CN111139243B

CN111139243B - LlimADS11 gene separated from prunus persica and application method thereof

Info

Publication number: CN111139243B
Application number: CN201911188658.9A
Authority: CN
Inventors: 张静文; 李佳文; 杨勇; 张颖
Original assignee: Hainan Normal University
Current assignee: Hainan Normal University
Priority date: 2019-11-28
Filing date: 2019-11-28
Publication date: 2022-04-05
Anticipated expiration: 2039-11-28
Also published as: CN111139243A

Abstract

The invention discloses a LlimADS11 gene separated from prunus persica and an application method thereof, wherein the LlimADS11 gene has the characteristic of promoting plant flowering. The invention initially knows the flowering induction mechanism of the prunus persica from the perspective of molecular biology for the first time, lays a foundation for regulating the flowering time through the overexpression or the inhibition of the expression of target genes in the prunus persica, and has important significance for the explanation of endangered prunus persica at the molecular level.

Description

LlimADS11 gene separated from prunus persica and application method thereof

Technical Field

The invention relates to a LlimADS11 gene separated from prunus cerasifera and an application method thereof, belonging to the technical field of biological engineering.

Background

According to the prediction result of the NOAA model, by 2020, the global earth surface temperature is at least 0.5 ℃ higher than the average temperature in 1986 to 2005, and multiple regions of the earth are accompanied by an extreme climate-uneven cold and heat phenomenon, but the global temperature is increased. At high temperature, the plant has the phenomena of early flowering, thinning and diminishing leaves, elongation and growth of hypocotyl, and the like, and the biological phenomena are collectively called as thermo morphogenesis (thermo genesis). At present, the research on the hot morphogenesis is widely concerned, but each component of the regulation pathway is still to be identified, and the potential action mechanism of the regulation pathway needs to be further deeply researched.

The endangered mangrove plant cerasus rubra (Jack.) Voigt is a plant of cerasus (Combretaceae) genus, is mainly distributed in tropical regions, and becomes an endangered species of International wetland convention due to the damage of habitat. In China, the red olive plum is only distributed in Hainanling water and Sanya, only 11 wild species are stored at present, the wild species are all in the old or nearly old forest stage, and no seedling develops under the forest (cancai Rong et al, 2011; Zhangyi et al, 2017). The drastic reduction of the quantity of red olive plum is related to biological factors such as low pollen activity, abnormal embryo development and serious seed abortion (Zhang Ying et al, 2017; Wang Wen Qing and Wang Eretmochelydis, 2007). Therefore, the flowering of the prunus persica during the growth process is unstable, the state of prunus persica seeds is seriously affected, and the reproductive difficulty is caused. Therefore, the research on the flowering of the prunus persica becomes a focus of attention.

The investigation shows that the temperature of the plum habitat is 25 ℃, and the plum habitat is a thermophilic narrow distribution species, so the temperature is one of important factors for limiting the distribution. At high temperatures, prunus persica evolves a strong ability to adapt to the surrounding habitat, especially with regard to the establishment of the thermal form. The hot morphogenesis is beneficial to reducing the temperature of the plants and better adapting to the high-temperature environment. It has now been found that the transcription factor PIF4 interacting with plant phytochrome phyB plays a central role in plant thermo-morphogenesis, and a number of negative regulators have also been identified to regulate thermo-morphogenesis by inhibiting the activity of PIF 4. However, the molecular mechanism of how prunus persica undergoes thermo-morphogenesis at high temperature is not clear, and particularly, the mechanism of flowering regulation is studied.

The MADS-box gene of the plant is identified as a floral organ characteristic determining gene in Arabidopsis thaliana and snapdragon, and later researches find that the genes play an important regulation role in the processes of plant flowering transformation, floral meristem determination, male and female gametophyte development, fruit maturation and the like. Currently, several studies have shown that the MADS-box gene can influence the flowering time of plants by responding to changes in environmental temperature. FLM-beta is a selective spliceosome of FLOWERING inhibiting factor FLOWERING LOCUS M (FLM), and the transcription level of the FLM-beta is improved in a low-temperature environment to inhibit the FLOWERING of plants; upon interaction of FLM-beta with SHORT VEGETATIVE PHASE (SVP), SVP degrades at high temperatures, decreasing the abundance of the SVP-FLM-beta repression complex, thereby promoting plant flowering (Lee JH, Ryu HS, Chung KS, Pos D, Kim S, Schmid M, Ahn JH.Regulation of temperature-responsive flowering by MADS-box transcription factor expression.science.2013, 342(6158): 628) -632.). FLOWERING LOCUS C (FLC) is a transcription factor encoding MADS-box, a FLOWERING inhibitor, and FRIGIDA (FRI) are essential for the vernalization pathway. FRI is capable of up-regulating the expression of FLC to levels effective to prevent flowering (Koornneefet al, 1994; Searleet al, 2006). Studies have shown that FLC affects the period of the biological clock at high temperatures: low expression of FLC is associated with decreased circadian rhythm, high expression of FLC is associated with increased circadian rhythm; this may affect many aspects of plant development [47,48 ]. Furthermore, many temperature responsive genes altered the expression level of FLC-3 mutants after a transition from 22 ℃ to 27 ℃, suggesting that FLC may down-regulate the transcription level of other genes at high temperatures. The MADS box transcription factor can not only regulate and control the flowering phase of the plant, but also influence the fertility of the plant. The TaMS-MADS box of the wheat is up-regulated in the key period of fertility conversion of the A3017 variety (the mononuclear period to the dinuclear period of pollen development), and the expression level under the sterile condition is higher than that under the contemporaneous fertility condition. The expression of TaMS-MADS box on the A3017 spike is effectively silenced by adopting the BSMV-VIGS technology under the condition of fertile temperature. The silent plant has sterile characters of partial anther being thin and small, not cracking and the like, and the selfing seed setting rate is reduced.

At present, MADS-box genes have been cloned from various plants, and the transcriptional activity of MADS-box key genes is temperature-controlled, which allows synchronization of flowering with seasonal changes. In addition, the MADS-box gene has a potential role in regulating developmental responses to elevated growth temperatures. Therefore, studying how temperature regulates the transcription of the MADS-box gene helps to understand how seasonal fluctuations in temperature affect plant development. Plant breeders can utilize natural variation of temperature responsive MADS-box genes to breed crop varieties that are amenable to high temperatures. However, as an endangered species with narrow distribution of thermophiles, the molecular mechanism of MADS-box gene in Prunus persica for promoting plant thermo-morphogenesis in response to high temperature environment is not clear. Therefore, the cloning and identification of the Prunus persica LlMADS11 gene and the research of flowering induction mechanism lay the foundation for regulating flowering time through the overexpression or inhibition of the expression of target genes in Prunus persica, and the analysis of the plant heat morphogenesis mechanism of Prunus persica LlMADS11 from the perspective of molecular biology has very important significance for the cultivation of heat-resistant quality crops.

Disclosure of Invention

The invention obtains a gene LlMADS11 for promoting plant flowering by separating from the red elegans plum genome. Constructing a plant expression vector by using the separated LlMADS11 gene and introducing the plant expression vector into arabidopsis thaliana to obtain a transgenic material, wherein the transgenic arabidopsis thaliana shows that LlMADS11 is successfully inserted into arabidopsis thaliana, the expression of the gene is detected at a transcription level, and physiological phenomena such as early flowering, hypocotyl elongation, leaf blade reduction and the like occur at mild high temperature through phenotype detection on transgenic offspring, which shows that LlMADS11 promotes plant thermo-morphosis and can also influence the development of floral organs.

The technical scheme adopted by the invention is as follows:

LlimaDS11 gene separated from Prunus padus has nucleotide sequence shown in SEQ ID NO. 1.

Furthermore, the amino acid sequence coded by the LlimADS11 gene is shown in SEQ ID NO.2, and the LlimADS11 gene contains a MADS family structural domain.

An application method of an LlimaDS11 gene separated from prunus persica is characterized in that the LlimaDS11 gene is connected with a pBinGlyRed vector to obtain a recombinant plasmid, agrobacterium is transformed by a freeze-thaw method, and arabidopsis thaliana is transformed by a pollen tube channel method, rosette leaves of transgenic arabidopsis thaliana are fewer than those of wild arabidopsis thaliana by 11 leaves on average, and the flowering time of the transgenic arabidopsis thaliana is remarkably advanced.

Furthermore, the floral organ development of LlimADS11 transgenic Arabidopsis is affected, including pistil, stamen and petals.

Compared with the prior art, the invention has the beneficial effects that:

the invention discovers a novel MADS-box gene LlimMADS 11, researches the function of the gene in the hot morphogenesis of arabidopsis thaliana by cloning the gene, can artificially create early maturing materials by expressing the gene, and has very important significance for the cultivation of heat-resistant quality crops.

Drawings

FIG. 1 is an electrophoresis chart of the LlMADS11 gene cloning process.

FIG. 2 shows the nucleotide sequence and amino acid sequence of LlMADS 11.

FIG. 3 shows that LlMADS11 contains domains typical of the MADS family.

FIG. 4 shows the expression analysis of the LlMADS11 gene in the transgenic line.

FIG. 5 shows the statistics of flowering phenotype and rosette leaf number after overexpression of LlMADS11 gene in Arabidopsis thaliana, wherein A: wild type arabidopsis, B: OX-LlMADS11 overexpression strain.

FIG. 6 is the floret morphological structure in OX-LlMADS11 overexpression line, where A: wild-type arabidopsis floret morphology, B: OX-LlMADS11 over-expresses the variation of the stamens and petals of the florets of the strain.

FIG. 7 is a leaf phenotype in OX-LlMADS11 overexpression lines, where A: leaf-positive of wild type Arabidopsis with OX-LlMADS11 overexpression line, B: the back of the blade.

Detailed Description

The specific implementation mode is as follows:

in the following examples, unless otherwise specified, all methods used are conventional and materials and reagents used are commercially available.

Example 1:

cloning method and sequence analysis of LlMADS11 gene

The method for cloning and sequence analysis of the LlMADS11 gene comprises the following steps.

S1: the extraction and detection of red elemene plum RNA take leaves of red elemene plum as a material, and the extraction of RNA adopts a polysaccharide polyphenol/complex plant RNA rapid extraction kit of Beijing Eldely Biotech limited (the specific method refers to the instruction).

And (3) detecting the total RNA quality and integrity of the prunus persica: diluting 5 μ L RNA solution to 100 μ L, measuring light absorption values at 260, 280 and 230nm with ultraviolet nucleic acid protein detector, and calculating A260nm/A280nm ratio; at the same time, 5. mu.L of RNA sample was subjected to electrophoresis on 1% agarose gel to check the integrity of total RNA. When the ratio of A260/A280 is between 1.8-2.0, 28S and 18S rRNA bands are clear and the brightness ratio is between 1.5-2, the RNA sample is qualified and used for the next experiment.

S2: synthesis of First Strand of cDNA mu.g of total RNA sample extracted was used to synthesize First Strand cDNA in a reaction system of 20. mu.L, oligo (dT)18 was used as a primer, and the detailed procedure was performed according to RevertAID First Strand cDNA Synthesis Kit (Thermo Fermentas) instructions. The reverse transcription system is as follows:

standing the mixed solution at 42 ℃ for reacting for 1 h; the reaction was carried out at 70 ℃ for 5 min. After the reaction was completed, the cDNA was diluted 5-fold and used as a template for PCR amplification.

S3: the Primer design is based on the sequence comparison of related gene sequences obtained by sequencing of red elemene plum blossom tissue transcriptome and other plant homologous genes on NCBI (http:// www.ncbi.nlm.nih.gov /), according to the basic principle of Primer design, the Primer Premier 5.0 software is used for designing specific primers comprising an initiation codon and a termination codon for amplifying the full-length sequence of the LlMADS11 gene, and the primers used for amplification are as follows:

LlMADS11-F:ACGGGGGACTGAATTCATGGGTCGAACTCGTGGAAAG

LlMADS11-R:CCGCCTCGAGCCCGGGCTATCTTGGGTCCCCCTTTGCT

s4: amplification and recovery of the target Gene fragment Using cDNA as template

Max kit (Nanjing Novozam) is used for PCR amplification reaction, and the reaction system is 50 mu L.

The 50 μ L PCR reaction program was as follows:

the PCR reaction program is: pre-denaturation at 95 ℃ for 3min, followed by denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 15sec, and extension at 72 ℃ for 30sec, followed by 35 cycles, and finally complete extension for 5 min. The PCR product was detected on a 1.5% agarose gel and recovered.

S5: vector connection, transformation and positive cloning identification are carried out by connecting a target DNA fragment with pBinGlyRed vector skeleton subjected to EcoR I and Xma I double enzyme digestion in a homologous recombination mode, adopting heat excitation to transform escherichia coli competence DH5 alpha, sending positive spots identified by colony PCR to Guangzhou Tian biological technology limited company for sequencing, comparing a sequencing result with a reference sequence, and confirming the sequencing result to obtain the full length of the LlMADS11 gene. The electrophoresis chart of the specific cloning process of the LlMADS11 gene is shown in FIG. 1, and the nucleotide sequence and the amino acid sequence of the ORF frame are shown in FIG. 2.

S6: sequence analysis of LlMADS11 Gene the ORF frame of LlMADS11 gene is 522bp, encodes protein consisting of 174 amino acids, the molecular weight of the protein is 19.45KDa, and the isoelectric point is 9.16. Conservative sequence analysis was performed in the NCBI database and showed that LlMADS11 belongs to the MADS family and contains domains typical of the MADS family, as shown in fig. 3.

Example 2:

an application method of the LlMADS11 gene in regulation and control of plant hot morphogenesis:

obtaining of LlMADS11 Gene overexpression plant lines

The plasmid containing the desired gene LlMADS11 obtained in example 1 was transferred to Agrobacterium-infected GV3101 by freeze-thaw method, cultured on a plate containing 50mg/L kanamycin and 50mg/L rifampicin for 2-3 days, PCR-amplified with primers specific to LlMADS11 to obtain uniform fragments, the strain was activated in YEB medium at 28 ℃ and Arabidopsis thaliana Col-0 was transformed by dip flower method. Infecting three times until the seeds are mature and harvested. And selecting red seeds as positive transgenic seeds by using glasses for filtering green light under a green fluorescent lamp. Planting T1 generation, extracting genome DNA from T1 generation leaves by a CTAB method, carrying out PCR amplification by using specific primers of LlMADS11, carrying out 1.5% agarose gel electrophoresis on PCR products, obtaining positive transgenic plants when the fragment size is consistent with a reference sequence, and the result shows that the LlMADS11 gene is successfully transferred into arabidopsis thaliana, and harvesting T1 generation seeds for storage.

2. Expression level analysis and flowering-time phenotype observation of LlMADS11 gene in transgenic Arabidopsis progeny

The LlMADS11 transgenic line was named OX-LlMADS11, and 19 independent lines were obtained. The transgenic line and wild type Arabidopsis thaliana were simultaneously sown in the cultivation room. Collecting flower buds after bolting, repeating at least three materials, repeating at least one strain for each material, collecting the materials by using a freezing tube after sampling, and quickly placing the materials in liquid nitrogen for preservation at-80 ℃.

Extracting RNA, carrying out reverse transcription, diluting the obtained cDNA, carrying out RT-PCR experiment, and verifying the expression level of the exogenous gene LlMADS 11. By usingSYBR green method and 2^-ΔΔCtThe method carries out fluorescence quantitative analysis, and primer sequences (gene and reference sequences) are as follows:

LlMADS11 FP:GAGTGCAAGAACAACAACCA

LlMADS11 RP:TAACGTCTGAGAGCCCAAAA

U6FP：ACATCCGATAAAATTGGAACGA

U6RP：TTTTTTTGGACCATTTCTCGAT

the reaction system is as follows:

the qRT-PCR reaction program was: pre-denaturation at 95 ℃ for 30sec, 10sec at 95 ℃ and 30sec at 60 ℃ for 40 cycles. As shown in FIG. 4, the result analysis shows that the expression level of the target gene LlMADS11 in the OX-LlMADS11 overexpression transgenic line is obviously higher than that of the wild Arabidopsis.

And selecting OX-LlMADS11-11 and OX-LlMADS11-13 strains with high expression quantity, simultaneously planting the strains and the wild type arabidopsis thaliana in a culture room at 28 ℃, and counting the number of rosette leaves of the transgenic strains and the wild type arabidopsis thaliana during bolting. And (3) displaying a statistical result: the number of rosette leaves of the OX-LlMADS11 overexpression strain is obviously less than that of the wild type, which indicates that the transgenic strain bolting and flowering are promoted, and the table is shown in figure 5. Meanwhile, the leaves of the OX-LlMADS11 overexpression strain are obviously reduced, the petioles are elongated, and the early flowering physiological phenomenon appears, which indicates that the LlMADS11 promotes the hot morphogenesis of arabidopsis thaliana.

Since the Prunus padus LlMADS11 gene belongs to MADS-box family, which is generally involved in the development of floral organs, the study observed floret morphology of transgenic lines. Through microscopic observation, the pistil, stamen and petal of the OX-LlMADS11 strain have different degrees of variation, as shown in FIG. 6. Meanwhile, it was also found that the leaf morphology of the transgenic line was transformed from long and narrow to oval, as shown in FIG. 7.

The foregoing is a more detailed description of the present invention that is presented in conjunction with specific embodiments, and the practice of the invention is not to be considered limited to those descriptions. It will be apparent to those skilled in the art that a number of simple derivations or substitutions can be made without departing from the inventive concept.

<110> university of south of the sea

<120> regulatory gene isolated from prunus persica and method of use thereof

<140> 2019111886589

<141> 2019-11-28

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 522

<212> DNA

<213> Lumnitzera littorea

<400> 1

atgggtcgaa ctcgtggaaa gctggcattg aaatttattc aaaacaagag tgcaagaaca 60

acaaccattg cgaaaagaaa aatgaatctc atgaaaaagg ctcatgaaat ttcggtatta 120

tgtggagtag atacatgtgc gattgtttat gatggctctg attcacaatg tcctgagacc 180

tggccaccaa accggaacga ggtcgagctt accatcgatg gatatctgtg tggatccaag 240

gctggcaaag tgcgtgtgaa gagaactttt gggctctcag acgttataga gaatcaaaag 300

aaggagattg atagtcagat ggcaaaagtg cgattggaga gtctggaggt taaagatttc 360

agcaaagagg aactggaatc catctctttg actctggatc agaagattga aatggcaaag 420

aaaaggcttg aacttttgga gacgagttct tcttcggagc ggatgccatc ctctgtttgg 480

cagtccatgc ctcctttgca agcaaagggg gacccaagat ag 522

<210> 2

<211> 173

<212> PRT

<213> Lumnitzera littorea

<400> 2

Met Gly Arg Thr Arg Gly Lys Leu Ala Leu Lys Phe Ile Gln Asn Lys

1 5 10 15

Ser Ala Arg Thr Thr Thr Ile Ala Lys Arg Lys Met Asn Leu Met Lys

20 25 30

Lys Ala His Glu Ile Ser Val Leu Cys Gly Val Asp Thr Cys Ala Ile

35 40 45

Val Tyr Asp Gly Ser Asp Ser Gln Cys Pro Glu Thr Trp Pro Pro Asn

50 55 60

Arg Asn Glu Val Glu Leu Thr Ile Asp Gly Tyr Leu Cys Gly Ser Lys

65 70 75 80

Ala Gly Lys Val Arg Val Lys Arg Thr Phe Gly Leu Ser Asp Val Ile

85 90 95

Glu Asn Gln Lys Lys Glu Ile Asp Ser Gln Met Ala Lys Val Arg Leu

100 105 110

Glu Ser Leu Glu Val Lys Asp Phe Ser Lys Glu Glu Leu Glu Ser Ile

115 120 125

Ser Leu Thr Leu Asp Gln Lys Ile Glu Met Ala Lys Lys Arg Leu Glu

130 135 140

Leu Leu Glu Thr Ser Ser Ser Ser Glu Arg Met Pro Ser Ser Val Trp

145 150 155 160

Gln Ser Met Pro Pro Leu Gln Ala Lys Gly Asp Pro Arg

165 170

<210> 3

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

acgggggact gaattcatgg gtcgaactcg tggaaag 37

<210> 4

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ccgcctcgag cccgggctat cttgggtccc cctttgct 38

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gagtgcaaga acaacaacca 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

taacgtctga gagcccaaaa 20

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

acatccgata aaattggaac ga 22

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tttttttgga ccatttctcg at 22

Sequence listing

Claims

1. An LlimaDS11 gene isolated from prunus persica, characterized in that: the nucleotide sequence is shown in SEQ ID NO. 1.

2. The LlimADS11 gene isolated from Prunus persica as claimed in claim 1, wherein: the amino acid sequence coded by the LlimADS11 gene is shown in SEQ ID NO.2, and the LlimADS11 gene contains a MADS family structural domain.

3. The use of LlimaDS11 gene isolated from Prunus persica as claimed in claim 1 or 2, wherein: the LlimADS11 gene is connected with a pBinGlyRed vector to obtain recombinant plasmid, agrobacterium is transformed by a freeze-thaw method, arabidopsis thaliana is transformed by a pollen tube channel method, rosette leaves of the transgenic arabidopsis thaliana are fewer than those of wild arabidopsis thaliana by 11 leaves on average, and the flowering time of the transgenic arabidopsis thaliana is remarkably advanced.

4. The method of claim 3, wherein the LlimADS11 gene isolated from Prunus persica is LlimADS11, wherein the LlimADS11 gene is selected from the group consisting of: floral organ development of LlimADS11 transgenic Arabidopsis is affected, including pistil, stamen, and petal.