed.

Linearization of pPICZ18L1 with SacI, phenol: removing protein with chloroform, adding 2.5 times volume of anhydrous ethanol, 1/10 volume of 3M NaAc (pH5.2) to precipitate DNA, washing the obtained precipitate with 75% 7 alcohol, oven drying, dissolving the precipitate with small amount of sterile ddH2O, transferring Pichia host bacteria (Invitrogen), coating onto YPDS plate (containing 180. mu.g/mLzeocin), and culturing at 30 deg.C for 3 days to obtain hundreds of clones. Several tens of clones were selected and inoculated on YPD plates (containing 1500. mu.g/mLzeocin), and high-copy plasmid strains were selected and cultured at 30 ℃ for 2 days. Partial clones grow faster, and a plurality of clones with the best K-producing condition are selected and inoculated in 5mL YPD liquid culture medium, after 24 hours, BMMY culture medium is replaced, and after 48 hours of induction with 0.5% methanol, the thalli are collected. After the thalli are crushed by glass beads, supernatant obtained by centrifugation is identified by Western-blot (figure 9), and the primary antibody is the home-made rabbit polyclonal antibody. The strain with the highest expression level is frozen and stored at-80 ℃ to be used as a fermentation tank culture working seed.

Linearization of pPICZ58L1 with SacI, phenol: removing protein with chloroform, adding 2.5 times volume of anhydrous ethanol, 1/10 volume of 3M NaAc (pH5.2) to precipitate DNA, washing the obtained precipitate with 75% ethanol, oven drying, dissolving the precipitate with small amount of sterile ddH20, transferring Pichia pastoris host bacteria (Invitrogen), coating on YPDS plate (containing 180. mu.g/mLzeocin), and culturing at 30 deg.C for 3 days to obtain hundreds of clones. Several tens of clones were selected and inoculated on YPD plates (containing 1500. mu.g/mLzeocin), and high-copy plasmid strains were selected and cultured at 30 ℃ for 2 days. Partial clones grow faster, several clones with the best growth condition are selected and inoculated in 5mL YPD liquid culture medium, BMMY culture medium is replaced after 24 hours, and thalli are collected after 0.5% methanol induction for 48 hours. After the thalli are crushed by glass beads, supernatant obtained by centrifugation is identified by Western-blot (figure 10), and the primary antibody is the home-made rabbit polyclonal antibody. The strain with the highest expression level is frozen and stored at-80 ℃ to be used as a fermentation tank culture working seed.

Example 4: fermenter culture of HPV L1 recombinant protein

From the working seed bank of the genetically engineered bacteria expressing IIPV6L1 obtained in example 3, 1 strain was taken out of a glycerol cryopreservation tube, and after thawing, 100. mu.L of the strain was inoculated into 5mL of YPD medium and cultured at 280 revolutions per minute (rpm) at 30 ℃ for 20 hours. The density of the cells reaches OD600 of about 1-2. The microscopic examination is free from the contamination of foreign bacteria. 1mL of the activation solution which was passed through the examination was inoculated into 500mL of YPD medium and cultured at 280rpm at 30 ℃ for 20 hours. The density of the thallus reaches OD₆₀₀About 2 to about 6. The microscopic examination is free from the contamination of foreign bacteria. Basic salt culture medium BSM1 (K) for fermentation₂SO₄273g，MgSO₄109g，CaSO₄·2H₂O17.6g，H₃PO₄400.5mL, KOH62g, glycerol 600g, PTM160mL, 1mL of bubbled 1, deionized water to 15L), no antibiotics, were formulated and sterilized in a 30L fermentor (Bioengineering Co.). Sterilizing at 121 deg.C for 30min, and cooling to 30 deg.C. Inoculating the activated seed liquid into a tank at a ratio of 1: 15. Fermenting at 30.0 + -0.5 deg.C with initial pH of 5.00 + -0.05, culturing at initial rotation speed of 300rpm, ventilating amount of 0.5vvm, DO (dissolved oxygen value) of 100%, and adding PTM1(CuSO 1)₄·5H₂06.0g，NaI 0.008g，MnSO₄3.0g，NaMo0₄0.2g，H₃BO₃0.02g，ZnSO₄20.0g，CoCl₂0.5g，FeSO₄·7H₂O65.0g，biotin0.2g，H2SO₄5.0mL, deionized water to 1L) of trace salts. The initial proliferation stage is about 24 hours, the dissolved oxygen value is maintained to be not less than 20%, when the carbon source is completely consumed, the dissolved oxygen value rapidly rises, and the wet weight of the thalli reaches about 100 g/L. The initial two hours were supplemented with 50% volume glycerol solution at a rate of 200mL/h per hour (12 mL PTM1 added per liter). After two hours of feeding, 300mL/h was used instead. By adjusting the stirring speed, the air flow rate and the tank pressure (b)<0.8bar) to maintain the dissolved oxygen level above 30%. After the addition of the enzyme for about 4 hours and the wet weight of the cells of about 200g/L, the feeding of the enzyme is stopped and the dissolved oxygen value is increased. While controlling the pH to 6.00. + -. 0.05, the induction was started by adding methanol (12 mL of PTM1 per liter). The initial methanol addition was controlled at 30 mL/h. The amount of methanol added was slowly increased and the feed rate was set to 90mL/h after 4 hours of methanol induction. The dissolved oxygen value is maintained to be higher than 20 percent by volume, the temperature is maintained at 30 ℃, and the pH value is controlled to be 6.00 +/-0.05. And discharging fermentation liquor after the fermentation is finished after 40 hours of induction. The thalli is collected by centrifugation at 4 ℃, and the wet weight of the thalli reaches 400 g/L.

From the working seed bank of the genetically engineered strain expressing HPV11L1 obtained in example 3, 1 strain was taken out of a glycerol cryopreservation tube, and after thawing, 100. mu.L of the strain was inoculated into 5mL of YPD medium and cultured at 280 revolutions per minute (rpm) at 30 ℃ for 20 hours. The density of the thallus reaches OD₆₀₀About 1 to about 2. The microscopic examination is free from the contamination of foreign bacteria. 1mL of the activation solution which was passed through the examination was inoculated into 500mL of YPD medium and cultured at 280rpm at 30 ℃ for 20 hours. The density of the thallus reaches OD600 of about 2-6. The microscopic examination is free from the contamination of foreign bacteria. Basic salt culture medium BSM1 (K) for fermentation₂SO₄273g，MgSO₄109g，CaSO₄·2H₂O17.6g，H₃PO₄400.5mL, KOH62g, glycerol 600g, PTML60mL, 1mL of bubbled 1, deionized water to 15L), no antibiotics, were formulated and sterilized in a 30L fermentor (Bioengineering Co.). Sterilizing at 121 deg.C for 30min, and cooling to 30 deg.C. Inoculating the activated seed liquid into a tank at a ratio of 1: 15. The fermentation temperature is 30.0 + -0.5 deg.C, initial pIII 5.00 + -0.05Culturing at initial rotation speed of 300rpm, ventilating amount of 0.5vvm, DO (dissolved oxygen value) of 100%, adding PTM1 (CuSO)₄·5H₂O6.0g，NaI0.008g，MnSO₄3.0g，NaMoO₄0.2g，HaBO₃0.02g，ZnSO₄20.0g，CoCl₂0.5g，FeSO₄·7H₂O65.0g，biotin0.2g，H₂SO₄5.0mL, deionized water to 1L) of trace salts. In the initial proliferation stage, people maintain the dissolved oxygen value not less than 20% for about 24 hours, and when the carbon source is completely consumed, the dissolved oxygen value rapidly rises, and the wet weight of the thalli reaches about 100 g/L. The initial two hours were supplemented with 50% volume glycerol solution at a rate of 200mL/h per hour (12 mL PTM1 added per liter). After two hours of feeding, 300mL/h was used instead. By adjusting the stirring speed, the air flow rate and the tank pressure (b)<0.8bar) to maintain the dissolved oxygen level above 30%. After the addition of the enzyme for about 4 hours and the wet weight of the cells of about 200g/L, the feeding of the enzyme is stopped and the dissolved oxygen value is increased. While controlling the pH to 6.00. + -. 0.05, the induction was started by adding methanol (12 mL of PTM1 per liter). The initial methanol addition was controlled at 30 mL/h. The amount of methanol added was slowly increased and the feed rate was set to 90mL/h after 4 hours of methanol induction. The dissolved oxygen value is maintained to be higher than 20 percent by volume, the temperature is maintained at 30 ℃, and the pH value is controlled to be 6.00 +/-0.05. And discharging fermentation liquor after the fermentation is finished after 40 hours of induction. The thalli is collected by centrifugation at 4 ℃, and the wet weight of the thalli reaches 400 g/L.

From the working seed bank of the genetically engineered strain expressing HPV16L1 obtained in example 3, 1 strain was taken out of a glycerol cryopreservation tube, and after thawing, 100. mu.L of the strain was inoculated into 5mL of YPD medium and cultured at 280 revolutions per minute (rpm) at 30 ℃ for 20 hours. The density of the thallus reaches OD₆₀₀About 1 to about 2. The microscopic examination is free from the contamination of foreign bacteria. 1mL of the activation solution which was passed through the examination was inoculated into 500mL of YPD medium and cultured at 280rpm at 30 ℃ for 20 hours. The density of the thallus reaches OD₆₀₀About 2 to about 6. The microscopic examination is free from the contamination of foreign bacteria. Basic salt culture medium BSM1 (K) for fermentation₂SO₄273g，MgSO₄109g，CaSO₄·2H₂O17.6g，H₃PO₄400.5mL, KOH62g, glycerol 600g, PTM160mL, 1mL of bubbled 1, deionized water to 15L), no antibiotics, were formulated and sterilized in a 30L fermentor (Bioengineering Co.). The sterilization condition is 12At 1 deg.C for 30 minutes, and cooling to 30 deg.C after digestion. Inoculating the activated seed liquid into a tank at a ratio of 1: 15. Fermenting at 30.0 + -0.5 deg.C with initial pH of 5.00 + -0.05, culturing at initial rotation speed of 300rpm, ventilating amount of 0.5vvm, DO (dissolved oxygen value) of 100%, and adding PTM1(CuSO 1)₄·5H₂O6.0g，Na10.008g，MnSO₄3.0g，NaMoO₄0.2g，H₃BO₃0.02g，ZnSO₄20.0g，CoCl₂0.5g，FeSO₄·7H₂O65.0g，biotin0.2g，H₂SO₄5.0mL, deionized water to 1L) of trace salts. The initial proliferation stage is about 24 hours, the dissolved oxygen value is maintained to be not less than 20%, when the carbon source is completely consumed, the dissolved oxygen value rapidly rises, and the wet weight of the thalli reaches about 100 g/L. The initial two hours were supplemented with a volume white fraction 50% glycerol solution (12 mL PTMI per liter) at a rate of 200mL/h per hour. After two hours of feeding, 300mL/h was used instead. By adjusting the stirring speed, the air flow rate and the tank pressure (b)<0.8bar) to maintain the dissolved oxygen level above 30%. After the addition of the enzyme for about 4 hours and the wet weight of the cells of about 200g/L, the feeding of the enzyme is stopped and the dissolved oxygen value is increased. While controlling the pII value to 6.00 +/-0.05, the induction was started by adding methanol (12 mL of PTM1 per liter). The initial methanol addition was controlled at 30 mL/h. The amount of methanol added was slowly increased and the feed rate was set to 90mL/h after 4 hours of methanol induction. The dissolved oxygen value is maintained to be higher than 20 percent by volume, the temperature is maintained at 30 ℃, and the pH value is controlled to be 6.00 +/-0.05. And discharging fermentation liquor after the fermentation is finished after 40 hours of induction. The thalli is collected by centrifugation at 4 ℃, and the wet weight of the thalli reaches 400 g/L.

From the working seed bank of the genetically engineered strain expressing HPV18L1 obtained in example 3, 1 strain was taken out of a glycerol cryopreservation tube, and after thawing, 100. mu.L of the strain was inoculated into 5mL of YPD medium and cultured at 280 revolutions per minute (rpm) at 30 ℃ for 20 hours. The density of the cells reaches OD600 of about 1-2. The microscopic examination is free from the contamination of foreign bacteria. 1mL of the activation solution which was passed through the examination was inoculated into 500mL of YPD medium and cultured at 280rpm at 30 ℃ for 20 hours. The density of the thallus reaches OD600 of about 2-6. The microscopic examination is free from the contamination of foreign bacteria. Basic salt culture medium BSM1 (K) for fermentation₂SO₄273g，MgsO₄109g，CaSO₄·2H₂O17.6g，H₃PO₄400.5mL, KOH62g, glycerol 600g, PTM160mL, 1mL of natural rubber,deionized water to 15L), no antibiotics, and can be sterilized in a 30L fermentor (Bioengineering) after formulation. Sterilizing at 121 deg.C for 30min, and cooling to 30 deg.C. Inoculating the activated seed liquid into a tank at a ratio of 1: 15. Fermenting at 30.0 + -0.5 deg.C with initial pH of 5.00 + -0.05, culturing at initial rotation speed of 300rpm, ventilating amount of 0.5vvm, DO (dissolved oxygen value) of 100%, and adding PTM1(CuSO 1)₄·5II₂O6.0g，NaIO.008g，MnSO₄3.0g，NaMoO₄0.2g，H₃BO₃0.02g，ZnSO₄20.0g，CoCl₂0.5g，FeSO₄·7H₂065.0g，biotin0.2g，H₂SO₄5.0mL, deionized water to 1L) of trace salts. The initial proliferation stage is about 24 hours, the dissolved oxygen value is maintained to be not less than 20%, when the carbon source is completely consumed, the dissolved oxygen value rapidly rises, and the wet weight of the thalli reaches about 100 g/L. The initial two hours were supplemented with 50% volume glycerol solution at a rate of 200mL/h per hour (12 mL PTM1 added per liter). After two hours of feeding, 300mL/h was used instead. By adjusting the stirring speed, the air flow rate and the tank pressure (b)<0.8bar) to maintain the dissolved oxygen level above 30%. After the addition of the enzyme for about 4 hours and the wet weight of the cells of about 200g/L, the feeding of the enzyme is stopped and the dissolved oxygen value is increased. While controlling the pH to 6.00. + -. 0.05, the induction was started by adding methanol (12 mL of PTM1 per liter). The initial methanol addition was controlled at 30 mL/h. The amount of methanol added was slowly increased and the feed rate was set to 90mL/h after 4 hours of methanol induction. The dissolved oxygen value is maintained to be higher than 20 percent by volume, the temperature is maintained at 30 ℃, and the pH value is controlled to be 6.00 +/-0.05. And discharging fermentation liquor after the fermentation is finished after 40 hours of induction. The thalli is collected by centrifugation at 4 ℃, and the wet weight of the thalli reaches 400 g/L.

From the working seed bank of the genetically engineered strain expressing HPV58L1 obtained in example 3, 1 strain was taken out of a glycerol cryopreservation tube, and after thawing, 100. mu.L of the strain was inoculated into 5mL of YPD medium and cultured at 280 revolutions per minute (rpm) at 30 ℃ for 20 hours. The density of the cells reaches OD600 of about 1-2. The microscopic examination is free from the contamination of foreign bacteria. 1mL of the activation solution which was passed through the examination was inoculated into 500mL of YPD medium and cultured at 280rpm at 30 ℃ for 20 hours. The density of the thallus reaches OD600 of about 2-6. The microscopic examination is free from the contamination of foreign bacteria. Basic salt culture medium BSM1 (K) for fermentation₂SO₄273g，MgSO₄109g，CaSO₄·2H₂O17.6g，H₃PO₄400.5mL, KOH62g, glycerol 600g, PTM160mL, 1mL of bubbled 1, deionized water to 15L), no antibiotics, were formulated and sterilized in a 30L fermentor (Bioengineering Co.). Sterilizing at 121 deg.C for 30min, and cooling to 30 deg.C. Inoculating the activated seed liquid into a tank at a ratio of 1: 15. Fermenting at 30.0 + -0.5 deg.C with initial pH of 5.00 + -0.05, culturing at initial rotation speed of 300rpm, ventilating amount of 0.5vvm and DO (dissolved oxygen value) of 100%, and adding PTM1(CuSO 1)₄·5H₂O6.0g，NaI0.008g，MnSO₄3.0g，NaMoO₄0.2g，H₃BO₃0.02g，ZnSO₄20.0g，CoCl₂0.5g，FeSO₄·7H₂065.0g，biotin0.2g，H₂SO₄5.0mL, deionized water to 1L) of trace salts. The initial proliferation stage is about 24 hours, the dissolved oxygen value is maintained to be not less than 20%, when the carbon source is completely consumed, the dissolved oxygen value rapidly rises, and the wet weight of the thalli reaches about 100 g/L. The initial two hours were supplemented with 50% volume glycerol solution at a rate of 200mL/h per hour (12 mL PTM1 added per liter). After two hours of feeding, 300mL/h was used instead. By adjusting the stirring speed, the air flow rate and the tank pressure (b)<0.8bar) to maintain the dissolved oxygen level above 30%. After the addition of the enzyme for about 4 hours and the wet weight of the cells of about 200g/L, the feeding of the enzyme is stopped and the dissolved oxygen value is increased. While controlling the pH to 6.00. + -. 0.05, the induction was started by adding methanol (12 mL of PTM1 per liter). The initial methanol addition was controlled at 30 mL/h. The amount of methanol added was slowly increased and the feed rate was set to 90mL/h after 4 hours of methanol induction. The dissolved oxygen value is maintained to be higher than 20 percent by volume, the temperature is maintained at 30 ℃, and the pH value is controlled to be 6.00 +/-0.05. And discharging fermentation liquor after the fermentation is finished after 40 hours of induction. The thalli is collected by centrifugation at 4 ℃, and the wet weight of the thalli reaches 400 g/L.

Example 5: HPV L1 protein purification

After the collected HPV6L1 thallus is broken (broken bacterium buffer solution: 200mM MOPS, pH7.0, 0.7NaCl, 0.05% Tween-80), centrifugated, and the supernatant after breaking is purified by a chromatography method to obtain the L1 protein which is self-assembled into virus-like particles, and the specific steps are as follows: pichia pastoris cells expressing HPV6L1 VLPs were grown in 1: 5 adding a bacterium breaking buffer solution, mixing, breaking the cell suspension under high pressure after fully mixing, and repeating the operation to break 90% of cells. Centrifuging the high-pressure crushed bacteria-breaking solution at 9000rpm for 30min at 10 deg.C, and collecting the supernatant after centrifugation. The supernatant clarified by centrifugation was subjected to preliminary purification by passing through a POROS50HS (Applied Biosystems column) in a linear gradient of 100% buffer A (0.5M NaCl, 50mM MOPS, pH7.0, 0.05% Tween-80) to 100% buffer B (1.5M NaCl, 50mM MOPS, pH7.0, 0.05% Tween-80), and the fractions eluted were collected and detected by SDS-PAGE and Western-blot.

The fractions eluted containing HPV6L1 protein were pooled and further purified using a CHT (BIO-RAD type II) column, eluting in the following manner: a linear gradient from 100% buffer A (5nM PB, 0.6M NaCl, 50mM MOPS, pH6.5, 0.05% Tween-80) to 100% buffer B (200mM PB, 0.6M NaCl, pH6.5, 0.05% Tween-80). And collecting the eluted components, detecting by SDS-PAGE and Western-blot, and combining the components containing the HPV6L1VLP to obtain the final purified sample. The purity of L1 protein was checked by SDS-PAGE electrophoresis, and the purity of the purified virus-like particles was more than 90% as shown by scanning (FIG. 11). The purified sample was observed by electron microscopy (electron microscopy chamber of chemical series at the university of Compound denier) for the presence of virus-like particles (FIG. 16), which showed particle diameters between 50 and 100 nm.

After the collected HPV11L1 thallus is broken (broken bacterium buffer solution: 200mM MOPS, pH7.0, 0.7NaCl, 0.05% Tween-80), centrifugating, taking supernatant after breaking the thallus and purifying by a chromatography method to obtain the L1 protein self-assembled into virus-like particles, which comprises the following specific steps: adding a bacterium breaking buffer solution into the pichia pastoris cells expressing the HPV11L1VLP according to the ratio of 1: 5, mixing the mixture fully, breaking the cell suspension at high pressure after mixing the mixture uniformly, and repeating the operation to break 90 percent of the cells. Centrifuging the high-pressure crushed bacteria-breaking solution at 9000rpm for 30min at 10 deg.C, and collecting the supernatant after centrifugation. The supernatant clarified by centrifugation was subjected to preliminary purification by passing through a POROS50IIS (Applied Biosystems chromatography column) in a linear gradient of 100% buffer A (0.5M NaCl, 50mM MOPS, pH7.0, 0.05% Tween-80) to 100% buffer B (1.5M NaCl, 50mM OPS, pH7.0, 0.05% Tween-80), and the fractions eluted were collected and detected by SDS-PAGE and Western-blot.

The fractions eluted containing HPV11L1 protein were pooled and further purified using a CHT (BIO-PAD type II) column, eluting in the following manner: a linear gradient from 100% buffer A (5mM PB, 0.6M NaCl, 50mM MOPS, pH6.5, 0.05% Tween-80) to 100% buffer B (200mM PB, 0.6M NaCl, pH6.5, 0.05% Tween-80). And collecting the eluted components, detecting by SDS-PAGE and Western-blot, and combining the components containing the HPV11L1VLP to obtain the final purified sample. The purity of L1 protein was checked by SDS-PAGE electrophoresis, and the purity of the purified virus-like particles was more than 90% as shown by scanning (FIG. 11). The purified sample was observed by electron microscopy (university of east china electron microscopy laboratory) to show virus rod particles (fig. 17), which showed particle diameters between 50 and 100 nm.

After the collected HPV16L1 thallus is broken (broken bacterium buffer solution: 200mM MOPS, pH7.0, 0.7NaCl, 0.05% Tween-80), centrifugating, taking supernatant after breaking the thallus and purifying by a chromatography method to obtain the L1 protein self-assembled into virus-like particles, which comprises the following specific steps: adding a bacterium breaking buffer solution into the Pichia pastoris cells expressing IIPV16L1VLP according to the ratio of 1: 5, mixing the mixture fully, breaking the cell suspension at high pressure after mixing the mixture uniformly, and repeating the operation to break 90% of the cells. Centrifuging the high-pressure crushed bacteria-breaking solution at 9000rpm for 30min at 10 deg.C, and collecting the supernatant after centrifugation. The supernatant clarified by centrifugation was subjected to preliminary purification by passing through a column of POROS50HS (Applied Biosystems) in a linear gradient of 100% buffer A (0.5M NaGl, 50mM MOPS, pH7.0, 0.05% Tween-80) to 100% buffer B (1.5M NaCl, 50mM OPS, pH7.0, 0.05% Tween-80), and the fractions eluted were collected and detected by SDS-PAGE or Western-blot.

The fractions eluted containing HPV16L1 protein were pooled and further purified using a CHT (BTO-RAD type II) column, eluting in the following manner: a linear gradient from 100% buffer A (5mM PB, 0.6M NaCl, 50mM MOPS, pH6.5, 0.05% Tween-80) to 100% buffer B (200mM PB, 0.6M NaCl, pH6.5, 0.05% Tween-80). And collecting the eluted components, detecting by SDS-PAGE and Western-blot, and combining the components containing the HPV16L1VLP to obtain the final purified sample. The purity of L1 protein was checked by SDS-PAGE electrophoresis, and the purity of the purified virus-like particles was more than 90% as shown by scanning (FIG. 13). The purified sample was observed by electron microscopy (university of east china electron microscopy laboratory) to show virus-like particles (fig. 18), which showed particle diameters between 50 and 100 nm.

After the collected HPV18L1 thallus is broken (broken bacterium buffer solution: 200mM MOPS, pH7.0, 0.7NaCl, 0.05% Tween-80), centrifugated, and the supernatant after breaking is purified by a chromatography method to obtain the L1 protein which is self-assembled into virus-like particles, and the specific steps are as follows: adding a bacterium breaking buffer solution into pichia pastoris cells expressing HPV18L1VLP according to the ratio of 1: 5, mixing the pichia pastoris cells, breaking the cell suspension under high pressure after fully mixing the mixture, and repeating the operation to break 90 percent of the cells. Centrifuging the high-pressure crushed bacteria-breaking solution at 9000rpm for 30min at 10 deg.C, and collecting the supernatant after centrifugation. The supernatant clarified by centrifugation was subjected to preliminary purification by passing through a chromatographic column of POROS50HS (Applied Biosystems) in a linear gradient of 100% buffer A (0.5M NaCl, 50mM MOPS, pH7.0, 0.05% Tween-80) to 100% buffer B (1.5M NaCl, 50mM OPS, pH7.0, 0.05% Tween-80), and the fractions eluted were collected and detected by SDS-PAGE or Western-blot.

The fractions eluted containing HPVl8L1 protein were pooled and further purified using a CHT (BIO-RAD type II) column, eluting by: a linear gradient from 100% buffer A (5rmM PB, 0.6M NaCl, 50mM MOPS, pH6.5, 0.05% Tween-80) to 100% buffer B (200mM PB, 0.6M NaCl, pH6.5, 0.05% Tween-80). And collecting the eluted components, detecting by SDS-PAGE and Western-blot, and combining the components containing the IIPV18L1VLP to obtain the final purified sample. The purity of L1 protein was checked by SDS-PAGE electrophoresis, and the purity of the purified virus-like particles was more than 90% as shown by scanning (FIG. 14). The purified sample was observed by electron microscopy (university of east china electron microscopy laboratory) to show virus-like particles (fig. 19), which showed particle diameters between 50 and 100 nm.

After the collected HPV58L1 thallus is broken (broken bacterium buffer solution: 200mM MOPS, pH7.0, 0.7NaCl, 0.05% Tween-80), centrifugated, and the supernatant after breaking is purified by a chromatography method to obtain the L1 protein which is self-assembled into virus-like particles, and the specific steps are as follows: adding a bacterium breaking buffer solution into the pichia pastoris cells expressing the HPV58L1VLP according to the ratio of 1: 5, mixing the mixture fully, breaking the cell suspension at high pressure after mixing the mixture uniformly, and repeating the operation to break 90 percent of the cells. Centrifuging the high-pressure crushed bacteria-breaking solution at 9000rpm for 30min at 10 deg.C, and collecting the supernatant after centrifugation. The supernatant clarified by centrifugation was subjected to preliminary purification by passing through a chromatographic column of POROS50HS (Applied Biosystems) in a linear gradient of 100% buffer A (0.5M NaCl, 50mM MOPS, pH7.0, 0.05% Tween-80) to 100% buffer B (1.5M NaCl, 50mM OPS, pH7.0, 0.05% Tween-80), and the fractions eluted were collected and detected by SDS-PAGE or Western-blot.

Fractions eluted containing IIPV58L1 protein were pooled and further purified using CIIT (B1O-RAD type II) column, by: a linear gradient from 100% buffer A (5mM PB, 0.6M NaCl, 50mM MOPS, pH6.5, 0.05% Tween-80) to 100% buffer B (200mM PB, 0.6M NaCl, pH6.5, 0.05% Tween-80). And collecting the eluted components, detecting by SDS-PAGE and Western-blot, and combining the components containing the HPV58L1VLP to obtain the final purified sample. The purity of L1 protein was checked by SDS-PAGE electrophoresis, and the purity of the purified virus-like particles was more than 90% as shown by scanning (FIG. 15). The virus-like particles were observed in the purified samples by electron microscopy (center for analysis and detection of Wuhan institute of Virus, Chinese academy of sciences) (FIG. 20), and the results showed that the particle diameter was between 50-100 nm.

Example 6: measurement of expression amount of HPVL1 recombinant protein of the present invention

In this example, the total protein content of the HPVL1VLP after disruption was calculated based on the total protein content of the supernatant of disrupted cells after fermentation measured by the Bradford method and the expression level of the HPVL1VLP measured by the Elisa sandwich method. The method comprises the following specific steps:

1. determination of Total protein content in fermentation broth lysate supernatant Using Bradford method

The measurement was carried out using K4000Bradford protein qualification reagent kit commercially available from Shanghai Bombycis Biotech Ltd.

Mu.l, 10. mu.l, 20. mu.l, 40. mu.l, 80. mu.l, 100. mu.l of BSA standard (0.5mg/ml) and 40. mu.l (100-fold dilution) of the disrupted supernatant of the fermented cells obtained in example 4 were added to 7 tubes of 1.5ml EP in one portion, and the mixture was made up to a total volume of 100. mu.l with water and mixed. 3 replicates were set for each concentration. 900 μ l of Bradford solution was added to each tube, mixed immediately, and then left at room temperature for 10 minutes, and then OD595 light absorption was measured. And calculating a protein concentration to absorbance value standard curve according to 6 groups of BSA standard samples to obtain a linear equation, and calculating the total protein content of the fermented thallus broken bacteria supernatant according to the absorbance value obtained by breaking the bacteria supernatant and the standard curve linear equation.

2. Determination of content of HPVL1VLP in supernatant of fermented thallus broken bacteria by Elisa sandwich method

Purified HPVL1VLP was used as a standard protein concentration curve, and the pre-induced bacteria were used as a negative control.

The rabbit anti-HPVL 1VLP polyclonal antibody was diluted 2000-fold with coating solution (1.6g Na2CO3, 2.95g NaHCO3), and then 0.1ml of the diluted rabbit polyclonal antibody was added to each well of the plate and left overnight at 4 ℃. The coating solution was removed, the wells were washed with 0.3ml of PBST (PBS, pH7.0, 0.05% Tween-20), and incubated with 0.3ml of blocking solution (5% nonfat dry milk + PBST) at 37 ℃ for 2 hours.

The purified HPVL1VLP obtained in example 5 was diluted from a gradient of concentration 2. mu.g/ml to 0.0625. mu.g/ml with a dilution (PBS, pI7.0) in two successive dilutions as a standard sample. Meanwhile, the bacterial-breaking supernatant of the fermentation thallus obtained in example 4 was diluted 200 times, then 0.1ml of HPVL1VLP solutions of different concentrations after gradient dilution or diluted bacterial-breaking supernatant was added to the wells, respectively, and after 1 hour of incubation at 37 ℃, the antigen solution was removed and the wells were washed with 0.3ml of pbst. MAB885 murine anti-HPV 52L1VLP monoclonal antibody (purchased from CHEMICON) was diluted 1000-fold with antibody dilution buffer (PBS, pH7.0, 2% skim milk powder) and added to wells at 0.1ml per well and incubated at 37 ℃ for 1 hour. The mab solution was removed and the wells were washed with 0.3ml PBST. Then, HRP-labeled goat anti-mouse IgGO.1ml diluted by 5000 times by using an antibody dilution buffer is added into each concave hole, and the temperature is kept at 37 ℃ for 0.5 hour. Moving deviceThe antibody solution was removed, the wells were washed with 0.3ml of PBST, and 0.1ml of DAB developing solution (available from Amresco) was added to each well and allowed to stand at room temperature for 20 minutes. 0.05m12M H was added to each well₂SO₄Stopping the reaction with a stop solution, and determining OD with an enzyme-labeled colorimeter₄₅₀And (4) light absorption value.

OD of HPVLIVLP Using gradient dilution₄₅₀The fermentation expression level of HPVL1 protein was obtained by preparing a standard protein concentration curve and converting the standard protein concentration curve.

The results of this example are shown in tables 2-6.

As can be seen from Table 2, the expression level of HPV6L1 gene of the invention can reach up to 134.1. mu.g/mg (HPV 6L1VLP in the supernatant of the broken bacteria/total protein in the supernatant of the broken bacteria).

Table 2: expression level of HPV6L1 Gene of the invention

As can be seen from Table 3, the expression level of HPV11L1 gene of the present invention can reach up to 123.8. mu.g/mg (HPV 11L1VLP in the supernatant of the disrupted strain/total protein in the supernatant of the disrupted strain).

Table 3: expression level of HPV11L1 Gene of the invention

As can be seen from Table 4, the expression level of the HPVI6L1 gene of the invention can reach 135.8 μ g/mg (HPV 16L1VLP in the strain-breaking supernatant/total protein in the strain-breaking supernatant).

Table 4: expression level of IIPV16L1 Gene of the present invention

As can be seen from Table 5, the expression level of HPV18L1 gene of the present invention can reach up to 125.4. mu.g/mg (HPV 18L1VLP in the supernatant of the disrupted strain/total protein in the supernatant of the disrupted strain).

Table 5: expression level of HPV18L1 Gene of the invention

As can be seen from Table 6, the expression level of the HPV58L1 gene of the invention can reach up to 132.1. mu.g/mg (HPV 58L1VLP in the broken bacteria supernatant/total protein in the broken bacteria supernatant).

Table 6: expression level of HPV58L1 Gene of the invention

Example 7: preparation of HPV L1 vaccine

The HPV l1 protein purified and obtained in example 5 was adsorbed with an aluminum phosphate adjuvant by a method described in pharmacopoeia of the people's republic of china (2005 edition), to prepare an HPV vaccine having immunogenicity.

Example 8: determination of immunogenicity of HPV L1 Gene expression product

Determination of immunogenicity of HPV6L1 Gene expression product

SPF-grade BALB/c mice (Shanghai Seipaibikai laboratory animals Co., Ltd.) 6-8 weeks old were selected and divided into 4 groups of 8 mice each. Groups 1-3 were injected with 0.5mL VLP adsorbed with aluminum adjuvant (as test group), and groups 4 mice were immunized (as negative control group) with 0.1mL buffer containing aluminum adjuvant (0.32M NaCl, 0.01% Tween-80, 0.01M histidine, pH6.5) once by abdominal subcutaneous five-point injection for 0 day, and blood was collected 28 days after immunization. Standing the collected blood at 37 deg.C for 2h, centrifuging at 8000rpm for 5min, sucking supernatant to obtain mouse immune serum, storing at-20 deg.C, and detecting the positive conversion rate of mouse serum, the specific method comprises: purified Pichia pastoris-expressed HPV6L1 was diluted to 1. mu.g/mL with coating solution, coated on 96-well microtiter plates, 0.1mL per well, overnight at 4 ℃. The coating solution was removed and washed 3 times with 0.3mL of BST, followed by 3 washes with 0.3mL of blocking solution (5% nonfat dry milk + PBST) incubated at 37 ℃ for 2 hours. Dilution buffer for Per well additionThe solution (2% skimmed milk powder + PBST) diluted the serum to be tested at 1: 1000, 100. mu.l/well, double wells added to the ELISA plate, incubated at 37 ℃ for 1 hour. Washing 6 times, diluting HRP-labeled goat anti-mouse IgG with diluent 1: 5000, adding 100 μ l/well enzyme label plate, incubating at 37 deg.C for 0.5 hr, washing 6 times, adding 100 μ l/well TMB for color development, developing at 37 deg.C for 10 min, adding 2M H₂SO₄The reaction was stopped with 50. mu.l. OD determination with enzyme-labeled colorimeter₄₅₀Reading, OD₄₅₀The values are shown in Table 7. The results of the positive conversion rate of the three test groups are shown in Table 8.

TABLE 7 detection of the positive conversion rate of sera obtained from mice immunized with HPV6L1 (OD)₄₅₀Reading number)

Grouping of different doses	1 μ g group	0.1 μ g group	0.01 μ g group
				Rate of yang transformation	100％	100％	12.5％

TABLE 8HPV6L1 positive conversion results

Negative average value: 0.007; cutoff value: 0.014

Note: the Cutoff value is the OD of the detected serum antibody of the adjuvant group₄₅₀Average of the values multiplied by 2.1, OD₄₅₀Value greater than Cutoff valueIs determined to be positive and OD₄₅₀Mouse sera with values less than the Cutoff value were judged negative.

Determination of immunogenicity of HPV11L1 Gene expression product

SPF-grade BALB/c mice (Shanghai Seipaibikai laboratory animals Co., Ltd.) 6-8 weeks old were selected and divided into 4 groups of 8 mice each. Groups 1-3 were injected with 0.5mL VLP adsorbed with aluminum adjuvant (as test group), and groups 4 mice were immunized (as negative control group) with 0.1mL buffer containing aluminum adjuvant (0.32M NaCl, 0.01% Tween-80, 0.01M histidine, pH6.5) once by abdominal subcutaneous five-point injection for 0 day, and blood was collected 28 days after immunization. Standing the collected blood at 37 deg.C for 2h, centrifuging at 8000rpm for 5min, sucking supernatant to obtain mouse immune serum, storing at-20 deg.C, and detecting the positive conversion rate of mouse serum, the specific method comprises: purified Pichia pastoris-expressed HPV11L1 was diluted to 1. mu.g/mL with coating solution, coated on 96-well microtiter plates, 0.1mL per well, overnight at 4 ℃. The coating solution was removed and washed 3 times with 0.3mL of BST, followed by 3 washes with 0.3mL of blocking solution (5% nonfat dry milk + PBST) incubated at 37 ℃ for 2 hours. Each well was diluted with a dilution buffer (2% nonfat dry milk + PBST) at 1: 1000 (100. mu.l/well), and the wells were plated with an ELISA plate and incubated at 37 ℃ for 1 hour. Washing 6 times, diluting HRP-labeled goat anti-mouse IgG with diluent 1: 5000, adding 100 μ l/well enzyme label plate, incubating at 37 deg.C for 0.5 hr, washing 6 times, adding 100 μ l/well TMB for color development, developing at 37 deg.C for 10 min, adding 2M H₂SO₄The reaction was stopped with 50. mu.l. OD determination with enzyme-labeled colorimeter₄₅₀Reading, OD₄₅₀The values are shown in Table 9. The results of the positive conversion rate of the three test groups are shown in Table 10.

TABLE 9 detection of the positive conversion rate of sera obtained from mice immunized with HPV11L1 (OD)₄₅₀Reading number)

Grouping of different doses	1 μ g group	0.1 μ g group	0.01 μ g group
				Rate of yang transformation	100％	100％	25.0％

TABLE 10HPV11L1 positive conversion results

Negative average value: 0.007; cutoff value: 0.014

Note: the Cutoff value is the OD of the detected serum antibody of the adjuvant group₄₅₀Average of the values multiplied by 2.1, OD₄₅₀The mouse serum with the value larger than the Cutoff value is judged to be positive, OD₄₅₀Mouse sera with values less than the Cutoff value were judged negative.

Determination of immunogenicity of HPV16L1 Gene expression product

SPF-grade BALB/c mice (Shanghai Seipaibikai laboratory animals Co., Ltd.) 6-8 weeks old were selected and divided into 4 groups of 8 mice each. Groups 1-3 were injected with 0.5mL VLP adsorbed with aluminum adjuvant (as test group), and groups 4 mice were immunized (as negative control group) with 0.1mL buffer containing aluminum adjuvant (0.32M NaCl, 0.01% Tween-80, 0.01M histidine, pH6.5) once by abdominal subcutaneous five-point injection for 0 day, and blood was collected 28 days after immunization. Standing the collected blood at 37 deg.C for 2h, centrifuging at 8000rpm for 5min, sucking supernatant to obtain mouse immune serum, storing at-20 deg.C, and detecting the positive conversion rate of mouse serum, the specific method comprises: diluting purified Pichia pastoris expressed HPV16L1 to 1 microgram/mL with coating solution, coating 96-hole enzyme labelPlates were added 0.1mL per well overnight at 4 ℃. The coating solution was removed and washed 3 times with 0.3mL of BST, followed by 3 washes with 0.3mL of blocking solution (5% nonfat dry milk + PBST) incubated at 37 ℃ for 2 hours. Each well was diluted with a dilution buffer (2% nonfat dry milk + PBST) at 1: 1000 (100. mu.l/well), and the wells were plated with an ELISA plate and incubated at 37 ℃ for 1 hour. Washing 6 times, diluting HRP-labeled goat anti-mouse IgG with diluent 1: 5000, adding 100 μ l/well enzyme label plate, incubating at 37 deg.C for 0.5 hr, washing 6 times, adding 100 μ l/well TMB for color development, developing at 37 deg.C for 10 min, adding 2M H₂SO₄The reaction was stopped with 50. mu.l. OD determination with enzyme-labeled colorimeter₄₅₀Reading, OD₄₅₀The values are shown in Table 11. The results of the positive conversion rate of the three test groups are shown in Table 12.

TABLE 11 measurement of the positive conversion rate of serum obtained from HPV16L1 immunized mice (OD)₄₅₀Reading number)

TABLE 12HPV16L1 positive conversion results

Negative average value: 0.007; cutoff value: 0.014

Determination of immunogenicity of HPV18L1 Gene expression product

SPF-grade BALB/c mice (Shanghai Seipaibikai laboratory animals Co., Ltd.) 6-8 weeks old were selected and divided into 4 groups of 8 mice each. Groups 1-3 were injected with 0.5mL VLP adsorbed with aluminum adjuvant (as test group), and groups 4 mice were immunized (as negative control group) with 0.1mL buffer containing aluminum adjuvant (0.32M NaCl, 0.01% Tween-80, 0.01M histidine, pH6.5) once by abdominal subcutaneous five-point injection for 0 day, and blood was collected 28 days after immunization. Standing the collected blood at 37 deg.C for 2h, centrifuging at 8000rpm for 5min, sucking supernatant to obtain mouse immune serum, storing at-20 deg.C, and detecting the positive conversion rate of mouse serum, the specific method comprises: purified Pichia pastoris-expressed HPV18LI was diluted to 1. mu.g/mL with coating solution, coated on 96-well microtiter plates, 0.1mL per well, overnight at 4 ℃. The coating solution was removed and washed 3 times with 0.3mL of BST, followed by 3 washes with 0.3mL of blocking solution (5% nonfat dry milk + PBST) incubated at 37 ℃ for 2 hours. Each well was diluted with a dilution buffer (2% nonfat dry milk + PBST) at 1: 1000 (100. mu.l/well), and the wells were plated with an ELISA plate and incubated at 37 ℃ for 1 hour. Washing for 6 times, releasing HRP-labeled goat anti-mouse IgG with cotton release solution 1: 5000 cotton, adding 100 μ l/well enzyme label plate, incubating at 37 deg.C for 0.5 hr, washing for 6 times, adding 100 μ l/well TMB, developing at 37 deg.C for 10 min, adding 2M H₂SO₄The reaction was stopped with 50. mu.l. OD determination with enzyme-labeled colorimeter₄₅₀Reading, OD₄₅₀The values are shown in Table 13. The results of the positive conversion rate of the three test groups are shown in Table 14.

TABLE 13 measurement of the Positive Rate of serum transfer (OD) from HPV18L1 immunized mice₄₅₀Reading number)

Grouping of different doses	1 μ g group	I μ g group	0.01 μ g group
				Rate of yang transformation	100％	100％	12.5％

TABLE 14HPV18L1 positive conversion results

Negative average value: 0.007; cutoff value: 0.014

Determination of immunogenicity of HPV58L1 Gene expression product

SPF-grade BALB/c mice (Shanghai Seipaibikai laboratory animals Co., Ltd.) 6-8 weeks old were selected and divided into 4 groups of 8 mice each. Groups 1-3 were injected with 0.5mL VLP adsorbed with aluminum adjuvant (as test group), and groups 4 mice were immunized (as negative control group) with 0.1mL buffer containing aluminum adjuvant (0.32M NaCl, 0.01% Tween-80, 0.01M histidine, pH6.5) once by abdominal subcutaneous five-point injection for 0 day, and blood was collected 28 days after immunization. Collecting the obtained blood at 37 deg.CStanding for 2h, centrifuging at 8000rpm for 5min, sucking supernatant to obtain mouse immune serum, storing at-20 deg.C, and detecting the positive conversion rate of mouse serum, the specific method comprises: purified Pichia pastoris-expressed HPV58L1 was diluted to 1. mu.g/mL with coating solution and coated on 96-well microtiter plates at 0.1mL per well overnight at 4 ℃. The coating solution was removed and washed 3 times with 0.3mL of BST, followed by 3 washes with 0.3mL of blocking solution (5% nonfat dry milk + PBST) incubated at 37 ℃ for 2 hours. Each well was diluted with a dilution buffer (2% nonfat dry milk + PBST) at 1: 1000 (100. mu.l/well), and the wells were plated with an ELISA plate and incubated at 37 ℃ for 1 hour. Washing 6 times, diluting HRP-labeled goat anti-mouse IgG with diluent 1: 5000, adding 100 μ l/well enzyme label plate, incubating at 37 deg.C for 0.5 hr, washing 6 times, adding 100 μ l/well TMB for color development, developing at 37 deg.C for 10 min, adding 2M H₂SO₄The reaction was stopped with 50. mu.l. OD determination with enzyme-labeled colorimeter₄₅₀Reading, OD₄₅₀The values are shown in Table 15. The results of the positive conversion rate of the three test groups are shown in Table 16.

TABLE 15 measurement of the positive conversion rate of serum obtained from HPV58L1 immunized mice (OD)₄₅₀Reading number)

TABLE 16HPV58L1 positive conversion results

Negative average value: 0.006; cutoff value: 0.012

In summary, the major capsid protein L1 gene of human papilloma virus provided by the present invention is an optimized L1 gene, and has the following advantages: the optimized gene is suitable for expressing target protein in a yeast host with high efficiency and can meet the requirement of industrial production; meanwhile, the human papilloma virus vaccine provided by the invention can be self-assembled to form a VLPs structure, and the vaccine can generate stronger immunogenicity in a mouse body by measuring the positive transfer rate of serum after the purified VLPs adsorb an adjuvant, and the method has the following advantages because a pichia pastoris expression system is adopted: low cost, high yield and more uniform and stable product properties.

<110> Shanghai ze Biotech Co., Ltd

<120> recombinant human papillomavirus protein expression

<160>20

<210>1

<211>500

<212>PRT

<213>Human papillomavirus type 6

<300>

<308>Genebank/CBY85547.1

<309>2011-10-06

<313>(1)..(500)

<400>1

Met Trp Arg Pro Ser Asp Ser Thr Val Tyr Val Pro Pro Pro Asn Pro

1 5 10 15

Val Ser Lys Val Val Ala Thr Asp Ala Tyr Val Thr Arg Thr Asn Ile

20 25 30

Phe Tyr His Ala Ser Ser Ser Arg Leu Leu Ala Val Gly His Pro Tyr

35 40 45

Phe Ser Ile Lys Arg Ala Asn Lys Thr Val Val Pro Lys Val Ser Gly

50 55 60

Tyr Gln Tyr Arg Val Phe Lys Val Val Leu Pro Asp Pro Asn Lys Phe

65 70 75 80

Ala Leu Pro Asp Ser Ser Leu Phe Asp Pro Thr Thr Gln Arg Leu Val

85 90 95

Trp Ala Cys Thr Gly Leu Glu Val Gly Arg Gly Gln Pro Leu Gly Val

100 105 110

Gly Val Ser Gly His Pro Phe Leu Asn Lys Tyr Asp Asp Val Glu Asn

115 120 125

Ser Gly Ser Gly Gly Asn Pro Gly Gln Asp Asn Arg Val Asn Val Gly

130 135 140

Met Asp Tyr Lys Gln Thr Gln Leu Cys Met Val Gly Cys Ala Pro Pro

145 150 155 160

Leu Gly Glu His Trp Gly Lys Gly Lys Gln Cys Thr Asn Thr Pro Val

165 170 175

Gln Ala Gly Asp Cys Pro Pro Leu Glu Leu Ile Thr Ser Val Ile Gln

180 185 190

Asp Gly Asp Met Val Asp Thr Gly Phe Gly Ala Met Asn Phe Ala Asp

195 200 205

Leu Gln Thr Asn Lys Ser Asp Val Pro Ile Asp Ile Cys Gly Thr Thr

210 215 220

Cys Lys Tyr Pro Asp Tyr Leu Gln Met Ala Ala Asp Pro Tyr Gly Asp

225 230 235 240

Arg Leu Phe Phe Phe Leu Arg Lys Glu Gln Met Phe Ala Arg His Phe

245 250 255

Phe Asn Arg Ala Gly Glu Val Gly Glu Pro Val Pro Asp Thr Leu Ile

260 265 270

Ile Lys Gly Ser Gly Asn Arg Thr Ser Val Gly Ser Ser Ile Tyr Val

275 280 285

Asn Thr Pro Ser Gly Ser Leu Val Ser Ser Glu Ala Gln Leu Phe Asn

290 295 300

Lys Pro Tyr Trp Leu Gln Lys Ala Gln Gly His Asn Asn Gly Ile Cys

305 310 315 320

Trp Gly Asn Gln Leu Phe Val Thr Val Val Asp Thr Thr Arg Ser Thr

325 330 335

Asn Met Thr Leu Cys Ala Ser Val Thr Thr Ser Ser Thr Tyr Thr Asn

340 345 350

Ser Asp Tyr Lys Glu Tyr Met Arg His Val Glu Glu Tyr Asp Leu Gln

355 360 365

Phe Ile Phe Gln Leu Cys Ser Ile Thr Leu Ser Ala Glu Val Met Ala

370 375 380

Tyr Ile His Thr Met Asn Pro Ser Val Leu Glu Asp Trp Asn Phe Gly

385 390 395 400

Leu Ser Pro Pro Pro Asn Gly Thr Leu Glu Asp Thr Tyr Arg Tyr Val

405 410 415

Gln Ser Gln Ala Ile Thr Cys Gln Lys Pro Thr Pro Glu Lys Glu Lys

420 425 430

Pro Asp Pro Tyr Lys Asn Leu Ser Phe Trp Glu Val Asn Leu Lys Glu

435 440 445

Lys Phe Ser Ser Glu Leu Asp Gln Tyr Pro Leu Gly Arg Lys Phe Leu

450 455 460

Leu Gln Ser Gly Tyr Arg Gly Arg Ser Ser Ile Arg Thr Gly Val Lys

465 470 475 480

Arg Pro Ala Val Ser Lys Ala Ser Ala Ala Pro Lys Arg Lys Arg Ala

485 490 495

Lys Thr Lys Arg

500

<210>2

<211>501

<212>PRT

<213>Human papillomavirus type 11

<300>

<308>Genebank/CCE60515.1

<309>2013-06-18

<313>(1)..(501)

<400>2

Met Trp Arg Pro Ser Asp Ser Thr Val Tyr Val Pro Pro Pro Asn Pro

1 5 10 15

Val Ser Lys Val Val Ala Thr Asp Ala Tyr Val Lys Arg Thr Asn Ile

20 25 30

Phe Tyr His Ala Ser Ser Ser Arg Leu Leu Ala Val Gly His Pro Tyr

35 40 45

Tyr Ser Ile Lys Lys Val Asn Lys Thr Val Val Pro Lys Val Ser Gly

50 55 60

Tyr Gln Tyr Arg Val Phe Lys Val Val Leu Pro Asp Pro Asn Lys Phe

65 70 75 80

Ala Leu Pro Asp Ser Ser Leu Phe Asp Pro Thr Thr Gln Arg Leu Val

85 90 95

Trp Ala Cys Thr Gly Leu Glu Val Gly Arg Gly Gln Pro Leu Gly Val

100 105 110

Gly Val Ser Gly His Pro Leu Leu Asn Lys Tyr Asp Asp Val Glu Asn

115 120 125

Ser Gly Gly Tyr Gly Gly Asn Pro Gly Gln Asp Asn Arg Val Asn Val

130 135 140

Gly Met Asp Tyr Lys Gln Thr Gln Leu Cys Met Val Gly Cys Ala Pro

145 150 155 160

Pro Leu Gly Glu His Trp Gly Lys Gly Thr Gln Cys Ser Asn Thr Ser

165 170 175

Val Gln Asn Gly Asp Cys Pro Pro Leu Glu Leu Ile Thr Ser Val Ile

180 185 190

Gln Asp Gly Asp Met Val Asp Thr Gly Phe Gly Ala Met Asn Phe Ala

195 200 205

Asp Leu Gln Thr Asn Lys Ser Asp Val Pro Leu Asp Ile Cys Gly Thr

210 215 220

Val Cys Lys Tyr Pro Asp Tyr Leu Gln Met Ala Ala Asp Pro Tyr Gly

225 230 235 240

Asp Arg Leu Phe Phe Tyr Leu Arg Lys Glu Gln Met Phe Ala Arg His

245 250 255

Phe Phe Asn Arg Ala Gly Thr Val Gly Glu Pro Val Pro Asp Asp Leu

260 265 270

Leu Val Lys Gly Gly Asn Asn Arg Ser Ser Val Ala Ser Ser Ile Tyr

275 280 285

Val His Thr Pro Ser Gly Ser Leu Val Ser Ser Glu Ala Gln Leu Phe

290 295 300

Asn Lys Pro Tyr Trp Leu Gln Lys Ala Gln Gly His Asn Asn Gly Ile

305 310 315 320

Cys Trp Gly Asn His Leu Phe Val Thr Val Val Asp Thr Thr Arg Ser

325 330 335

Thr Asn Met Thr Leu Cys Ala Ser Val Ser Lys Ser Ala Thr Tyr Thr

340 345 350

Asn Ser Asp Tyr Lys Glu Tyr Met Arg His Val Glu Glu Phe Asp Leu

355 360 365

Gln Phe Ile Phe Gln Leu Cys Ser Ile Thr Leu Ser Ala Glu Val Met

370 375 380

Ala Tyr Ile His Thr Met Asn Pro Ser Val Leu Glu Asp Trp Asn Phe

385 390 395 400

Gly Leu Ser Pro Pro Pro Asn Gly Thr Leu Glu Asp Thr Tyr Arg Tyr

405 410 415

Val Gln Ser Gln Ala Ile Thr Cys Gln Lys Pro Thr Pro Glu Lys Glu

420 425 430

Lys Gln Asp Pro Tyr Lys Asp Met Ser Phe Trp Glu Val Asn Leu Lys

435 440 445

Glu Lys Phe Ser Ser Glu Leu Asp Gln Phe Pro Leu Gly Arg Lys Phe

450 455 460

Leu Leu Gln Ser Gly Tyr Arg Gly Arg Thr Ser Ala Arg Thr Gly Ile

465 470 475 480

Lys Arg Pro Ala Val Ser Lys Pro Ser Thr Ala Pro Lys Arg Lys Arg

485 490 495

Thr Lys Thr Lys Lys

500

<210>3

<211>505

<212>PRT

<213>Human papillomavirus type 16

<300>

<308>Genebank/AAC09292.1

<309>1998-04-12

<313>(1)..(505)

<400>3

Met Ser Leu Trp Leu Pro Ser Glu Ala Thr Val Tyr Leu Pro Pro Val

1 5 10 15

Pro Val Ser Lys Val Val Ser Thr Asp Glu Tyr Val Ala Arg Thr Asn

20 25 30

Ile Tyr Tyr His Ala Gly Thr Ser Arg Leu Leu Ala Val Gly His Pro

35 40 45

Tyr Phe Pro Ile Lys Lys Pro Asn Asn Asn Lys Ile Leu Val Pro Lys

50 55 60

Val Ser Gly Leu Gln Tyr Arg Val Phe Arg Ile His Leu Pro Asp Pro

65 70 75 80

Asn Lys Phe Gly Phe Pro Asp Thr Ser Phe Tyr Asn Pro Asp Thr Gln

85 90 95

Arg Leu Val Trp Ala Cys Val Gly Val Glu Val Gly Arg Gly Gln Pro

100 105 110

Leu Gly Val Gly Ile Ser Gly His Pro Leu Leu Asn Lys Leu Asp Asp

115 120 125

Thr Glu Asn Ala Ser Ala Tyr Ala Ala Asn Ala Gly Val Asp Asn Arg

130 135 140

Glu Cys Ile Ser Met Asp Tyr Lys Gln Thr Gln Leu Cys Leu Ile Gly

145 150 155 160

Cys Lys Pro Pro Ile Gly Glu His Trp Gly Lys Gly Ser Pro Cys Thr

165 170 175

Asn Val Ala Val Asn Pro Gly Asp Cys Pro Pro Leu Glu Leu Ile Asn

180 185 190

Thr Val Ile Gln Asp Gly Asp Met Val Asp Thr Gly Phe Gly Ala Met

195 200 205

Asp Phe Thr Thr Leu Gln Ala Asn Lys Ser Glu Val Pro Leu Asp Ile

210 215 220

Cys Thr Ser Ile Cys Lys Tyr Pro Asp Tyr Ile Lys Met Val Ser Glu

225 230 235 240

Pro Tyr Gly Asp Ser Leu Phe Phe Tyr Leu Arg Arg Glu Gln Met Phe

245 250 255

Val Arg His Leu Phe Asn Arg Ala Gly Ala Val Gly Glu Asn Val Pro

260 265 270

Asp Asp Leu Tyr Ile Lys Gly Ser Gly Ser Thr Ala Asn Leu Ala Ser

275 280 285

Ser Asn Tyr Phe Pro Thr Pro Ser Gly Ser Met Val Thr Ser Asp Ala

290 295 300

Gln Ile Phe Asn Lys Pro Tyr Trp Leu Gln Arg Ala Gln Gly His Asn

305 310 315 320

Asn Gly Ile Cys Trp Gly Asn Gln Leu Phe Val Thr Val Val Asp Thr

325 330 335

Thr Arg Ser Thr Asn Met Ser Leu Cys Ala Ala Ile Ser Thr Ser Glu

340 345 350

Thr Thr Tyr Lys Asn Thr Asn Phe Lys Glu Tyr Leu Arg His Gly Glu

355 360 365

Glu Tyr Asp Leu Gln Phe Ile Phe Gln Leu Cys Lys Ile Thr Leu Thr

370 375 380

Ala Asp Val Met Thr Tyr Ile His Ser Met Asn Ser Thr Ile Leu Glu

385 390 395 400

Asp Trp Asn Phe Gly Leu Gln Pro Pro Pro Gly Gly Thr Leu Glu Asp

405 410 415

Thr Tyr Arg Phe Val Thr Ser Gln Ala Ile Ala Cys Gln Lys His Thr

420 425 430

Pro Pro Ala Pro Lys Glu Asp Pro Leu Lys Lys Tyr Thr Phe Trp Glu

435 440 445

Val Asn Leu Lys Glu Lys Phe Ser Ala Asp Leu Asp Gln Phe Pro Leu

450 455 460

Gly Arg Lys Phe Leu Leu Gln Ala Gly Leu Lys Ala Lys Pro Lys Phe

465 470 475 480

Thr Leu Gly Lys Arg Lys Ala Thr Pro Thr Thr Ser Ser Thr Ser Thr

485 490 495

Thr Ala Lys Arg Lys Lys Arg Lys Leu

500 505

<210>4

<211>568

<212>PRT

<213>Human papillomavirus type 18

<300>

<308>Genebank/AAP20601.1

<309>2005-12-06

<313>(1)..(568)

<400>4

Met Cys Leu Tyr Thr Arg Val Leu Ile Leu His Tyr His Leu Leu Pro

1 5 10 15

Leu Tyr Gly Pro Leu Tyr His Pro Arg Pro Leu Pro Leu His Ser Ile

20 25 30

Leu Val Tyr Met Val His Ile Ile Ile Cys Gly His Tyr Ile Ile Leu

35 40 45

Phe Leu Arg Asn Val Asn Val Phe Pro Ile Phe Leu Gln Met Ala Leu

50 55 60

Trp Arg Pro Ser Asp Asn Thr Val Tyr Leu Pro Pro Pro Ser Val Ala

65 70 75 80

Arg Val Val Asn Thr Asp Asp Tyr Val Thr Arg Thr Ser Ile Phe Tyr

85 90 95

His Ala Gly Ser Ser Arg Leu Leu Thr Val Gly Asn Pro Tyr Phe Arg

100 105 110

Val Pro Ala Gly Gly Gly Asn Lys Gln Asp Ile Pro Lys Val Ser Ala

115 120 125

Tyr Gln Tyr Arg Val Phe Arg Val Gln Leu Pro Asp Pro Asn Lys Phe

130 135 140

Gly Leu Pro Asp Thr Ser Ile Tyr Asn Pro Glu Thr Gln Arg Leu Val

145 150 155 160

Trp Ala Cys Ala Gly Val Glu Ile Gly Arg Gly Gln Pro Leu Gly Val

165 170 175

Gly Leu Ser Gly His Pro Phe Tyr Asn Lys Leu Asp Asp Thr Glu Ser

180 185 190

Ser His Ala Ala Thr Ser Asn Val Ser Glu Asp Val Arg Asp Asn Val

195 200 205

Ser Val Asp Tyr Lys Gln Thr Gln Leu Cys Ile Leu Gly Cys Ala Pro

210 215 220

Ala Ile Gly Glu His Trp Ala Lys Gly Thr Ala Cys Lys Ser Arg Pro

225 230 235 240

Leu Ser Gln Gly Asp Cys Pro Pro Leu Glu Leu Lys Asn Thr Val Leu

245 250 255

Glu Asp Gly Asp Met Val Asp Thr Gly Tyr Gly Ala Met Asp Phe Ser

260 265 270

Thr Leu Gln Asp Thr Lys Cys Glu Val Pro Leu Asp Ile Cys Gln Ser

275 280 285

Ile Cys Lys Tyr Pro Asp Tyr Leu Gln Met Ser Ala Asp Pro Tyr Gly

290 295 300

Asp Ser Met Phe Phe Cys Leu Arg Arg Glu Gln Leu Phe Ala Arg His

305 310 315 320

Phe Trp Asn Arg Ala Gly Thr Met Gly Asp Thr Val Pro Gln Ser Leu

325 330 335

Tyr Ile Lys Gly Thr Gly Met Arg Ala Ser Pro Gly Ser Cys Val Tyr

340 345 350

Ser Pro Ser Pro Ser Gly Ser Ile Val Thr Ser Asp Ser Gln Leu Phe

355 360 365

Asn Lys Pro Tyr Trp Leu His Lys Ala Gln Gly His Asn Asn Gly Val

370 375 380

Cys Trp His Asn Gln Leu Phe Val Thr Val Val Asp Thr Thr Arg Ser

385 390 395 400

Thr Asn Leu Thr Ile Cys Ala Ser Thr Gln Ser Pro Val Pro Gly Gln

405 410 415

Tyr Asp Ala Thr Lys Phe Lys Gln Tyr Ser Arg His Val Glu Glu Tyr

420 425 430

Asp Leu Gln Phe Ile Phe Gln Leu Cys Thr Ile Thr Leu Thr Ala Asp

435 440 445

Val Met Ser Tyr Ile His Ser Met Asn Ser Ser Ile Leu Glu Asp Trp

450 455 460

Asn Phe Gly Val Pro Pro Pro Pro Thr Thr Ser Leu Val Asp Thr Tyr

465 470 475 480

Arg Phe Val Gln Ser Val Ala Ile Thr Cys Gln Lys Asp Ala Ala Pro

485 490 495

Ala Glu Asn Lys Asp Pro Tyr Asp Lys Leu Lys Phe Trp Asn Val Asp

500 505 510

Leu Lys Glu Lys Phe Ser Leu Asp Leu Asp Gln Tyr Pro Leu Gly Arg

515 520 525

Lys Phe Leu Val Gln Ala Gly Leu Arg Arg Lys Pro Thr Ile Gly Pro

530 535 540

Arg Lys Arg Ser Ala Pro Ser Ala Thr Thr Ser Ser Lys Pro Ala Lys

545 550 555 560

Arg Val Arg Val Arg Ala Arg Lys

565

<210>5

<211>524

<212>PRT

<213>Human papillomavirus type 58

<300>

<308>Genebank/BAA31851.1

<309>2007-12-07

<313>(1)..(524)

<400>5

Met Val Leu Ile Leu Cys Cys Thr Leu Ala Ile Leu Phe Cys Val Ala

1 5 10 15

Asp Val Asn Val Phe His Ile Phe Leu Gln Met Ser Val Trp Arg Pro

20 25 30

Ser Glu Ala Thr Val Tyr Leu Pro Pro Val Pro Val Ser Lys Val Val

35 40 45

Ser Thr Asp Glu Tyr Val Ser Arg Thr Ser Ile Tyr Tyr Tyr Ala Gly

50 55 60

Ser Ser Arg Leu Leu Ala Val Gly Asn Pro Tyr Phe Ser Ile Lys Ser

65 70 75 80

Pro Asn Asn Asn Lys Lys Val Leu Val Pro Lys Val Ser Gly Leu Gln

85 90 95

Tyr Arg Val Phe Arg Val Arg Leu Pro Asp Pro Asn Lys Phe Gly Phe

100 105 110

Pro Asp Thr Ser Phe Tyr Asn Pro Asp Thr Gln Arg Leu Val Trp Ala

115 120 125

Cys Val Gly Leu Glu Ile Gly Arg Gly Gln Pro Leu Gly Val Gly Val

130 135 140

Ser Gly His Pro Tyr Leu Asn Lys Phe Asp Asp Thr Glu Thr Ser Asn

145 150 155 160

Arg Tyr Pro Ala Gln Pro Gly Ser Asp Asn Arg Glu Cys Leu Ser Met

165 170 175

Asp Tyr Lys Gln Thr Gln Leu Cys Leu Ile Gly Cys Lys Pro Pro Thr

180 185 190

Gly Glu His Trp Gly Lys Gly Val Ala Cys Asn Asn Asn Ala Ala Ala

195 200 205

Thr Asp Cys Pro Pro Leu Glu Leu Phe Asn Ser Ile Ile Glu Asp Gly

210 215 220

Asp Met Val Asp Thr Gly Phe Gly Cys Met Asp Phe Gly Thr Leu Gln

225 230 235 240

Ala Asn Lys Ser Asp Val Pro Ile Asp Ile Cys Asn Ser Thr Cys Lys

245 250 255

Tyr Pro Asp Tyr Leu Lys Met Ala Ser Glu Pro Tyr Gly Asp Ser Leu

260 265 270

Phe Phe Phe Leu Arg Arg Glu Gln Met Phe Val Arg His Phe Phe Asn

275 280 285

Arg Ala Gly Lys Leu Gly Glu Ala Val Pro Asp Asp Leu Tyr Ile Lys

290 295 300

Gly Ser Gly Asn Thr Ala Val Ile Gln Ser Ser Ala Phe Phe Pro Thr

305 310 315 320

Pro Ser Gly Ser Ile Val Thr Ser Glu Ser Gln Leu Phe Asn Lys Pro

325 330 335

Tyr Trp Leu Gln Arg Ala Gln Gly His Asn Asn Gly Ile Cys Trp Gly

340 345 350

Asn Gln LeuPhe Val Thr Val Val Asp Thr Thr Arg Ser Thr Asn Met

355 360 365

Thr Leu Cys Thr Glu Val Thr Lys Glu Gly Thr Tyr Lys Asn Asp Asn

370 375 380

Phe Lys Glu Tyr Val Arg His Val Glu Glu Tyr Asp Leu Gln Phe Val

385 390 395 400

Phe Gln Leu Cys Lys Ile Thr Leu Thr Ala Glu Ile Met Thr Tyr Ile

405 410 415

His Thr Met Asp Ser Asn Ile Leu Glu Asp Trp Gln Phe Gly Leu Thr

420 425 430

Pro Pro Pro Ser Ala Ser Leu Gln Asp Thr Tyr Arg Phe Val Thr Ser

435 440 445

Gln Ala Ile Thr Cys Gln Lys Thr Ala Pro Pro Lys Glu Lys Glu Asp

450 455 460

Pro Leu Asn Lys Tyr Thr Phe Trp Glu Val Asn Leu Lys Glu Lys Phe

465 470 475 480

Ser Ala Asp Leu Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Leu Gln

485 490 495

Ser Gly Leu Lys Ala Lys Pro Arg Leu Lys Arg Ser Ala Pro Thr Thr

500 505 510

Arg Ala Pro Ser ThrLys Arg Lys Lys Val Lys Lys

515 520

<210>6

<211>1500

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of full-length HPV6L1 protein gene suitable for pichia pastoris preference codon

<400>6

atgtggagac catccgactc cactgtctac gttccaccac caaacccagt ctctaaggtt 60

gtcgccactg acgcctacgt cacccgtacc aacatctttt accacgcttc ttcctctcgt 120

ttgcttgccg tcggacaccc ttacttctcc atcaaaagag ccaacaagac cgtcgtccca 180

aaggtctccg gttatcagta tagagttttt aaagtcgtcc ttccagaccc taacaagttc 240

gctttgccag actcctcttt gttcgatcca accacccagc gtttggtctg ggcctgtact 300

ggtttggagg ttggtagagg tcagcctctt ggtgttggag tctccggaca ccctttcctt 360

aacaagtacg acgacgtcga gaactccggt tccggtggta acccaggtca ggataaccgt 420

gtcaacgttg gtatggacta caagcagacc cagctttgta tggtcggatg tgctccacca 480

cttggtgagc actggggaaa gggtaaacaa tgcaccaaca ccccagtcca ggctggtgac 540

tgtccacctt tggagcttat cacctccgtt atccaggacg gtgacatggt cgataccggt 600

ttcggagcca tgaattttgc cgaccttcag actaacaagt ccgatgtccc tatcgacatc 660

tgcggtacta cctgcaagta cccagactac cttcagatgg ccgccgaccc atacggagat 720

cgtttgtttt tctttttgcg taaggagcagatgttcgccc gtcacttctt taaccgtgct 780

ggagaggtcg gtgagcctgt cccagacacc cttatcatca aaggttccgg taacagaacc 840

tccgtcggtt cctccatcta cgttaacact ccatctggtt cccttgtttc ctccgaggcc 900

cagttgttta acaagcctta ctggttgcag aaggcccagg gtcacaataa cggtatttgc 960

tggggaaatc agttgtttgt caccgtcgtt gacaccaccc gttctaccaa catgaccctt 1020

tgtgcctccg tcaccacttc ctccacctat actaactccg actacaagga gtatatgcgt 1080

cacgtcgagg aatacgactt gcagtttatt tttcagttgt gttccatcac cttgtccgcc 1140

gaggtcatgg cctacattca taccatgaac ccatccgtct tggaggactg gaacttcgga 1200

ttgtctcctc cacctaatgg aaccttggag gatacctacc gttacgttca gtcccaagcc 1260

attacttgcc aaaagcctac ccctgagaag gaaaaacctg acccatacaa aaatctttct 1320

ttttgggagg ttaatcttaa agaaaaattc tcctccgaat tggaccagta cccattggga 1380

cgtaagtttt tgttgcaatc cggttatcgt ggacgttcct ctatccgtac cggagttaag 1440

cgtcctgccg tttctaaggc ctccgccgcc cctaagagaa aacgtgctaa aaccaagaga 1500

<210>7

<211>1515

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of full-length HPV16L1 protein gene suitable for pichia pastoris preference codon

<400>7

atgtccttgt ggttgccatc cgaagccact gtttacttgc ctcctgtccc agtctccaag 60

gtcgtttcta ccgacgagta cgtcgcccgt accaatatct actaccatgc cggaacctcc 120

cgtttgcttg ccgtcggtca tccatacttc cctattaaaa agccaaataa taacaagatc 180

cttgtcccaa aggtctccgg acttcagtac cgtgtcttcc gtattcatct tccagaccct 240

aacaaatttg gtttcccaga cacctccttc tacaaccctg atacccagag acttgtctgg 300

gcctgcgtcg gagttgaggt cggtagaggt caacctttgg gagtcggtat ctccggtcac 360

ccacttttga acaagttgga cgacaccgaa aacgcctctg cttacgccgc taacgctggt 420

gttgacaacc gtgagtgcat ttccatggac tacaaacaga cccagttgtg ccttatcgga 480

tgcaaaccac caatcggaga gcactggggt aagggttccc cttgcaccaa cgttgccgtc 540

aacccaggag actgcccacc tttggagctt atcaacaccg ttatccagga cggtgatatg 600

gtcgatactg gattcggagc catggacttt accacccttc aggccaataa gtccgaagtc 660

ccacttgaca tttgtacctc tatttgtaaa tacccagact acatcaaaat ggtctccgag 720

ccttacggtg actccttgtt tttttatctt cgtagagagc agatgtttgt ccgtcacctt 780

ttcaaccgtg ctggtgctgt cggtgagaac gtcccagacg acctttacat caagggttcc 840

ggttccaccg ccaatttggc ctcctccaac tatttcccaa ctccatccgg ttccatggtc 900

acctccgacg cccaaatctt taataaacca tactggcttc agagagccca gggacataac 960

aacggtatct gctggggtaa ccagttgttt gtcaccgtcg ttgacaccac tcgttccacc 1020

aacatgtcct tgtgcgccgc catctctacc tctgaaacca cctataagaa tactaatttc 1080

aaagagtatt tgagacacgg tgaggagtac gatttgcagt ttatctttca actttgcaag 1140

atcaccttga ccgccgacgt catgacctac atccattcta tgaactccac cattttggaa 1200

gactggaact tcggacttca acctccacct ggtggaactt tggaggacac ctaccgtttc 1260

gtcacttctc aggccattgc ctgtcagaag catacccctc ctgccccaaa agaagatcca 1320

ttgaagaaat atactttttg ggaggttaat cttaaggaga agttctccgc cgacttggat 1380

caattccctc ttggacgtaa gtttttgctt caggccggac ttaaggccaa gcctaagttt 1440

accttgggaa agcgtaaggc cacccctact acctcttcca cctccaccac tgctaagcgt 1500

aagaaaagaa agctt 1515

<210>8

<211>1503

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of full-length HPV11L1 protein gene suitable for pichia pastoris preference codon

<400>8

atgtggagac cttctgattc caccgtctac gtcccacctc caaacccagt ctccaaagtc 60

gtcgccactg acgcctacgt taaaagaact aatatcttct accacgcttc ttcctccaga 120

cttttggccg ttggacaccc ttactactcc attaaaaagg ttaacaagac cgtcgtccct 180

aaggtctccg gttatcagta ccgtgtcttc aaagtcgtct tgccagaccc aaacaagttc 240

gccttgcctg attcctccct tttcgaccct accactcaga gattggtctg ggcctgcacc 300

ggacttgaag tcggtagagg tcaaccattg ggtgtcggag tttccggaca cccattgctt 360

aacaaatacg acgacgttga aaactccggt ggatacggag gtaaccctgg tcaggacaac 420

agagtcaacg tcggtatgga ctacaagcag acccaacttt gcatggtcgg ttgcgctcca 480

cctcttggag agcactgggg taagggaact cagtgctcca acacctctgt ccagaacgga 540

gattgcccac cattggagtt gatcacttct gtcatccagg acggtgacat ggtcgatact 600

ggtttcggtg ccatgaactt cgccgacttg cagactaaca agtccgacgt ccctttggac 660

atttgcggaa ccgtctgcaa gtacccagac tatcttcaga tggctgccga tccatgcgga 720

gaccgtttgt tcttttactt gagaaaggaa caaatgttcg ctcgtcactt cttcaatcgt 780

gccggaaccg ttggagaacc agtcccagac gacttgcttg tcaaaggtgg aaacaaccgt 840

tcctccgttg cttcctccat ctatgtccat accccttccg gttctttggt ctcctccgag 900

gcccaacttt tcaacaagcc ttactggctt cagaaggctc agggacacaa caacggaatc 960

tgttggggta accacctttt cgtcaccgtt gttgacacca ccagatccac caacatgacc 1020

ttgtgcgcct ctgtctccaa atctgctacc tacaccaact ccgactataa ggagtacatg 1080

agacacgtcg aagagtttga tttgcagttt atttttcaac tttgctccat caccctttct 1140

gccgaggtca tggcctacat tcacaccatg aacccatccg tcttggagga ctggaacttt 1200

ggtttgtccc caccacctaa cggaaccctt gaggacacct atcgttatgt ccagtcccag 1260

gccatcacct gtcagaagcc aaccccagag aaggagaagc aggaccctta caaagatatg 1320

tctttttggg aggtcaactt gaaagaaaag ttctcttccg agcttgacca attccctctt 1380

ggtagaaagt ttttgttgca atccggttac cgtggacgta cctccgccag aaccggtatc 1440

aaacgtccag ccgtttccaa gccatccact gctcctaagc gtaaacgtac caagaccaag 1500

aaa 1503

<210>9

<211>1521

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of full-length HPV18L1 protein gene suitable for pichia pastoris preference codon

<400>9

atggctttgt ggcgtccttc cgacaacact gtctaccttc caccaccttc cgttgctaga 60

gtcgtcaata ccgacgacta cgtcacccgt acctccatct tctatcatgc cggttcctct 120

cgtttgttga ccgtcggtaa cccatacttc cgtgttccag ccggtggtgg taataaacag 180

gacatcccta aggtctccgc ttaccagtat cgtgtcttca gagtccagtt gcctgaccct 240

aacaagttcg gtcttccaga caactccatc tacaaccctg agacccaacg tcttgtttgg 300

gcctgcgccg gagttgagat cggacgtggt caaccacttg gtgtcggtct ttccggacac 360

cctttctaca acaagttgga tgacactgaa tcttcccacg ctgccacttc taacgtctcc 420

gaagacgtcc gtgacaatgt ctccgttgac tacaagcaga cccagttgtg catcttgggt 480

tgtgctcctg ctatcggtga gcactgggct aagggaactg cctgtaagtc ccgtccattg 540

tcccagggag actgcccacc acttgagttg aagaacaccg tcttggagga cggagacatg 600

gtcgataccg gttacggagc catggacttt tccacccttc aggacactaa gtgcgaggtc 660

cctcttgaca tctgccagtc catttgcaag tacccagatt acttgcagatgtccgccgac 720

ccatacggtg actccatgtt cttttgcttg cgtcgtgagc agttgtttgc ccgtcatttc 780

tggaatcgtg ccggaaccat gggtgacact gtccctcagt ccttgtatat caagggaacc 840

ggtatgcgtg cttccccagg ttcttgcgtc tactctcctt ccccttccgg ttctatcgtt 900

acttccgatt cccaactttt caataagcca tattggttgc acaaggccca aggtcacaac 960

aacggtattt gctggcataa ccagttgttc gtcaccgtcg ttgacactac cagatccacc 1020

aacttgacca tctgtgcctc cactcagtcc cctgtccctg gtcagtacga cgccaccaag 1080

ttcaagcagt actcccgtca cgtcgaggaa tacgatttgc agttcatttt tcaactttgc 1140

accatcacct tgaccgccga cgttatgtct tacatccatt ctatgaattc ctccatcttg 1200

gaggactgga acttcggagt ccctccacca cctaccacct cccttgttga cacctacaga 1260

ttcgtccaat ccgtcgccat cacctgtcaa aaggacgccg cccctgccga aaacaaagat 1320

ccttatgaca agcttaagtt ctggaacgtt gacttgaagg agaagttttc tcttgacttg 1380

gaccaatacc ctcttggtag aaagttcctt gtccaggccg gattgcgtcg taagcctact 1440

atcggtcctc gtaagagatc cgccccttcc gccactacct cttctaagcc tgccaagcgt 1500

gtcagagtta gagccagaaa a 1521

<210>10

<211>1494

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of full-length HPV58L1 protein gene suitable for pichia pastoris preference codon

<400>10

atgtccgttt ggagaccttc cgaggccact gtctacttgc caccagttcc agtctccaag 60

gttgtttcca ctgacgagta cgtctcccgt acctccatct actactacgc cggttcttcc 120

agattgttgg ccgtcggtaa cccttacttc tccatcaagt ccccaaacaa caacaagaaa 180

gtccttgttc ctaaagtttc cggtcttcag taccgtgtct tccgtgttcg tttgcctgac 240

ccaaacaagt tcggattccc tgacacttcc ttctacaacc ctgacaccca gagacttgtc 300

tgggcctgtg tcggacttga gattggtcgt ggacaacctc ttggtgttgg agtttccggt 360

cacccttact tcaacaagtt cgacgacacc gagacctcca accgttaccc agcccaacca 420

ggttccgaca accgtgagtg cttgtccatg gactacaaac aaacccaatt gtgcttgatc 480

ggttgtaaac caccaactgg tgagcactgg ggaaagggtg tcgcctgcaa caacaacgct 540

gctgccaccg attgtccacc attggagttg tttaactcta ttatcgagga cggagacatg 600

gttgacaccg gattcggttg catggacttc ggaaccttgc aagccaacaa gtccgatgtc 660

ccaatcgaca tctgcaactc cacctgcaag taccctgact acttgaagat ggcctccgag 720

ccatacggtg actctttgtt cttcttcctt cgtagagagc agatgttcgt ccgtcacttc 780

ttcaaccgtg ctggaaagtt gggtgaggcc gtcccagatg acttgtatat caagggttct 840

ggtaataccg ccgtcatcca gtcctctgcc ttcttcccaa ctccatccgg ttccatggtt 900

acctccgagt cccagctttt caacaagcct tattggttgc agcgtgccca gggtcataac 960

aacggaatct gctggggaaa ccagcttttc gtcaccgtcg ttgacaccac ccgttccact 1020

aatatgacct tgtgcaccga ggtcaccaaa gagggaacct acaaaaacga caacttcaaa 1080

gagtatgtcc gtcacgtcga agagtacgac ttgcagttcg tctttcagtt gtgtaaaatc 1140

accttgaccg ctgaaattat gacctatatt cacactatgg actccaacat tttggaagat 1200

tggcagttcg gacttacccc acctccatct gcttccttgc aggacactta ccgtttcgtc 1260

acctcccagg ccatcacttg tcagaagacc gctccaccaa aggagaaaga agaccctttg 1320

aacaaataca ccttttggga ggttaacttg aaggagaagt tttctgccga cttggaccag 1380

ttcccattgg gtagaaaatt cttgcttcag tctggtttga aggccaagcc tcgtttgaag 1440

agatccgccc caaccactcg tgccccatct actaagcgta agaaggttaa gaaa 1494

<210>11

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> primer

<400>11

cgatggaact tcgaaacgat gtggagacc 29

<210>12

<211>32

<212>DNA

<213> Artificial sequence

<220>

<223> primer

<400>12

gacctgggta ccctattatc tcttggtttt ag 32

<210>13

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> primer

<400>13

cgatggaact tcgaaacgat gtggagacc 29

<210>14

<211>26

<212>DNA

<213> Artificial sequence

<220>

<223> primer

<400>14

gacctgggta ccctattatt tcttgg 26

<210>15

<211>30

<212>DNA

<213> Artificial sequence

<220>

<223> primer

<400>15

cgatggaact tcgaaacgat gatgtccttg 30

<210>16

<211>26

<212>DNA

<213> Artificial sequence

<220>

<223> primer

<400>16

gacctgggta ccctattaaa gctttc 26

<210>17

<211>30

<212>DNA

<213> Artificial sequence

<220>

<223> primer

<400>17

cgatggaact tcgaaacgat ggctttgtgg 30

<210>18

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> primer

<400>18

gacctgggta ccctattatt ttctggc 27

<210>19

<211>30

<212>DNA

<213> Artificial sequence

<220>

<223> primer

<400>19

cgatggaact tcgaaacgat gtccgtttgg 30

<210>20

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> primer

<400>20

gacctgggta ccctattatt tcttaac 27

Claims

1. A separated gene is used for coding a main capsid protein L1 of human papilloma and is characterized in that the gene has a codon preferred by pichia pastoris and has a nucleotide sequence shown as SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9 or SEQ ID NO 10.

2. An expression vector comprising the sequence of the gene of claim 1.

3. A genetically engineered host cell comprising the expression vector of claim 2, or having the gene of claim 1 integrated into its genome.

4. The host cell of claim 3, wherein the cell is a Pichia pastoris cell.

5. The host cell of claim 4, wherein the Pichia pastoris is selected from the group consisting of Pichia pastoris X-33, GS115, KM71, and SMD1168 strains.

6. A method for preparing an immunogenic macromolecule having a diameter of 50-80 nm and consisting essentially of self-assembly of the major capsid protein L1 of human papilloma virus, said method comprising:

(1) Culturing the host cell of claim 3 such that said major capsid protein L1 of human papilloma virus is expressed in the host cell and assembled to form an immunogenic macromolecule;

(2) Isolating said immunogenic macromolecule.

7. The method of claim 6, wherein step (2) comprises:

(a) Crushing the host cell obtained in the step (1) to obtain a supernatant containing the macromolecules with immunogenicity; and

(b) Purifying the supernatant obtained in the step (a) by sequentially adopting ion exchange column chromatography and hydroxyapatite column chromatography, thereby obtaining the macromolecule with immunogenicity.

8. An immunogenic composition comprising:

(i) An effective amount of a macromolecule having immunogenicity prepared according to the method of claim 6; and

(ii) An adjuvant.

9. The composition of claim 8, wherein the adjuvant is an aluminum adjuvant.

10. Use of the composition of claim 8 in the manufacture of a medicament for preventing or treating a disease associated with human papilloma virus infection.

11. A method for expressing HPV6, 11, 16, 18 and 58L1 genes in Pichia pastoris, comprising the steps of:

(1) cloning HPV6, 11, 16, 18 and 58L1 genes optimized by codons into an expression vector, wherein the genes have nucleotide sequences shown in SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9 or SEQ ID NO 10;

(4) further screening the strains obtained in the step (3) by testing the expression level of HPV6, 11, 16, 18 and 58L1 genes to obtain one or more strains with the highest expression level;

(5) performing expression by using the strain obtained in the step (4) to obtain HPV6, 11, 16, 18 and 58L1 proteins.