CN107002085A - Excellent human papillomavirus antigen with superior immune characteristic and the vaccine containing it - Google Patents

Abstract

The present invention provides the gene of a variety of HPV antigens of the several serotypes of coding.The gene of the present invention is produced with improved immunology quality and the virus-like particle of quaternary structure.Present invention also offers suitable host cell, the pichia pastoris phaff (P.pastoris) of the gene of a variety of HPV antigens of the several serotypes of coding preferably with high copy number.Present invention also offers the vaccine for HPV antigens with improved immunization program, wherein reducing vaccine dose scheme and the amount of antigen.Present invention also offers improved Human-papilloma Vaccine's composition using yeast.

Description

Excellent human papillomavirus antigen with superior immune characteristic and containing it Vaccine

Technical field

The present invention relates to the gene of coding human papillomavirus antigen and its purposes in vaccine development, particularly it is used for The purposes of prevention of human papillomavirus infection in the mankind.Present invention also offers the improved HPV using yeast Vaccine combination.

Background technology

In world wide, cervical carcinoma is the second largest common cancer in women, and it causes annual 274,000 death. The incidence of disease of cervical carcinoma of Indian is about annual 132,000, accounts for nearly the 52% of Asian-Pacific area record disease incidence.It is every in India Year has nearly 73,000 women to die from cervical carcinoma；Therefore it possesses nearly the four of all cervical carcinomas death for occupying whole world record / mono- ignominious reputation.According to estimates by 2025, the incidence of disease of developing world will account for nearly the 80% of global incidence. HPV (human papillomavirus, HPV) is the size about 8kb epithelial double-stranded DNA virus that becomes.HPV bases Because of group coding nonstructural proteins (E1, E2, E4, E5, E6 and E7) and a structural protein (L1 and L2).Report has more than 120 kinds of HPV Type.The persistent infection of excessive risk HPV type is the unique most important factor for inducing cervical carcinoma.In excessive risk HPV type, HPV16 and 18 is the whole world most often related to cervical carcinoma genotype.It was found that the overall HPV type incidence in cervical carcinoma of Indian For following order：HPV16,18,31,33,35,39,45,52,56,58,59 and HPV68.In India, HPV16 and HPV18 types Joint contribution nearly the 80% of whole cervical cancer pathogenesis rates.

At present, two kinds of vaccine for cervical cancer have been used on world market：The tetravalence HPV produced by Merck＆Co.Inc. (qHPV) vaccine (Merck, Rahway, NJ, the U.S.)；With two produced by GlaxoSmithKline plc. Valency HPV vaccines (CervarixTM, GSK, Middlesex, Britain).Gardasil is by food and drug administration (FDA) In in June, 2006 approval, it is protected for four kinds of HPV strains --- HPV 6,11,16 and 18.Although having more than 100 kinds HPV strains, but some types especially may be relevant with cancer；Strain 16 and 18 and 70% phase of all cases of cervical cancer in the U.S. Close.Strain 6 and 11 is related to 90% genital wart.In clinical test, vaccine prevents in the women being uninfected by the past Efficient is shown in terms of persistent infection, precancerous lesion and the external genital organs lesion of these four strains.The one of women in the experiment Individual subset 5 years by follow-up, and have shown that 95.8% resistance persistent infection or the vaccine potency of disease and With peripheral lesions effect before 100% resistance cancer.Further follow-up study is needed to determine the protection period, but research it has been shown that Women of the Young Female of 10-14 Sui than 15-24 Sui shows stronger immune response to vaccine, and this shows the epidemic disease of more early stage Seedling inoculation can cause more permanent antibody-activated killers.Other nearest researchs are it has been shown that vaccine is also provided to vagina and vulva cancer Protection.According to Alan Guttmacher research institutes, HPV vaccines " are widely regarded as in recent years to the greatest health of women One of health care progress ".

Different from qHPV vaccines, divalence HPV vaccines are only made up of two kinds of antigens：The types of HPV 16 and 18 types.For its L1 egg White synthesis, by gene cloning into rhabdovirus expression vector, and arrives insect cell powder pattern night by manufactured carrier infection In moth cell (High Five), then it is incubated two days in serum free medium；Then harvesting.

The infection of the currently available and evaluated HPV vaccines targeting prevention types of HPV 16 and 18 types.HPV vaccines are by passing through weight Prepared by the virus-like particle (virus-like particle, VLP) that group technology is produced, and be used as three 0.5ml intramuscular injections Applied within six months periods.Nearest result shows that HPV vaccines are high degree of immunogenicity, in nearly all vaccine inoculation Women in induced high levels serum antibody, and impart in the women of complete vaccine inoculation for HPV-16/18 senses Dye and therefore related cancer before cervical lesionses it is highly protective.The tetravalence assessed in 33 national 27,000 women (HPV 6/11/16/18) vaccine has been demonstrated effectively prevent the persistent infection more than 99%.

Produced according to the vaccine of the present invention using the recombinant technique used in the exploitation of early stage HPV vaccine.By making Having main steps that by required gene cloning into expression vector involved by protein needed for being obtained with recombinant technique, by base Because expressing in host cell (it is properly termed as expression system), to from the protein that obtains of insertion gene carry out purifying and Characterize.Commonly used approach and component are widely available in the prior art in each above-mentioned steps.It is all these to refer to Step has some limitations and dependence, such as expression vector, host cell, nucleotide sequence to wherein usually used component Deng.Those skilled in the art must analyze every kind of mutual compatibility of component in recombinant technique.

The invention provides use human papilloma virus with new codon optimised genes of the yeast as expression system Malicious vaccine combination, described four kinds of difference HPV type (HPV16, HPV18, HPV6 and HPV11) late period HPV albumen of gene code HPV protein.It is well known that strain HPV16 and HPV18 combination can only protect 70% in all popular HPV strains. Therefore, it is suggested that adding extra antigen into vaccine.Due to there is epidemiology difference between region in the world, it is proposed that alive Relevant range in boundary includes more serotypes (being HPV 33 and HPV 45 for India) to provide wider protection. The coverage that L2 antigens will be enlarged by protection together with L1 antigens has been described.It was found that the human papilloma developed according to the present invention The internal seroconversion response of vaccine is much better than existing reference product.

In the existing field of the present invention, in the art it is known that with the phase containing wild type HPV16 L1 genes The pichia pastoris phaff (P.pastoris) (KM71 bacterial strains) converted with plasmid does not express L1 albumen, demonstrates the need for Pasteur HPV16L1 expression in Pichia pastoris carries out codon optimization.

[Bazan etc., Arch Virol.2009；154(10)；P1-16] this document describes the password of the L1 genes of HPV 16 Son optimization, and be cloned into non-integrated vector, and it is further used for transformed competence colibacillus P. pastoris cell. Bazan etc. discloses VLP and seems more regularly and limited (45-50nm).It is known for large-scale production, episomal carrier (episomal vector) (non-integrated vector) is not favourable, because the yeast of conversion may after continuous mitosis These carriers are lost, because their unconformity are into genome, therefore can be lost in the case of in the absence of selection pressure. Need to make codon optimised genes be expressed in selected expression system.For using any anti-of suitable expression systems Original, this technology is known in the art.For example, N.Hanumantha Rao etc., Vaccine 29 (2011) 7326-7334 describes the main of codon optimization that HPV 16 and 18 types are expressed in pichia pastoris phaff Capsid protein (L1).In addition, Hanumantha Rao etc. disclose " The purified VLPs of HPV16 and HPV 18 showed variable particle size having a mean of approximately 53nm.”(HPV16 Average about 53nm varying granularity is shown with HPV18 purifying VLP).Wherein, HPV genes are in Pichia Pastoris strain Clone and express in GS115.

These articles do not provide the information relevant with the impromptu property (improvisation) of its VLP immunogenic properties. Increased VLP immunogenicities can realize that it allows the repetition antigen presentation of higher amount by increasing VLP size.Most Eventually, it will provide the more preferable immune response for being directed to HPV antigens.

Therefore, the invention provides the codon optimization of the HPV L1 genes for different serotypes, it, which provides to have, changes The self assembly VLP of kind immunology quality, and the final substantially higher immunogenic response for being directed to HPV antigens.With phase Same mode, can produce HPV L2 genes, the codon optimization of HPV early antigens (E6 and E7) resists to develop for HPV Former vaccine.

Although select optimization gene in specific host expressing said gene be technology as known in the art, It is that many possible changes are still had in optimization.The method of codon optimization is not general.Therefore, each gene has Unique codon optimization method.We are hereinafter it has been mentioned that several patent applications, it is used as prior art of the invention A part.

1066/MUMNP/2010 discloses the codon optimization base of the Major capsid protein L1 of coding HPV Cause.There is provided the Major capsid protein L1 that HPV is encoded by being expressed in yeast cells through codon optimization Gene and the macromolecular with immunogenicity, its purposes and the composition produced.Obtained by the method described in this application The VLP obtained size is in the range of about 50 to 80nm.

IN 203333 is disclosed comprising from human papilloma virus 16, HPV 18, the and of HPV 31 The vaccine combination of the virus-like particle containing L1 albumen or feature L1 protein derivatives of the genotype of HPV 45, The antibody mediated immunity response wherein produced by the vaccine is in every kind of HPV with individually preparing, virus-like particle class As level.It which disclose and infected with coding HPV 36 or 18L1 target gene recombinant baculovirus (MOI is 0.3) Cabbage looper (High Five^TM) the middle expression albumen of HPV 16/18 of cell (density is about 350000 cell/ml).It is wherein public It is the aluminium hydroxide combined with 3D-MPL to have opened preferred adjuvant.It can include impurity (such as host cell DNA using insect cell With host cell proteins matter) risk.

IN 245189 discloses a kind of immunogenic composition, its include from HPV 16 and 18 and it is at least one its The VLP or capsomere of his HPV cancer types, other described cancer types be selected from the types of HPV 31,45 types and 52 types, wherein it is described at least The dosage of a kind of VLP of other cancer types or the dosage of capsomere relative to HPV 16 or 18 is reduced.Wherein, inventor is in formula In used two kinds of adjuvants, i.e. aluminium hydroxide and 3D MPL.These adjuvants contribute to the immunogenicity of inducing antigen.

Above-mentioned existing patent application is described has used yeast as expression system in the vaccine that exploitation is directed to HPV antigens The extensive work that system is carried out.Pichia pastoris phaff second is commonly used afterwards in bacteria Escherichia coli (Escherichia coli) Heterologous expression system.Selection pichia pastoris phaff is still not enough to antigen needed for obtaining as the host of antigen needed for expression It is higher to express and turn into therewith a kind of good candidate for being used for developing the vaccine for HPV.From above-mentioned bibliography [Bazan Deng] it is well understood that.Accordingly, it would be desirable to carry out codon optimization to required antigen to obtain purpose insertion according to host cell The expression of gene.

Therefore, it is necessary to solve several challenges and uncertain before HPV vaccine inoculations can be widely implemented in low-resource country Property.Challenge includes：The logistics that can be transported with the current high cost of vaccine, feasibility, acceptability, vaccine is (in view of need through 6 Month three dosage of distribution, improvement alternative and vaccine platform are to extend to the girl of Pre-adolescence or early stage), permanent immunity originality and Prevent the effect of cervix neoplasmses formation, for the cross protection for the HPV infection not targetted by vaccine antigen, and it is swollen in anti-uterine neck Knurl and induce and maintain immunogenicity and digital preservation in terms of the need for dosage more feasible in logistics.These problems pair It is most important for the global acceptance of HPV vaccines and the abundant support of power are introduced in public health service.

The present inventor has been attempt to solve expression yield, immunogenicity, dosage and the cost with HPV vaccines Related most problems.In the present invention, illustrate by only carrying out one with the HPV L1 antigens of relatively low-dose in mouse Secondary immunity inoculation and the bacterin preparation for delivering more high immunogenicity.The invention provides coding various serotype HPV L1 albumen New gene, it most provides the surprising higher immune response for HPV antigens at last.Therefore, these candidates can For developing the vaccine for HPV, it will solve the subject matter related to HPV vaccines.Present invention also offers immunogenicity Composition, its include contain from HPV 16, HPV 18, HPV 6, HPV 11 and it is at least one selected from HPV 31, HPV 52, HPV 58 and the L1 albumen of another genotype in the genotype of HPV 45 virus-like particle and only a kind of adjuvant.In addition, The present invention is used as expression system without using insect cell.Therefore, it reduce insect source host cell impurity such as host it is thin Born of the same parents DNA and host cell proteins matter risk, it can meet the consideration (allergy) of secure context.Can be according to described in the present invention Method prepare other serotypes such as HPV 35 for HPV, HPV 39, HPV 56, HPV 59 and HPV 68 immunogene Property composition.

In addition, the invention provides with more large scale and with the VLP of improved immunology quality, offer is directed to by it The significantly higher immune response of HPV antigens.

Commercially available HPV vaccines are based on VLP formation, by yeast (saccharomyces cerevisiae (Sacchromyces Cervisiae HPV albumen is expressed)) or in baculovirus expression system and forms the VLP, and their immunogenicity and its Quaternary structure forms directly related.[Henryk Mach etc., Journal of pharmaceutical sciences, Vol.95, No.10, p 2195-2206].This article discloses the table of HPV 6,11 and 16 type L1VLP albumen in saccharomyces cerevisiae Up to generating size (30-50nm) in irregular shape, the widely distributed VLP smaller than expected (60nm).

In our invention, inventor has optimized decomposition/restructuring condition with by forming more preferable quaternary structure To form improved VLP, cause in HPV different serotypes (preferably 18 6 L1 and HPV of L1, HPV of L1, HPV of HPV 16 11 L1) higher immunogenicity.

To achieve it, gene is directed into different HPV serotypes (preferred L1, HPV 18 of HPV 16 of HPV serotypes The L1 of L1, HPV 6 and L1 of HPV 11) codon optimization is carried out to express in yeast.Some regions (the following article of modifier Described in the detailed description of the application), to realize that conformation dependent quaternary structure changes after the translation in VLP.

In this specification and subsequent claims, unless the context otherwise requires, word " include/including " will be by The group including the entirety or step or entirety or step is construed as to imply that, but is not excluded for any other entirety or step or entirety Or the group of step.

It is not simultaneously to the reference of any first disclosure (or the information obtained from it) or any known things in this specification And be not construed as recognizing or confirm or any form hint：The first disclosure (or the information obtained from it) or known things A part for the common knowledge formed in the field involved by this specification.

Goal of the invention

In the first aspect, the invention provides the isolated genes of the HPV of coding various serotype different proteins, its Described in gene optimized according to host cell codon.

At one of described aspect, HPV different proteins include Major capsid protein L1, secondary capsid protein L2 and early stage Antigen E6 and E7.

On the other hand, the invention provides coding various serotype (preferably HPV 16, HPV 18, HPV 6, HPV 11 Deng) L1 albumen isolated genes.

In second aspect, the invention provides the virus-like particle with improved immunology quality, it is used as integration The result of the codon optimised genes of the different HPV antigens of coding into host cell and obtain.

At the 3rd aspect, the invention provides the host of the genetic transformation of the different proteins with coding HPV is thin Born of the same parents.

On the other hand, the invention provides the HPV of the coding various serotype with high copy number different proteins Gene host cell.

On the other hand, the invention provides the load of the gene of the different proteins of the HPV containing coding various serotype Body.

At the 4th aspect, the invention provides the virus-like particle with improved quaternary structure, it is as being incorporated into The result of the codon optimised genes of the different HPV antigens of coding in host cell and obtain.

At the 5th aspect, the invention provides the epidemic disease for HPV with significantly higher immunogenicity Seedling.

At the 6th aspect, the invention provides a kind of epidemic disease for HPV antigens with improved immunization program Seedling, wherein vaccine dose scheme is reduced to single.

On the other hand, the invention provides the vaccine for HPV antigens of the amount of antigen with substantive reduction.

On the other hand, the invention provides use vaccine for HPV antigen of the yeast as expression system.

In terms of one preferred, the invention provides use pichia pastoris phaff as expression system to be directed to HPV The vaccine of antigen.

Summary of the invention

The invention provides the gene of the codon optimization for a variety of HPV antigens for encoding several serotypes.These genes enter One step is produced with improved immunology quality and the virus-like particle of quaternary structure.Such VLP produces the reality for HPV antigens The higher immune response of matter.

In addition, the invention provides suitable host cell, many of several serotypes are encoded preferably with high copy number Plant the pichia pastoris phaff of the gene of HPV antigens.

Further, the invention provides the vaccine for HPV antigens with improved immunization program, wherein subtracting Vaccine dose scheme and the amount of antigen dose are lacked.

In addition, the invention provides the protein containing HPV antigens and the immunogenic composition of appropriate adjuvants.

Brief description

Fig. 1 describes the expression vector collection of illustrative plates pPICZ α containing HPV 16L1 genes.

Fig. 2 describes the L1 of HPV 16 and analyzed during the different production phases.

Fig. 3 describes the homogeneity analysis to HPV 16L1 by western immunoblot methods.

Fig. 4 describes by dynamic light scattering method that (VLP's is average straight to the L1 VLP of HPV 16 size distribution analysis Footpath：238.9nm).

Fig. 5 describes the final VLP obtained through negative staining method by electron microscopy and formed.

Fig. 6 describes the antibody response after the single immunization four weeks by HPV16 L1 antigens.

Fig. 7 describes the antibody response after the single immunization four weeks by the L1 antigens of HPV 18.

Fig. 8 describes the antibody response after the single immunization four weeks by the L1 antigens of HPV 11.

Fig. 9 describes the antibody response after the single immunization four weeks by the L1 antigens of HPV 6.

Figure 10 describes the HPV vaccines with the present invention measured by ELISA and carries out spirit with the reference vaccine being compared The antibody titer for the L1 antigens of HPV 16 obtained after long class animal immune.

Figure 11 describes the HPV vaccines with the present invention measured by ELISA and carries out spirit with the reference vaccine being compared The antibody titer for the L1 antigens of HPV 18 obtained after long class animal immune.

Figure 12 describes by dynamic light scattering method that (VLP's is average straight to the L1 VLP of HPV 18 size distribution analysis Footpath：388.4nm).

Figure 13 describes by dynamic light scattering method that (VLP's is average straight to the L1 VLP of HPV 6 size distribution analysis Footpath：365nm).

Figure 14 describes by dynamic light scattering method that (VLP's is average straight to the L1 VLP of HPV 11 size distribution analysis Footpath：307.9nm).

Detailed description of the invention

In one embodiment, the invention provides the un-mixing bases of the HPV of coding various serotype different proteins Cause, wherein the gene optimizes according to host cell codon.

In another embodiment, HPV different albumen include Major capsid protein L1, secondary capsid protein L2 and morning Stage antigens E6 and E7.

In preferred embodiments, the invention provides coding various serotype L1 albumen (such as L1 of HPV 16, The L1 of HPV 18 L1, the HPV 6 and L1 of HPV 11) isolated genes.

In another embodiment, the invention provides be used as the different HPV antigens of the coding being incorporated into host cell Codon optimised genes result and obtain have improve immunology quality virus-like particle.Such VLP deliverings Enhanced immune response is to prevent the HPV infection of various serotype.VLP with improved immunology quality, which helps to reduce, to be helped Use of the agent in vaccine preparation.

In one embodiment, the invention provides the place of the genetic transformation of the different proteins with the coding HPV Chief cell.According to the present invention, host cell can be referred to as expression system, wherein the gene converted with suitable carrier will table Reach.

In another embodiment, the invention provides the HPV of the coding various serotype with high copy number not With the host cell of the gene of protein.It causes the higher expression of the HPV antigens of different serotypes.

In a preferred embodiment, it is yeast cells according to the host cell of the present invention, preferably Pasteur is finished red Yeast.

In a further preferred embodiment, Pichia Pastoris strain X-33, GS115, KM71, SMD1168 etc. It may be used as expression system.

In one embodiment, the invention provides the base of the different proteins of the HPV containing coding various serotype The carrier of cause.

In preferred embodiments, pPICZ, pPIC6, pGAPZ, pAO815 or other similar bearers can be used as the present invention In carrier.These carriers are commercially available.

In a preferred embodiment, the invention provides the carrier with the genetic transformation for encoding different HPV albumen, The carrier can be selected from the carrier that accession number is MTCC 5969, MTCC 5970, MTCC 5971 and MTCC 5972.These are carried Body is deposited in microorganism type culture on November 17th, 2014 according to budapest treaty by applicant of the present invention and protected Hide and gene library (Microbial Type Culture Collection＆Gene Bank), microbial technique research institute, portion Door 39-A, Chandigarh -160036, India.The preservation carrier has the gene developed according to the present invention.MTCC 5969、 MTCC 5970, MTCC 5971 and MTCC 5972 refer to pPICzHPV 6L1, pPICzHPV 11L1, pPICzHPV 16L1 respectively With pPICzHPV 18L1.

In another embodiment, the invention provides be used as the different HPV antigens of the coding being incorporated into host cell Codon optimised genes result and the virus-like particle with improved quaternary structure that obtains.Such VLP has about 80 to 100nm high diameter, and VLP average diameter 50 between 80nm.In preferred embodiments, according to this hair Bright VLP is 50 to 500nm, preferably 50 to 400nm, more preferably 100 to 400nm.

In a preferred embodiment, the invention provides contain the immune of the present invention for a variety of HPV antigens The vaccine of Immunogenic Compositions.These vaccines can be applied with conventional route and dosage.

In one embodiment, the invention provides the method for preparing human papilloma vaccine, it comprises the following steps：

A. the gene of composite coding HPV major capsid protein,

B. the expression vector of the gene of coding HPV major capsid protein is built,

C. selection has the clone of the transformed gene of the human papilloma virus toxalbumin of high copy number,

D. the expression analysis of the transformed gene of the human papilloma virus toxalbumin is carried out,

E. the protein of the gene code by the human papilloma virus toxalbumin is purified,

F. the VLP of human papilloma virus toxalbumin batch solution is prepared,

G. the protein in host cell is characterized,

H. the vaccine containing the human papilloma virus toxalbumin is prepared.

Here, being the L1 albumen of various serotype, such as HPV 16 L1, HPV according to the major capsid protein of the present invention The 18 6 L1 and L1 of HPV 11 of L1, HPV.It is yeast cells according to the host cell of the present invention, preferred Pichia pastoris, more preferably Pichia pastoris phaff.

In another embodiment, it is column chromatography, aseptics filtration according to the purification process of the present invention, is percolated or its is suitable Combination.

In one embodiment, the invention provides the decomposition of optimization/restructuring condition with by forming more preferable level Four Structure forms improved VLP, causes higher immunogenicity in terms of HPV different serotypes.Will be from refined chromatographic step The VLP of reception passes through suitable pre-prepared buffer solution to obtain the improvement VLP with more preferable quaternary structure.According to the excellent of the present invention It is phosphate buffer to select pre-prepared buffer solution.

Pre-prepared buffer solution can be defined as maintaining the buffer solution of its structure for providing stability for VLP, and it is used for It is used for further formulation development together with different adjuvants and combinations thereof.

This pre-prepared buffer solution can also include suitable reducing agent (DTT, beta -mercaptoethanol, Tween 80 etc.), salt (NaCl or KCl), amino acid and acid or ealkaline buffer.

In a further embodiment, the invention provides have significantly higher immunogenicity for HPV Vaccine.Protective immune response for different HPV serotypes is triggered according to the vaccine of the present invention.

In one embodiment, the invention provides the vaccine for HPV antigens, it has improved immunity inoculation side Case, wherein reducing vaccine dose scheme.

In another embodiment, the invention provides the epidemic disease with the amount of antigen substantially reduced for HPV antigens Seedling.This helps to reduce the preparation cost of vaccine so that the business level that may be implemented in developing country is used.

In one embodiment, the invention provides the immunogenicity group containing HPV antigen proteins and appropriate adjuvants Compound.

Aluminium salt, single Monophosphoryl lipid (Mono Phosphoryl Lipid, MPL) analog such as GLA (pyrroles can be used Mutter glucityl lipid adjuvant, glucopyranosyl lipid adjuvant), monatide, cytokine induction agent, be based on Adjuvant, lipophilic adjuvants of squalene etc..

In another embodiment, the invention provides include the immunogene with pharmaceutically available support or excipient The pharmaceutical composition of property composition.

Embodiment

It is a variety of of HPV 16, HPV 18, HPV 6 and HPV 11 that following non-limiting example, which is described to coded representation, The codon optimization of the gene of the HPV of serotype L1 albumen.It should be appreciated that other that can prepare with not synantigen are immunized Immunogenic Compositions, and this immunogenic composition is in the limit of power of those skilled in the art, and it is also included within this In the range of invention.

Embodiment 1：The synthesis of the L1 of HPV 16 codon optimised genes

Collect can Genebank obtain the L1 antigens of HPV 16 nucleotide sequence.To from Genebank collect it is every The amino acid sequence that individual nucleotide sequence is obtained is compared.Afterwards, the L1 protein amino acid sequences of HPV 16 are selected as most Representative consensus sequence.Nucleotide sequence is determined by selected consensus amino acid sequences, with further thin according to host Born of the same parents carry out codon optimization.It is SEQ ID NO.1 by the sequence definition.

SEQ ID NO.1：The nucleotide sequence (Genebank gb | GQ423063.1 |) of the L1 antigens of HPV 16

1 ATGTCTTTGT GGTTGCCATC TGAAGCTACT GTTTACTTGC CACCAGTTCC AGTTTCTAAG

61 GTTGTTTCTA CTGATGAATA CGTTGCTAGA ACTAACATTT ACTACCATGC TGGTACTTCT

121 AGATTGTTGG CTGTTGGTCA CCCATACTTT CCAATTAAGA AGCCAAACAA CAACAAGATT

181 TTGGTTCCAA AGGTTTCTGG TTTGCAATAC AGAGTTTTTA GAATCCATTT GCCAGATCCA

241 AACAAGTTTG GTTTTCCAGA TACTTCTTTT TACAACCCAG ATACTCAAAG ATTGGTTTGG

301 GCTTGTGTTG GTGTTGAAGT TGGTAGAGGT CAACCATTGG GTGTTGGTAT TTCTGGTCAC

361 CCATTGTTGA ACAAGTTGGA TGATACTGAA AACGCTTCTG CTTACGCTGC TAACGCTGGT

421 GTTGATAACA GAGAATGTAT TTCTATGGAT TACAAGCAAA CTCAATTGTG TTTGATTGGT

481 TGTAAGCCAC CAATTGGTGA ACATTGGGGT AAGGGTTCTC CATGTACTAA CGTTGCTGTT

541 AACCCAGGTG ATTGTCCACC ATTGGAATTG ATTAACACTG TTATTCAAGA TGGTGATATG

601 GTTGATACTG GTTTTGGTGC TATGGATTTT ACTACTTTGC AAGCTAACAA GTCTGAAGTT

661 CCATTGGATA TTTGTACTTC TATTTGTAAG TACCCAGATT ACATTAAGAT GGTTTCTGAA

721 CCATACGGTG ATTCTTTGTT TTTTTACTTG AGAAGAGAAC AAATGTTTGT TAGACACTTG

781 TTTAACAGAG CTGGTGCTGT TGGTGAAAAC GTTCCAGATG ATTTGTACAT TAAGGGTTCT

841 GGTTCTACTG CTAACTTGGC TTCTTCTAAC TACTTTCCAA CTCCATCTGG TTCTATGGTT

901 ACTTCTGATG CTCAAATTTT TAACAAGCCA TACTGGTTGC AAAGAGCCCA AGGTCATAAC

961 AACGGTATTT GTTGGGGTAA CCAATTGTTT GTTACTGTTG TTGATACTAC TAGATCTACT

1021 AACATGTCTT TGTGTGCTGC TATTTCTACT TCTGAAACTA CTTACAAGAA CACTAACTTT

1081 AAGGAATACT TGAGACACGG TGAAGAATAC GATTTGCAAT TTATTTTTCA ATTGTGTAAG

1141 ATTACTTTGA CTGCTGATGT TATGACTTAC ATTCATTCTA TGAACTCTAC TATTTTGGAA

1201 GATTGGAACT TTGGTTTGCA ACCACCACCA GGTGGTACTT TGGAAGATAC TTACAGATTT

1261 GTTACTTCTC AAGCTATTGC TTGTCAAAAG CACACTCCAC CAGCTCCAAA GGAAGATCCA

1321 TTGAAGAAGT ACACTTTTTG GGAAGTTAAC TTGAAGGAAA AGTTTTCTGC TGATTTGGAT

1381 CAATTTCCAT TGGGTAGAAA GTTTTTGTTG CAAGCTGGTT TGAAGGCTAA GCCAAAGTTT

1441 ACTTTGGGTA AGAGAAAGGC TACTCCAACT ACTTCTTCTA CTTCTACTAC TGCTAAGAGA

1501 AAGAAGAGAA AGTTGTAATA G

Here, in the present invention, host cell is used as using pichia pastoris phaff.Other yeast biomass (are preferably finished Multiple kinds of red saccharomyces) it is also used as host cell for codon optimization method.The nucleotides of the L1 albumen of HPV 16 Sequence definition is SEQ ID NO.1, and it is further embellished as described below.

61-300,361-840 and/or 961- in the L1 of HPV 16 provided in SEQ ID NO.1 nucleotide sequence Modified at 1520 positions.These modifications are carried out in this way：So that after the codon optimization of nucleotide sequence The amino acid sequence of acquisition will be homologous with the primary structure 100% of the L1 albumen of HPV 16.Then, the sequence of this codon optimization In terms of being listed in size and immunogenicity more preferable quaternary structure is provided for VLP.Repeated in the nucleotide sequence after modifying, At the position, inventor has discovered that a kind of codon optimised sequence of new change of the L1 antigens of HPV 16, its It is defined herein as SEQ ID NO.2.

SEQ ID NO.2：HPV 16 The nucleotide sequence of L1 antigens

1 ATGTCTTTGTGGTTGCCATCTGAAGCTACTGTTTACTTGCCACCA

46 GTTCCAGTTTCTAAAGTTGTTTCCACTGACGAATACGTTGCTAGA

91 ACTAACATCTACTACCACGCTGGTACTTCTAGATTGTTGGCTGTT

136 GGTCATCCATACTTCCCAATTAAGAAGCCAAACAACAACAAGATT

181 TTGGTTCCAAAGGTTTCCGGATTGCAATACAGAGTTTTCAGAATC

226 CATTTGCCAGATCCAAACAAGTTTGGTTTCCCAGATACTTCTTTC

271 TACAACCCAGACACTCAAAGACTTGTTTGGGCTTGTGTTGGTGTT

316 GAAGTTGGTAGAGGTCAACCATTGGGTGTTGGTATTTCTGGTCAC

361 CCATTGTTGAACAAGTTGGACGATACTGAAAACGCTTCTGCTTAC

406 GCTGCTAACGCTGGTGTTGATAACAGAGAATGTATTTCTATGGAC

451 TACAAGCAAACTCAATTGTGTTTGATTGGTTGTAAGCCACCAATT

496 GGTGAACATTGGGGAAAGGGTTCTCCATGTACTAATGTTGCTGTT

541 AACCCTGGTGATTGTCCACCATTGGAATTGATTAACACTGTTATT

586 CAAGACGGTGATATGGTTGATACTGGTTTCGGTGCTATGGATTTC

631 ACTACTTTGCAAGCTAACAAGTCTGAAGTTCCATTGGACATTTGT

676 ACTTCCATCTGTAAGTACCCAGACTACATTAAGATGGTTTCTGAA

721 CCATACGGTGATTCTTTGTTCTTCTACTTGAGAAGAGAACAAATG

766 TTTGTTAGACACTTGTTCAACAGAGCTGGTGCTGTTGGTGAAAAC

811 GTTCCAGATGACTTGTACATTAAGGGTTCTGGTTCTACTGCTAAC

856 TTGGCTTCTTCTAACTACTTTCCAACTCCATCTGGTTCTATGGTT

901 ACTTCTGACGCTCAAATTTTCAACAAGCCATACTGGTTGCAAAGA

946 GCACAAGGTCATAACAACGGTATTTGTTGGGGTAACCAATTGTTC

991 GTTACTGTTGTTGACACTACTAGATCCACTAACATGTCCTTGTGT

1036 GCTGCTATTTCTACTTCTGAAACTACTTACAAGAACACTAACTTC

1081 AAAGAGTACTTGAGACACGGAGAAGAATACGACTTGCAATTCATT

1126 TTCCAATTGTGTAAGATTACTTTGACTGCTGACGTTATGACTTAC

1171 ATTCACTCTATGAACTCTACTATTTTGGAAGATTGGAACTTCGGA

1216 TTGCAACCACCACCAGGTGGTACTTTGGAAGATACTTACAGATTC

1261 GTTACTTCTCAAGCTATTGCTTGTCAAAAGCATACTCCACCTGCT

1306 CCAAAAGAAGATCCATTGAAGAAGTACACTTTCTGGGAAGTTAAC

1351 TTGAAAGAAAAGTTCTCTGCTGATTTGGATCAATTCCCATTGGGT

1396 AGAAAGTTTTTGTTGCAAGCTGGATTGAAGGCTAAACCAAAGTTC

1441 ACTTTGGGAAAGAGAAAGGCTACTCCAACTACTTCTTCTACTTCT

1486 ACTACTGCTAAGAGAAAGAAGAGAAAATTGTAA 1518

In an identical manner, generate for HPV 18 L1, HPV 6 the L1 and L1 of HPV 11 codon optimised sequence. HPV 18 L1, HPV 6 the L1 and L1 of HPV 11 codon optimised sequence be given SEQ ID NO.3,4 and 5 respectively.

SEQ ID NO.3：HPV The nucleotide sequence of 18 L1 antigens

1 ATGGCTCTTTGGAGACCATCCGACAACACTGTTTACTTGCCACCA

46 CCATCCGTTGCTAGAGTTGTTAACACTGACGACTACGTTACTAGA

91 ACTTCCATCTTCTACCACGCTGGTTCTTCCAGATTGTTGACTGTT

136 GGTAACCCATACTTCAGAGTTCCAGCTGGAGGTGGTAACAAGCAA

181 GACATCCCAAAGGTTTCCGCTTACCAGTACAGAGTTTTCAGAGTT

226 CAGTTGCCAGACCCAAACAAGTTTGGATTGCCAGACAATTCCATC

271 TACAACCCAGAGACTCAGAGACTTGTTTGGGCTTGTGCTGGTGTT

316 GAAATCGGTAGAGGACAGCCATTGGGTGTTGGTTTGTCTGGTCAC

361 CCATTCTACAACAAGTTGGACGACACTGAATCTTCTCACGCTGCT

406 ACTTCTAACGTTTCCGAGGATGTTAGAGACAACGTTTCCGTTGAC

451 TACAAGCAGACTCAGTTGTGTATCTTGGGTTGTGCTCCAGCTATT

496 GGTGAACATTGGGCTAAGGGTACTGCTTGTAAGTCCAGACCATTG

541 TCTCAGGGAGATTGTCCACCATTGGAGTTGAAGAACACTGTTTTG

586 GAGGACGGTGATATGGTTGATACTGGTTACGGTGCTATGGACTTC

631 TCTACTTTGCAGGACACTAAGTGTGAAGTTCCATTGGACATCTGT

676 CAGTCCATCTGTAAGTACCCAGACTACTTGCAAATGTCCGCTGAT

721 CCATACGGTGACTCTATGTTCTTCTGTTTGAGAAGAGAGCAGTTG

766 TTCGCTAGACACTTCTGGAACAGAGCTGGTACTATGGGTGACACT

811 GTTCCACAATCCTTGTACATCAAGGGTACTGGAATGAGAGCTTCT

856 CCTGGTTCTTGTGTTTACTCTCCATCTCCATCCGGTTCCATTGTT

901 ACTTCCGACTCCCAGTTGTTCAACAAGCCATACTGGTTGCATAAG

946 GCTCAAGGTCACAACAACGGTATTTGTTGGCACAACCAGTTGTTC

991 GTTACTGTTGTTGACACTACTAGATCCACTAACTTGACTATCTGT

1036 GCTTCCACTCAATCTCCAGTTCCAGGACAATACGACGCTACTAAG

1081 TTCAAGCAGTACTCCAGACACGTTGAAGAGTACGACTTGCAGTTC

1126 ATCTTCCAGTTGTGTACTATCACTTTGACTGCTGATGTTATGTCC

1171 TACATCCACTCTATGAACTCCTCCATTTTGGAGGATTGGAACTTC

1216 GGTGTTCCACCACCACCAACTACTTCATTGGTTGACACTTACAGA

1261 TTCGTTCAGTCCGTTGCTATCACTTGTCAAAAGGACGCTGCTCCA

1306 GCTGAAAACAAGGACCCATACGACAAGTTGAAGTTCTGGAACGTT

1351 GACTTGAAAGAGAAGTTCTCCTTGGACTTGGACCAATACCCATTG

1396 GGTAGAAAGTTTTTGGTTCAGGCTGGATTGAGAAGAAAGCCAACT

1441 ATCGGTCCAAGAAAGAGATCAGCTCCATCCGCTACTACTTCATCC

1486 AAGCCAGCTAAGAGAGTTAGAGTTAGAGCTAGAAAGTAG 1524

SEQ ID NO.4：The nucleotide sequence of the L1 antigens of HPV 6

1 ATGTGGAGACCATCCGACTCCACTGTTTATGTTCCACCACCAAAC

46 CCAGTTTCCAAGGTTGTTGCTACTGACGCTTACGTTACTAGAACT

91 AATATCTTCTACCACGCTTCCTCATCCAGATTGTTGGCTGTTGGT

136 CACCCATACTTCTCCATCAAGAGAGCTAACAAGACTGTTGTTCCA

181 AAGGTTTCCGGTTACCAGTACAGAGTTTTTAAGGTTGTTTTGCCA

226 GACCCAAACAAGTTCGCTTTGCCAGACTCTTCCTTGTTCGACCCA

271 ACTACTCAGAGATTGGTTTGGGCTTGTACTGGTTTGGAGGTTGGT

316 AGAGGTCAGCCATTGGGTGTTGGTGTTTCTGGTCACCCATTCTTG

361 AACAAGTACGACGACGTTGAGAACTCTGGTTCTGGTGGTAACCCA

406 GGTCAGGACAACAGAGTTAACGTTGGTATGGACTACAAGCAGACT

451 CAGTTGTGTATGGTTGGTTGTGCTCCACCATTGGGTGAACATTGG

496 GGTAAGGGTAAGCAGTGTACAAACACTCCAGTTCAGGCTGGTGAC

541 TGTCCACCTTTGGAGTTGATCACTTCCGTTATTCAGGACGGTGAC

586 ATGGTTGACACTGGTTTTGGTGCTATGAACTTCGCTGACTTGCAG

631 ACTAACAAGTCCGACGTTCCAATCGACATCTGTGGTACTACTTGT

676 AAGTACCCAGACTACTTGCAGATGGCTGCTGATCCATACGGTGAC

721 AGATTGTTCTTCTTCTTGAGAAAAGAACAGATGTTCGCTAGACAC

766 TTCTTCAACAGAGCTGGTGAAGTTGGTGAGCCAGTTCCAGACACT

811 TTGATCATTAAGGGTTCCGGTAACAGAACTTCCGTTGGTTCCTCC

856 ATCTACGTTAACACTCCATCCGGTTCCTTGGTTTCTTCTGAGGCT

901 CAGTTGTTCAACAAGCCATACTGGTTGCAGAAGGCTCAGGGTCAC

946 AACAACGGTATCTGTTGGGGTAACCAGTTGTTCGTTACTGTTGTT

991 GACACTACTAGATCCACTAATATGACTTTGTGTGCTTCCGTTACT

1036 ACTTCCTCCACTTACACTAACTCCGACTACAAAGAGTACATGAGA

1081 CACGTTGAAGAGTACGACTTGCAGTTCATCTTCCAGTTGTGTTCC

1126 ATCACTTTGTCCGCTGAGGTTATGGCTTACATCCACACTATGAAC

1171 CCATCCGTTTTGGAGGACTGGAACTTCGGTTTGTCTCCACCACCT

1216 AACGGTACTTTGGAGGACACTTACAGATACGTTCAGTCCCAGGCT

1261 ATCACTTGTCAGAAGCCAACTCCAGAGAAAGAGAAGCCAGACCCT

1306 TACAAGAACTTGTCCTTCTGGGAGGTTAACTTGAAAGAGAAGTTC

1351 TCCTCAGAGTTGGACCAGTACCCATTGGGTAGAAAGTTCTTGTTG

1396 CAGTCCGGTTACAGAGGTAGATCCTCCATCAGAACTGGTGTTAAG

1441 AGACCAGCTGTTTCCAAGGCTTCTGCTGCTCCAAAGAGAAAGAGA

1486 GCTAAGACTAAGAGATAG 1503

SEQ ID NO.5：The nucleotide sequence of the L1 antigens of HPV 11

1 ATGTGGAGACCATCCGACTCCACTGTTTATGTTCCACCACCAAAC

46 CCAGTTTCCAAGGTTGTTGCTACTGACGCTTACGTTAAGAGAACT

91 AATATCTTCTACCACGCTTCCTCATCCAGATTGTTGGCTGTTGGT

136 CACCCTTACTACTCCATCAAGAAGGTTAACAAGACTGTTGTTCCA

181 AAGGTTTCCGGTTACCAGTACAGAGTTTTTAAGGTTGTTTTGCCA

226 GACCCAAACAAGTTCGCTTTGCCAGACTCTTCCTTGTTCGACCCA

271 ACTACTCAGAGATTGGTTTGGGCTTGTACTGGTTTGGAGGTTGGT

316 AGAGGTCAGCCATTGGGTGTTGGTGTTTCTGGTCACCCTTTGTTG

361 AACAAGTACGACGACGTTGAGAACTCCGGTGGTTATGGTGGTAAC

406 CCAGGTCAAGACAACAGAGTTAACGTTGGTATGGACTACAAGCAC

451 ACTCAGTTGTGTATGGTTGGTTGTGCTCCACCATTGGGTGAACAT

496 TGGGGTAAGGGTACTCAGTGTTCCAACACTTCCGTTCAGAACGGT

541 GACTGTCCACCTTTGGAGTTGATCACTTCCGTTATTCAGGACGGT

586 GACATGGTTGACACTGGTTTTGGTGCTATGAACTTCGCTGACTTG

631 CAGACTAACAAGTCCGACGTTCCATTGGACATCTGTGGTACTGTT

676 TGTAAATACCCAGACTACTTGCAGATGGCTGCTGATCCATACGGT

721 GACAGATTGTTCTTCTACTTGAGAAAAGAACAGATGTTCGCTAGA

766 CACTTCTTCAACAGAGCTGGTACTGTTGGTGAGCCAGTTCCAGAT

811 GACTTGTTGGTTAAGGGTGGTAACAACAGATCCTCCGTTGCTTCC

856 TCCATCTACGTTCATACTCCATCCGGTTCCTTGGTTTCTTCTGAG

901 GCTCAGTTGTTCAACAAGCCATACTGGTTGCAGAAGGCTCAGGGT

946 CACAACAACGGTATTTGTTGGGGTAACCACTTGTTCGTTACTGTT

991 GTTGACACTACTAGATCCACTAATATGACTTTGTGTGCTTCCGTT

1036 TCCAAGTCCGCTACTTACACTAACTCCGACTACAAAGAGTACATG

1081 AGACACGTTGAAGAGTTCGACTTGCAGTTCATCTTCCAGTTGTGT

1126 TCCATCACTTTGTCCGCTGAGGTTATGGCTTACATCCACACTATG

1171 AACCCATCCGTTTTGGAGGACTGGAACTTCGGTTTGTCTCCACCA

1216 CCTAACGGTACTTTGGAGGACACTTACAGATACGTTCAGTCCCAG

1261 GCTATCACTTGTCAGAAGCCAACTCCAGAGAAAGAGAAGCAGGAC

1306 CCATACAAGGACATGTCTTTCTGGGAGGTTAACTTGAAAGAGAAG

1351 TTCTCCTCAGAGTTGGACCAGTTCCCATTGGGTAGAAAGTTCTTG

1396 TTGCAGTCCGGTTACAGAGGTAGAACTTCCGCTAGAACTGGTATC

1441 AAAAGACCAGCTGTTTCCAAGCCATCCACTGCTCCAAAGAGAAAA

1486 AGAACTAAGACTAAGAAGTAG 1506

Embodiment 2：The structure of the L1 expression vectors of HPV 16

Expression vector pPICZ α are used for the expression of HPV16L1 genes.PPIC6, pGAPZ, pAO815 or other similar loads Body can also be used for expression HPV 16 L1.PPICZ α are for being expressed in pichia pastoris phaff and secreting recombinant protein 3.6kb carrier.It has the characteristics that：

942bp fragments containing AOX1 promoters, it allows methanol induction, the mesh in high level expression Pichia pastoris Gene.Plasmid integration is targetted to AOX1 locus.

AOX1 tanscription terminations (transcription termination, TT) region allows from AOX1 genes (about Native transcription 260bp) is terminated and polyadenylation signal, its allow effective 3 ' mRNA process (including polyadenylation) with Improve mRNA stability.

Blasticidin resistance gene allows to select transformant in Escherichia coli and Pichia pastoris.

EM7 promoters, it drives the constitutive expression of blasticidin resistance gene in Escherichia coli.

TEF1 promoters from saccharomyces cerevisiae, it drives the expression of blasticidin resistance gene in Pichia pastoris.

PUC initiation sites allow duplication and holding of the plasmid in Escherichia coli.

Built by the multiple cloning sites of the BstBI/NotI fragment insertion vector pPICZ á by HPV16L1 is encoded HPV16L1 expression vectors.Gained expression vector is named as pPICZ-HPV16L1.Its physical map is as shown in Figure 1.For building Method substantially with Sambrook as in Russell (2001).

In an identical manner, construct containing HPV 18 L1, HPV 6 the L1 and L1 of HPV 11 expression vector.

Embodiment 3：The clone of HPV 16 L1 transformed gene of the selection with high copy number

A) preparation of competent cell

Make Pichia Pastoris strain in yeast extract peptone dextrose culture-medium (yeast extract Peptone dextrose medium, YPD) in grow and stay overnight at 30 DEG C.In 500ml fresh cultures in 2 liters of flasks It is inoculated with 0.1-0.5ml overnight cultures.Regrow overnight, until OD600=1.3-1.5.Cell is centrifuged and by sediment With ice-cold sterilized water resuspension once or twice.Cell is centrifuged and sediment is resuspended in the ice-cold 1M D-sorbites of 20ml In.Cell is centrifuged and sediment is resuspended in the ice-cold 1M D-sorbites of 1ml, final volume is about 1.5ml.Keep cell On ice, simultaneously the same day uses.

B) convert

Cells of the 80 μ l from above-mentioned steps and 5-10 μ g the pPICZ α DNA (in 5-10 μ l sterilized waters) linearized are mixed Close, and be transferred into ice-cold 0.2cm electroporations cup.Cup with cell is incubated 5 minutes on ice.By competence ferment The aliquot of mother cell is thawed on ice, and the addition 600ng cyclic plasmids DNA into each aliquot.Suspension is turned In the electroporation cup for moving on to precooling.Electricity is carried out in 1.7kV in BIORAD GenePulser II, under 25 μ F, 200Ohm to wear Hole.1M D-sorbites ice-cold 1ml are added in cup immediately.Cup content is transferred in sterile 15ml test tubes.By test tube It is incubated 2 hours, does not shake at 30 DEG C.200 μ l pipe contents are dispersed in each list containing 150 μ g/ml concentration bleomycins On the YPD flat boards of only, mark.Flat board is incubated 3 days at 30 DEG C until forming bacterium colony.Select 10-20 bacterium colony, and containing (single bacterium colony line) is purified on the fresh YPD flat boards of the bleomycin of debita spissitudo.

The initial option that copy number based on the gene being incorporated into Pichia pastoris genome is cloned.This is with clone's Expression is related.The semidefinite of corresponding specific gene (HPV16L1, HPV18L1, HPV6L1 or HPV11L1) is directed to using specificity Amount PCR is screened.

Optimize the different parameters that quantitative bacterium colony PCR is determined using different primer sets.Further test these primers with The cross reactivity of Pichia pastoris genome and its sensitivity to selecting minimum copy number specific gene.

After quantitative bacterium colony PCR, the gene copy number of HPV16L1 clones is analyzed using RT PCR, and selects that there is highest The clone of gene copy number.

Embodiment 4：The expression analysis of HPV16 L1 transformed genes

The clone selected from RT PCR results is inoculated into BGY culture mediums, and divided after to culture methanol induction Analyse their expression.Culture is cracked and the transformant storehouse supernatant as obtained by Western blot analysis.Based on The final clone of intensity selection for the band expressed on western traces.Again by SDS PAGE and western engram analysis this A little clones, to select the optimal production of HPV albumen to clone.SDS PAGE gels are as shown in Figure 2 after coomassie brilliant blue staining.It is logical Cross identification of the western traces to HPV serotypes 16L1 as shown in Figure 3.

Embodiment 5：The purifying of the L1 albumen of HPV 16

The purge process of the L1 albumen of HPV 16 is as follows：

With a kind of representative batch of material illustrate every kind of HPV albumen purifying and removal process in each unit for being related to Operating procedure.

A) cracking of scrubbed cell precipitation

Batch is harvested at the end of the production phase.About 12L nutrient solution is collected from each fermentation tank.Pass through centrifugation point first From cell, to separate the culture cell containing protein from used culture medium.The precipitation of washing is dissolved in cracking buffering In liquid.Use high pressure homogenisers cell lysis.

B) clarify

After cell cracking, the supernatant containing product is separated with cell fragment by centrifuging.Use 0.45 μm of filter Further clarify supernatant.

C) step chromatogram is captured

The lysate of clarification is loaded onto on suitable resin.Albumen is carried out by improving the sodium chloride concentration in buffer solution The elution of matter.

D) purification step chromatogram

Merging fraction containing target protein is loaded onto on suitable resin.By reducing the sodium chloride in buffer solution Concentration carries out the elution of protein.

E) exchanged by being percolated into row buffering liquid

The fraction of merging is percolated by the suitable PES film filters for phosphate buffer, with molten from protein Excessive sodium chloride is removed in liquid.

F) it is sterile filtered

After diafiltration steps, the preparation of its batch solution is carried out to the protein solution of purifying.

Embodiment 6：The preparation of the L1 of HPV 16 VLP batch solution

The purifying protein obtained after above-mentioned purge process is undergone into decomposition/restructuring condition, to obtain with improved The VLP of the final stabilization of quaternary structure.Expressed VLP decomposition/restructuring is carried out in pre-prepared buffer solution.This is pre-prepared slow Fliud flushing is diluted to about 5-10 times, so as to the VLP of recombination expression.Salt such as NaCl or KCl are added to 500mM to 2M concentration In the pre-prepared buffer solution used during expressed VLP decomposition.

Decompose buffer solution and contain reducing agent and amino acid.Reassembly buffer liquid includes the salt of higher concentration and decomposes buffer solution Component.

Obtained VLP size is analyzed by dynamic light scattering method.The L1's of HPV 16 obtained after this step is homogeneous VLP has 90nm average diameter.It is described in Fig. 4.It is described in Fig. 4.The L1 of HPV 18 that obtain after this step, The L1 of HPV 6 and the L1 of HPV 11 homogeneous VLP are described in Figure 12, Figure 13 and Figure 14.

The protein solution of purifying is aseptically filtered by 0.22 micron filter and stored up as material medicine Deposit.

Embodiment 7：The sign of HPV-16 L1 capsid proteins in pichia pastoris phaff

The part N-terminal sequence of protein is degraded by Edman to be confirmed, and has observed that primary structure (tryptose Enzyme bglii).As determined and assessed by DTNB, the antigen of mass purification does not show any free mercaptan (- SH) in the structure Group.It was found that the antigen of mass purification is without aggregation any as determined by by nano particle tracer analysis.Pass through ELISA It was found that the antigen of mass purification is free of host cell proteins, and found also without DNA pollution by the method based on RT-PCR Thing.Tested and assessed by LAL, it is found that said preparation is free of endotoxin.In order to confirm VLP structural stability, electron microscopic is carried out Spectroscopy, inventor has found that these VLP are the particles of the average diameter with about 90nm.The L1 VLP of HPV 16 negative staining It is shown in Fig. 5.

All technologies referred in this embodiment are all widely available in this area.

Material medicine is stored at -80 DEG C in pyrogen-free container.

Embodiment 8：The preparation of the vaccine of the L1 containing HPV 16

By on the Antigen adsorption of purifying to the adjuvant based on aluminium, and sterilely it is filled into bottle.By aluminum phosphate with 0.8- 20mg/0.5ml phosphate buffered saline (PBS)s, which are added in 160 μ g HPV 16L1 albumen, is used for final preparation.Adjuvant based on aluminium It can use the salt of mineral salt adjuvant such as calcium, iron and zirconium, complete Freund's adjuvant (Complete Freund ' s adjuvant, CFA), Adjuvant emulsion such as incomplete Freund's adjuvant (Incomplete Freund ' s adjuvant, IFA), montanide, MF 59 And adjuvant 65, the adjuvant of bacterial derivation or its combination are replaced.In an identical manner, technical staff can be prepared containing other blood The vaccine of the L1 albumen of clear type (such as 18,6,11) and combinations thereof.

Embodiment 9：The measure of the immunogenicity of mice immunisation and expression product

Method：

Based on British Pharmacopoeia 2012, there is adjuvant, without adjuvant in the case of to a representative batch of test sample and Reference product carries out the research.Using the experimental design referred in table 1, come using Balb/c mouse (6-8 week old female mice) Analyze its internal effect.

Table 1：The experimental design that Mouse immunogenicity for HPV vaccines is studied

0.5ml reference product/the test vaccines diluted are subcutaneously injected into every mouse to (each dilution group is 10 small Mouse).Apply 0.5ml thinner for vaccine in an identical manner in 10 mouse.These are PBS control and animal are maintained into 28 My god.At the 29th day, blood is collected from every mouse by eye venipuncture, and stand 1 hour at room temperature to solidify.Will pipe Centrifuged 10 minutes with 4,000rpm at 4 DEG C, and by serum collection into the microcentrifugal tube individually marked.

Using the following ELISA kit from U.S. ADI (Alpha Diagnostic International) once Property all blood serum samples of test.

The anti-HPV16L1ELISA kits (#550-316-PMG) of mouse

The anti-HPV18L1ELISA kits (#550-318-PMG) of mouse

The anti-HPV6L1ELISA kits (#550-306-PMG) of mouse

The anti-HPV11L1ELISA kits (#550-311-PMG) of mouse

The VLP preparations and normative reference of the vaccine and not combination adjuvant based on VLP according to the present invention are compared.Pass through ELISA determines the result obtained and is shown in Fig. 6,7,8 and 9 and table 2.

Table 2：For the ELISA antibody responses of the HPV antigens of various serotype, absorbance unit/ml at

Serum number	Group (adjuvant)	HPV 16 L1	HPV 18 L1	HPV 11 L1	HPV 6L1
						1	Only HPV antigens	0.36	0.19	0.66	0.30
2	Jia Dexi	0.40	0.29	0.70	0.35
						3	Aluminium	1.39	0.45	2.09	0.70
4	PBS	0.19	0.045	0.23	0.151

Embodiment 10：To in rats be directed to Human-papilloma Vaccine's generation antibody endpoint identification and measure

Method：

First by L1 the or HPV 18L1 proteopexies of HPV 16 on the hole of microtiter plate.Plate is entered with skimmed milk power One step is closed to avoid non-specific interaction.By the serum from the rat with anti-HPV16L1 and HPV18L1 antibody Sample dilutes in sample dilution buffer, to realize each albumen (L1 of 16 L1/HPV of HPV 18) with being coated with respective plate Corresponding antigens specific binding.The anti-rat Ab for adding HRP marks is used as secondary antibody.Immune response causes anti-rat Ab Compound is formed between specific antibody (the L1/HPV 18L1 of HPV 16).Removed in each washing step uncombined anti- Answer thing.Then react substrate OPD.The amount and blood serum sample of the substrate read on microtiter plate reader through chromogenic reaction Present in the concentration of each antibody be directly proportional.

Experimental design

The group of every group of 10 males and 10 female rats is handled with HPV (rDNA) bacterin preparation, every two weeks Once with three dosage levels to Wistar rats through intramuscular injection：0.25mL/ animals (low), 0.5ml/ animals (in) and 1.0ml/ animals (height), continue 3 months.There is separate control group in our current research, it only receives comfort as supporting agent control group Agent.In addition, recovery group is maintained into high dose level while supporting agent is compareed in the time of one month after treatment, to see The invertibity, continuation or delay for examining adverse reaction occur.Before treatment, handle after between Later convalescent collect blood sample with Detect immunogenicity, then by enzyme linked immunosorbent assay (ELISA) (Enzyme Linked Immuno-Sorbent Assay, ELISA), for supporting agent control (1.0ml placebos/rat), low dosage (0.25ml vaccines/rat), middle dosage (0.5ml epidemic diseases Seedling/rat) and high dose (1.0ml vaccines/rat) and the anti-HPV of before processing group measure.

Table 3：Handle details

Titer determination

By by antigen concentration be set to 50ng/ holes and rest on 2-8 DEG C of night incubation being coated with for the L1 of HPV 16 or The L1 of HPV 18 different flat boards.Then, plate is statically placed in 5% lock solution (skimmed milk in PBST), and at 37 DEG C It is incubated 2 hours.Collect respectively from every group of all samples and dilute in PBST (phosphate buffered saline (PBS)-polysorbas20) buffer solution Release 50 times.Plate is washed, the every kind of samples of 50 μ l are added in predetermined hole, and is statically placed in incubation 1 hour at 37 DEG C.Plate is washed with PBST Wash, the anti-rat IgG HRP of 50 μ l are then added into each hole, and rest on incubation 60 minutes at 37 DEG C.Then use again PBST washs plate, and 50 μ l substrates are added into each hole and (are dissolved in citrate phosphate buffer and H₂O₂In OPD), and in room Plate 15 minutes are stood under temperature in the dark.Then, the 25 μ l terminate liquids (5.4ml in 100ml WFI are added into each hole H₂SO₄), and by flat board on the microplate readers of SpectraMAX 190 reading at 490nm.

As a result

Table 4：Before processing-male

Table 5：Before processing recovery-male

Table 6：It is male after processing

Table 7：It is male after recovery

Table 8：Before processing-female

Table 9：Before processing recovery-female

Table 10：After processing-female

Table 11：After recovery-female

Summarize

The result of before processing sample is shown, in both male and female rats, and its absorbance is big no better than control Mouse and be all non-reacted.By identical group of male and female rats with low dosage (0.25ml/ animals), median dose HPV (rDNA) vaccine of (0.5mV animals) and high dose (1.0ml/ animals) is handled three months.At three months At the end of reason, as a result show highly reactive to vaccine compared with high absorbance value.In male group, measured with ELISA titres Reactivity, which is, to be 3880.417 for HPV16L1 in the case of low dosage and is 522.338 for HPV18L1, at medium dose Be 6377.327 for HPV16L1 in the case of amount and be 632.235 for HPV18L1, and in the case of high dose for HPV16L1 is 25832.417 and is 1198.762 for HPV18L1；In female group, the reaction measured with ELISA titres Property, which is, to be 15567.343 for HPV16L1 in the case of low dosage and is 770.180 for HPV18L1, in median dose In the case of be 24445.245 for HPV16L1 and be 4058.034 for HPV18L1, and in the case of high dose for HPV16L1 is 26283.248 and is 4100.000 for HPV18L1.At the end of a month convalescence, blood serum sample shows Show, be according to the reactivity of ELISA titres：It is 25416.265 and for HPV18L1 for HPV16L1 in male rat For 1042.376；In female rats, it is 30410.085 for HPV16L1 and is 951.940 for HPV18L1.

Conclusion

Terminal result of study shows：HPV (rDNA) vaccine manufactured by Cadila Healthcare Ltd. is to exempt from Epidemic focus, measurable in ELISA by the antibody that is produced for low, medium and high dosage is to be in the up to L1 of HPV 16 30410.085, the highest titre for being 4100.000 in the L1 of HPV 18.

Embodiment 11：Primate (rhesus macaque) immunity inoculation and titer determination

HPV bacterin preparations are prepared in phosphaljel, it contains 20 μ g simultaneously respectively for the L1 of the HPV 6 and L1 of HPV 18 And contain 40 μ g respectively for the L1 of HPV 16 and the L1 of HPV 11.The vaccine of preparation is stored in 2-8 DEG C until using.In rhesus macaque In to every animal with 1ml vaccine immunizations (equivalent to one time human dose), applied at the 0th day by the way that single dose is intramuscular With with extra in booster shots in the 342nd day after the 21st day, the 180th day, and in reference to vaccine group and negative control group. Before experiment starts, to the progress of all non-human primates, thoroughly physiology, veterinary inspection and clinical chemistry parameters are divided Analysis.

According to following immunization program, with following vaccine with primate described in a variety of time interval immunity inoculations.

Table 12：The immunization program of primate study

The 21st, the serum that 33,46,63,126,186,193,342,372 and 433 days collect in blood sample, for Antibody titer is determined by ELISA.Blood serum sample is collected from monkey according to experimental design at a predetermined interval.Blood serum sample is entered one Step is stored in -20 DEG C to measure antibody by ELISA.

After being coated with overnight on elisa plate with 50-100ng/ holes with the L1/HPV L1 protein purifications of HPV 16, carry out ELISA.Uncombined protein is washed away with PBS Tween buffers, and it is small to add into plate the Block buffer 1 containing 1%BSA When to close non-specific sites.Blood serum sample is suitably diluted in PBS and added in hole.Washed away with PBS Tween buffers Uncombined sample, and add the anti-monkey IgG that is marked with HRPO 45 minutes.Plate is washed with lavation buffer solution again, peroxide is added Compound zymolyte.It is incubated in the dark 25 minutes.Finally, 25 μ l stop baths are added in each instrument connection.At 15 points The interior read plate at 405nm of clock.Using the different dilution factors of positive reference vaccine Serum Bank, specified with O.D. values relative to it ELISA titres, based on the end blocked to ELISA after O.D. (average value+3S.D. of the O.D. from blank and negative sample) The consideration of titre is put to draw standard curve.Pass through the ELISA antibody titer such as table 13 below measured and the institutes of 14 and Figure 10 and 11 Show.

Table 13：The anti-L1 ELISA titres of HPV 16 (in terms of the geometrical means of Log 10)

Table 14：The anti-L1 ELISA titres of HPV 18 (in terms of the geometrical means of Log 10)

As a result

Originally test vaccine prepared in accordance with the present invention provides the response suitable with reference vaccine.Afterwards, by test epidemic disease The immune response that seedling is obtained continues the longer period, and needs booster to realize similar immune response with reference to vaccine. Similarly, in order to confirm the Neutralizing antibody response in the L1 of HPV 16 and the L1 of HPV 18, we also pass through pseudo- viral neutralizing mensuration It is found that suitable immune response.It was found that for the total antibody response measured by ELISA, 433 days after vaccine inoculation In time, for the L1 of HPV 16 and the L1 of HPV 18,3 dosage altogether of our vaccine have and 4 agent with reference to vaccine The suitable total antibody response of amount.Therefore, it provides our vaccine and had compared to reference to vaccine in monkey for HPV 16 With the strong evidence of 18 L1 advantage effect.

Sequence table

<110>Cadila Healthcare Ltd.

<120>Excellent human papillomavirus antigen with superior immune characteristic and the vaccine containing it

<130> CHL-PCT0719

<140> 2905/MUM/2014

<141> 2014-09-11

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 3027

<212> DNA

<213> HPV 16 L1

<400> 1

atgtctatgt ggagaccatc cgactccact gtttatgttc caccaccaaa cccagtttcc 60

aaggttgttg ctactgacgc ttacgttaag agaactaata tcttctacca cgcttcctca 120

tccagattgt tggctgttgg tcacccttac tactccatca agaaggttaa caagactgtt 180

gttccaaagg tttccggtta ccagtacaga gtttttaagg ttgttttgcc agacccaaac 240

aagttcgctt tgccagactc ttccttgttc gacccaacta ctcagagatt ggtttgggct 300

tgtactggtt tggaggttgg tagaggtcag ccattgggtg ttggtgtttc tggtcaccct 360

ttgttgaaca agtacgacga cgttgagaac tccggtggtt atggtggtaa cccaggtcaa 420

gacaacagag ttaacgttgg tatggactac aagcagactc agttgtgtat ggttggttgt 480

gctccaccat tgggtgaaca ttggggtaag ggtactcagt gttccaacac ttccgttcag 540

aacggtgact gtccaccttt ggagttgatc acttccgtta ttcaggacgg tgacatggtt 600

gacactggtt ttggtgctat gaacttcgct gacttgcaga ctaacaagtc cgacgttcca 660

ttggacatct gtggtactgt ttgtaaatac ccagactact tgcagatggc tgctgatcca 720

tacggtgaca gattgttctt ctacttgaga aaagaacaga tgttcgctag acacttcttc 780

aacagagctg gtactgttgg tgagccagtt ccagatgact tgttggttaa gggtggtaac 840

aacagatcct ccgttgcttc ctccatctac gttcatactc catccggttc cttggtttct 900

tctgaggctc agttgttcaa caagccatac tggttgcaga aggctcaggg tcacaacaac 960

ggtatttgtt ggggtaacca cttgttcgtt actgttgttg acactactag atccactaat 1020

atgactttgt gtgcttccgt ttccaagtcc gctacttaca ctaactccga ctacaaagag 1080

tacatgagac acgttgaaga gttcgacttg cagttcatct tccagttgtg ttccatcact 1140

ttgtccgctg aggttatggc ttacatccac actatgaacc catccgtttt ggaggactgg 1200

aacttcggtt tgtctccacc acctaacggt actttggagg acacttacag atacgttcag 1260

tcccaggcta tcacttgtca gaagccaact ccagagaaag agaagcagga cccatacaag 1320

gacatgtctt tctgggaggt taacttgaaa gagaagttct cctcagagtt ggaccagttc 1380

ccattgggta gaaagttctt gttgcagtcc ggttacagag gtagaacttc cgctagaact 1440

ggtatcaaaa gaccagctgt ttccaagcca tccactgctc caaagagaaa aagaactaag 1500

actaagaagt agttgtggtt gccatctgaa gctactgttt acttgccacc agttccagtt 1560

tctaaggttg tttctactga tgaatacgtt gctagaacta acatttacta ccatgctggt 1620

acttctagat tgttggctgt tggtcaccca tactttccaa ttaagaagcc aaacaacaac 1680

aagattttgg ttccaaaggt ttctggtttg caatacagag tttttagaat ccatttgcca 1740

gatccaaaca agtttggttt tccagatact tctttttaca acccagatac tcaaagattg 1800

gtttgggctt gtgttggtgt tgaagttggt agaggtcaac cattgggtgt tggtatttct 1860

ggtcacccat tgttgaacaa gttggatgat actgaaaacg cttctgctta cgctgctaac 1920

gctggtgttg ataacagaga atgtatttct atggattaca agcaaactca attgtgtttg 1980

attggttgta agccaccaat tggtgaacat tggggtaagg gttctccatg tactaacgtt 2040

gctgttaacc caggtgattg tccaccattg gaattgatta acactgttat tcaagatggt 2100

gatatggttg atactggttt tggtgctatg gattttacta ctttgcaagc taacaagtct 2160

gaagttccat tggatatttg tacttctatt tgtaagtacc cagattacat taagatggtt 2220

tctgaaccat acggtgattc tttgtttttt tacttgagaa gagaacaaat gtttgttaga 2280

cacttgttta acagagctgg tgctgttggt gaaaacgttc cagatgattt gtacattaag 2340

ggttctggtt ctactgctaa cttggcttct tctaactact ttccaactcc atctggttct 2400

atggttactt ctgatgctca aatttttaac aagccatact ggttgcaaag agcccaaggt 2460

cataacaacg gtatttgttg gggtaaccaa ttgtttgtta ctgttgttga tactactaga 2520

tctactaaca tgtctttgtg tgctgctatt tctacttctg aaactactta caagaacact 2580

aactttaagg aatacttgag acacggtgaa gaatacgatt tgcaatttat ttttcaattg 2640

tgtaagatta ctttgactgc tgatgttatg acttacattc attctatgaa ctctactatt 2700

ttggaagatt ggaactttgg tttgcaacca ccaccaggtg gtactttgga agatacttac 2760

agatttgtta cttctcaagc tattgcttgt caaaagcaca ctccaccagc tccaaaggaa 2820

gatccattga agaagtacac tttttgggaa gttaacttga aggaaaagtt ttctgctgat 2880

ttggatcaat ttccattggg tagaaagttt ttgttgcaag ctggtttgaa ggctaagcca 2940

aagtttactt tgggtaagag aaaggctact ccaactactt cttctacttc tactactgct 3000

aagagaaaga agagaaagtt gtaatag 3027

<210> 2

<211> 1518

<212> DNA

<213> HPV 16 L1

<400> 2

atgtctttgt ggttgccatc tgaagctact gtttacttgc caccagttcc agtttctaaa 60

gttgtttcca ctgacgaata cgttgctaga actaacatct actaccacgc tggtacttct 120

agattgttgg ctgttggtca tccatacttc ccaattaaga agccaaacaa caacaagatt 180

ttggttccaa aggtttccgg attgcaatac agagttttca gaatccattt gccagatcca 240

aacaagtttg gtttcccaga tacttctttc tacaacccag acactcaaag acttgtttgg 300

gcttgtgttg gtgttgaagt tggtagaggt caaccattgg gtgttggtat ttctggtcac 360

ccattgttga acaagttgga cgatactgaa aacgcttctg cttacgctgc taacgctggt 420

gttgataaca gagaatgtat ttctatggac tacaagcaaa ctcaattgtg tttgattggt 480

tgtaagccac caattggtga acattgggga aagggttctc catgtactaa tgttgctgtt 540

aaccctggtg attgtccacc attggaattg attaacactg ttattcaaga cggtgatatg 600

gttgatactg gtttcggtgc tatggatttc actactttgc aagctaacaa gtctgaagtt 660

ccattggaca tttgtacttc catctgtaag tacccagact acattaagat ggtttctgaa 720

ccatacggtg attctttgtt cttctacttg agaagagaac aaatgtttgt tagacacttg 780

ttcaacagag ctggtgctgt tggtgaaaac gttccagatg acttgtacat taagggttct 840

ggttctactg ctaacttggc ttcttctaac tactttccaa ctccatctgg ttctatggtt 900

acttctgacg ctcaaatttt caacaagcca tactggttgc aaagagcaca aggtcataac 960

aacggtattt gttggggtaa ccaattgttc gttactgttg ttgacactac tagatccact 1020

aacatgtcct tgtgtgctgc tatttctact tctgaaacta cttacaagaa cactaacttc 1080

aaagagtact tgagacacgg agaagaatac gacttgcaat tcattttcca attgtgtaag 1140

attactttga ctgctgacgt tatgacttac attcactcta tgaactctac tattttggaa 1200

gattggaact tcggattgca accaccacca ggtggtactt tggaagatac ttacagattc 1260

gttacttctc aagctattgc ttgtcaaaag catactccac ctgctccaaa agaagatcca 1320

ttgaagaagt acactttctg ggaagttaac ttgaaagaaa agttctctgc tgatttggat 1380

caattcccat tgggtagaaa gtttttgttg caagctggat tgaaggctaa accaaagttc 1440

actttgggaa agagaaaggc tactccaact acttcttcta cttctactac tgctaagaga 1500

aagaagagaa aattgtaa 1518

<210> 3

<211> 1524

<212> DNA

<213> HPV 16 L1

<400> 3

atggctcttt ggagaccatc cgacaacact gtttacttgc caccaccatc cgttgctaga 60

gttgttaaca ctgacgacta cgttactaga acttccatct tctaccacgc tggttcttcc 120

agattgttga ctgttggtaa cccatacttc agagttccag ctggaggtgg taacaagcaa 180

gacatcccaa aggtttccgc ttaccagtac agagttttca gagttcagtt gccagaccca 240

aacaagtttg gattgccaga caattccatc tacaacccag agactcagag acttgtttgg 300

gcttgtgctg gtgttgaaat cggtagagga cagccattgg gtgttggttt gtctggtcac 360

ccattctaca acaagttgga cgacactgaa tcttctcacg ctgctacttc taacgtttcc 420

gaggatgtta gagacaacgt ttccgttgac tacaagcaga ctcagttgtg tatcttgggt 480

tgtgctccag ctattggtga acattgggct aagggtactg cttgtaagtc cagaccattg 540

tctcagggag attgtccacc attggagttg aagaacactg ttttggagga cggtgatatg 600

gttgatactg gttacggtgc tatggacttc tctactttgc aggacactaa gtgtgaagtt 660

ccattggaca tctgtcagtc catctgtaag tacccagact acttgcaaat gtccgctgat 720

ccatacggtg actctatgtt cttctgtttg agaagagagc agttgttcgc tagacacttc 780

tggaacagag ctggtactat gggtgacact gttccacaat ccttgtacat caagggtact 840

ggaatgagag cttctcctgg ttcttgtgtt tactctccat ctccatccgg ttccattgtt 900

acttccgact cccagttgtt caacaagcca tactggttgc ataaggctca aggtcacaac 960

aacggtattt gttggcacaa ccagttgttc gttactgttg ttgacactac tagatccact 1020

aacttgacta tctgtgcttc cactcaatct ccagttccag gacaatacga cgctactaag 1080

ttcaagcagt actccagaca cgttgaagag tacgacttgc agttcatctt ccagttgtgt 1140

actatcactt tgactgctga tgttatgtcc tacatccact ctatgaactc ctccattttg 1200

gaggattgga acttcggtgt tccaccacca ccaactactt cattggttga cacttacaga 1260

ttcgttcagt ccgttgctat cacttgtcaa aaggacgctg ctccagctga aaacaaggac 1320

ccatacgaca agttgaagtt ctggaacgtt gacttgaaag agaagttctc cttggacttg 1380

gaccaatacc cattgggtag aaagtttttg gttcaggctg gattgagaag aaagccaact 1440

atcggtccaa gaaagagatc agctccatcc gctactactt catccaagcc agctaagaga 1500

gttagagtta gagctagaaa gtag 1524

<210> 4

<211> 1503

<212> DNA

<213> HPV 16 L1

<400> 4

atgtggagac catccgactc cactgtttat gttccaccac caaacccagt ttccaaggtt 60

gttgctactg acgcttacgt tactagaact aatatcttct accacgcttc ctcatccaga 120

ttgttggctg ttggtcaccc atacttctcc atcaagagag ctaacaagac tgttgttcca 180

aaggtttccg gttaccagta cagagttttt aaggttgttt tgccagaccc aaacaagttc 240

gctttgccag actcttcctt gttcgaccca actactcaga gattggtttg ggcttgtact 300

ggtttggagg ttggtagagg tcagccattg ggtgttggtg tttctggtca cccattcttg 360

aacaagtacg acgacgttga gaactctggt tctggtggta acccaggtca ggacaacaga 420

gttaacgttg gtatggacta caagcagact cagttgtgta tggttggttg tgctccacca 480

ttgggtgaac attggggtaa gggtaagcag tgtacaaaca ctccagttca ggctggtgac 540

tgtccacctt tggagttgat cacttccgtt attcaggacg gtgacatggt tgacactggt 600

tttggtgcta tgaacttcgc tgacttgcag actaacaagt ccgacgttcc aatcgacatc 660

tgtggtacta cttgtaagta cccagactac ttgcagatgg ctgctgatcc atacggtgac 720

agattgttct tcttcttgag aaaagaacag atgttcgcta gacacttctt caacagagct 780

ggtgaagttg gtgagccagt tccagacact ttgatcatta agggttccgg taacagaact 840

tccgttggtt cctccatcta cgttaacact ccatccggtt ccttggtttc ttctgaggct 900

cagttgttca acaagccata ctggttgcag aaggctcagg gtcacaacaa cggtatctgt 960

tggggtaacc agttgttcgt tactgttgtt gacactacta gatccactaa tatgactttg 1020

tgtgcttccg ttactacttc ctccacttac actaactccg actacaaaga gtacatgaga 1080

cacgttgaag agtacgactt gcagttcatc ttccagttgt gttccatcac tttgtccgct 1140

gaggttatgg cttacatcca cactatgaac ccatccgttt tggaggactg gaacttcggt 1200

ttgtctccac cacctaacgg tactttggag gacacttaca gatacgttca gtcccaggct 1260

atcacttgtc agaagccaac tccagagaaa gagaagccag acccttacaa gaacttgtcc 1320

ttctgggagg ttaacttgaa agagaagttc tcctcagagt tggaccagta cccattgggt 1380

agaaagttct tgttgcagtc cggttacaga ggtagatcct ccatcagaac tggtgttaag 1440

agaccagctg tttccaaggc ttctgctgct ccaaagagaa agagagctaa gactaagaga 1500

tag 1503

<210> 5

<211> 1506

<212> DNA

<213> HPV 16 L1

<400> 5

atgtggagac catccgactc cactgtttat gttccaccac caaacccagt ttccaaggtt 60

gttgctactg acgcttacgt taagagaact aatatcttct accacgcttc ctcatccaga 120

ttgttggctg ttggtcaccc ttactactcc atcaagaagg ttaacaagac tgttgttcca 180

aaggtttccg gttaccagta cagagttttt aaggttgttt tgccagaccc aaacaagttc 240

gctttgccag actcttcctt gttcgaccca actactcaga gattggtttg ggcttgtact 300

ggtttggagg ttggtagagg tcagccattg ggtgttggtg tttctggtca ccctttgttg 360

aacaagtacg acgacgttga gaactccggt ggttatggtg gtaacccagg tcaagacaac 420

agagttaacg ttggtatgga ctacaagcag actcagttgt gtatggttgg ttgtgctcca 480

ccattgggtg aacattgggg taagggtact cagtgttcca acacttccgt tcagaacggt 540

gactgtccac ctttggagtt gatcacttcc gttattcagg acggtgacat ggttgacact 600

ggttttggtg ctatgaactt cgctgacttg cagactaaca agtccgacgt tccattggac 660

atctgtggta ctgtttgtaa atacccagac tacttgcaga tggctgctga tccatacggt 720

gacagattgt tcttctactt gagaaaagaa cagatgttcg ctagacactt cttcaacaga 780

gctggtactg ttggtgagcc agttccagat gacttgttgg ttaagggtgg taacaacaga 840

tcctccgttg cttcctccat ctacgttcat actccatccg gttccttggt ttcttctgag 900

gctcagttgt tcaacaagcc atactggttg cagaaggctc agggtcacaa caacggtatt 960

tgttggggta accacttgtt cgttactgtt gttgacacta ctagatccac taatatgact 1020

ttgtgtgctt ccgtttccaa gtccgctact tacactaact ccgactacaa agagtacatg 1080

agacacgttg aagagttcga cttgcagttc atcttccagt tgtgttccat cactttgtcc 1140

gctgaggtta tggcttacat ccacactatg aacccatccg ttttggagga ctggaacttc 1200

ggtttgtctc caccacctaa cggtactttg gaggacactt acagatacgt tcagtcccag 1260

gctatcactt gtcagaagcc aactccagag aaagagaagc aggacccata caaggacatg 1320

tctttctggg aggttaactt gaaagagaag ttctcctcag agttggacca gttcccattg 1380

ggtagaaagt tcttgttgca gtccggttac agaggtagaa cttccgctag aactggtatc 1440

aaaagaccag ctgtttccaa gccatccact gctccaaaga gaaaaagaac taagactaag 1500

aagtag 1506

Claims (19)

1. the isolated genes of HPV major capsid protein are encoded, wherein the gene is selected from SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5.

2. the carrier of the gene comprising coding HPV major capsid protein, wherein the gene is selected from SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and combinations thereof.

3. the carrier described in claim 2, it is selected from pPICZ, pPIC6, pGAPZ and pAO815z.

4. the carrier described in claim 2, it, which has, is selected from MTCC 5969, MTCC 5970, MTCC 5971 or MTCC 5972 MTCC accession number.

5. with the host cell of the genetic transformation described in claim 1.

6. include the host cell of the carrier described in claim 2.

7. the host cell described in claim 5 and 6, it is yeast cells, preferably pichia pastoris phaff (P.pastoris).

8. the host cell described in claim 6, its be selected from Pichia Pastoris strain X-33, GS115, KM71 and SMD1168。

9. the virus-like particle obtained by using the gene described in claim 1.

10. the virus-like particle described in claim 9, its diameter is in 50-500nm, more preferably preferably 50-400nm, 100- In the range of 400nm.

11. Human-papilloma Vaccine, its comprising ating least one the gene from the encoding capsid protein described in claim 1, It can trigger the immune response for HPV antigens.

12. the human papilloma vaccine described in claim 11, it is also anti-comprising single or different serotypes L2, E6 or E7 is encoded Former gene.

13. the serotype described in claim 12, its be selected from HPV 16, HPV 6, HPV 18, HPV 11, HPV 31, HPV 33, HPV 45, HPV 52, HPV 58 and combinations thereof.

14. immunogenic composition, it contains the albumen of suitable adjuvant and HPV antigens described at least one claim 1.

15. the adjuvant described in claim 14, it is selected from aluminium salt, single Monophosphoryl lipid analog such as glycopyranosyl lipid and helped Agent, monatide, cytokine induction agent, the adjuvant based on squalene, lipophilic adjuvants and combinations thereof.

16. preparing the method for the human papilloma vaccine described in claim 11, it comprises the following steps：

A. the gene of composite coding HPV major capsid protein,

B. the expression vector of the gene of coding HPV major capsid protein is built,

C. selection has the clone of the transformed gene of the human papilloma virus toxalbumin of high copy number,

D. the expression analysis of the transformed gene of the human papilloma virus toxalbumin is carried out,

E. the protein of the gene code by the human papilloma virus toxalbumin is purified,

F. the VLP of human papilloma virus toxalbumin batch solution is prepared,

G. the protein in host cell is characterized,

H. the vaccine containing the human papilloma virus toxalbumin is prepared.

17. the method for preparing human papilloma vaccine described in claim 16, wherein the host cell is yeast cells, preferably Pichia pastoris phaff.

18. the major capsid protein any one of preceding claims, it is single or different serotypes HPV L1.

19. the HPV L1 albumen described in claim 18, it is selected from 18 6 L1, the HPV 11 of L1, HPV of L1, HPV of HPV 16 L1, HPV 31 L1, HPV 33 L1, HPV 45 L1, HPV 52 L1, HPV 58 L1 and combinations thereof, the preferably L1 of HPV 16, 6 11 L1 and combinations thereof of L1, HPV of L1, HPV of HPV 18.