CN102329807B - B-class function gene AcPI (ananas comosus Pistillata) and application thereof - Google Patents

Abstract

The invention relates to a B-class function gene AcPI (ananas comosus Pistillata) obtained by cloning from ananas comosus, and an application thereof in regulating Arabidopsis flowering. The nucleotide sequence of the AcPI gene is shown in SEQ ID NO.1, and the sequence of the amino acid coded by the B-class function gene AcPI is shown in SEQ ID NO.2. The AcPI gene is obtained by cloning with a homologous sequence method; the Arabidopsis is transformed with a pollen tube pathway method; and the result proves that the transgenic Arabidopsis plant flowers in advance as compared with the wild Arabidopsis plant. The B-class function gene AcPI is favorable for further knowing the ananas comosus flowering principle, so that the ananas comosus flowering phase can be regulated and the new ananas comosus species can be selected by a biotechnology means.

Description

Category-B functional gene AcPI and application thereof

Technical field

The present invention relates to a kind of flower development category-B functional gene AcPI that the clone obtains from pineapple and the application in Arabidopis thaliana is bloomed adjusting thereof.

Background technology

Pineapple (Ananas comosus) is Poales, Bromelia family, Ananas per nnial herb; Its fruit is rich in the multivitamin of multiple sugar, organic acid, mineral element and needed by human, is of high nutritive value, and can eat raw and process; The capable of using as feed and fertilizer of skin slag after the processing; Pineapple leaves also can be extracted high quality fibers, and pineapple is of many uses, and vast market and development prospect are at home and abroad arranged.According to FAO statistics, 2009, China's pineapple output was 1,450,000 tons, was the big pineapple in the third place in the world after Thailand and Philippines producing country in the world.China begins to introduce a fine variety pineapple at the beginning of the 17th century, mainly be distributed in provinces and regions such as Guangdong, Guangxi, Hainan, Yunnan, Fujian.

Though the tropical fruit that pineapple is China relatively to have superiority is run into a lot of problems in the course of cultivation, one of subject matter is pineapple early blossoming phenomenon.The pineapple early blossoming be meant vegetative organ not zoon be a major reason that causes the pineapple underproduction with regard to the phenomenon of early flowering; The pineapple early blossoming causes fruit little, greatly reduces the commodity value and the economic worth of fruit.If but it is too late to bloom, then need gather in batches, sell and process, increased cost.At present, the flower forcing technology that adopt in the production to reach the purpose of receiving fruit simultaneously more.But flower forcing difficulty or ease difference is bigger between kind, therefore needs to understand the mechanism of blooming, to regulate the florescence.

PISTILLATA (being called for short PI) in flower development ABC model, belongs to the category-B functional gene.The function of category-B gene is to regulate and control second and third to take turns floral organ: the growth of petal and stamen (Coen et al, 1991).In Arabidopis thaliana, the category-B gene is representative with PI and AP3, and their sudden change causes second to take turns floral organ and change calyx into, and the third round floral organ is changed carpel (Bowman et al, 1989 into; Jack et al, 1992).In the PI genoid; The PI motif high conservative of C-terminal; Hint that it has important function, its effect can't confirm that (though the C-terminal of the bright category-B gene of function proof list is absolutely necessary in the body, experiment in vitro shows that but C-terminal is unnecessary to the combination of heterodimer.The PI motif of the PI sudden change that from Arabidopis thaliana and Common Snapdragon, is separated in addition, does not change).In plants such as petunia, paddy rice, Herba Ranunculi Japonici, exist by independent evolution the in planting and duplicate a plurality of PI class collateral line homologous genes of generation, then have the lineal homologous gene (Kramer et al, 1998) that produces by inserting in the fruit of Nakedcaule poppy etc.

PI belongs to the MADS-box gene family, mainly is made up of MADS box, K box, I district and 4 parts of C-terminal.The structural domain of the high conservative that MADS box wherein is made up of about 56-58 amino acid; The K box is the conservative sequence of a moderate; The I district is positioned between MADS-box and the K box, the faint conservative region of being made up of about 35 amino acid; C-terminal is positioned at K box downstream, the non-conservative region of being made up of about 30 amino acid that is rich in hydrophobic residue; Be high conservative zone PI motif at last by 14 based compositions.The PI motif is relevant with its protein function.

On various crop, cloned at present and obtained the homogenic cDNA total length of PI.As the CsPIC2 of Stigma Croci (Crocus sativus, ABB22781), the AoPI of Huashan ginger (Alpinia oblongifolia, ABB92623); The OrcPI of orchid (Orchis italica, BAC22579), hyacinthine HPI2 (Hyacinthus orientalis, AAD22494); The VvPI of grape (Vitis vinifera, ABK59993), the MdPI of apple (Malus x domestica; CAC28022), intend blue mustard AtPI (Arabidopsis thaliana, BAA06465) etc.PI and homologous gene thereof are expressed on Arabidopis thaliana, can promote to bloom.

Along with research to flower development aspects such as model plant Arabidopis thalianas, understand pineapple to bloom mechanism and can instruct the pineapple breeding effectively, accelerate breeding process.This is to come the preliminary flower development of understanding pineapple from molecular biological angle first, for later on through goal gene in pineapple overexpression or suppress it and express and regulate flowering time and lay the first stone.Therefore, this research is for utilizing genetically engineered to come seed selection pineapple new variety to have great significance.

Summary of the invention

In view of the above problems, according to one object of the present invention, a category-B functional gene AcPI who from the pineapple apical meristem, obtains first is provided, its nucleotide sequence such as SEQ ID NO:1.

According to an aspect of the present invention, said AcPI gene size is 907bp, and its 197 amino acid of encoding contain typical PI homologous gene structural domain.

According to another aspect of the present invention, the aminoacid sequence of said AcPI genes encoding such as SEQ ID NO:2.

According to another aspect of the present invention; Said AcPI gene has comprised 56～58 MADS structural domains that amino acid is formed; The K box, by the I box that about 35 amino acid are formed, the C-terminal of being made up of about 30 amino acid that is rich in hydrophobic residue reaches the PI motif by 14 based compositions.

According to a further aspect of the invention; Through the real time fluorescent quantitative expression analysis; Said AcPI gene all has expression at pulp, carpopodium, sepal, stamen, bract, apical meristem, blade and 8 positions of petal, and expression amount is followed successively by from big to small: stamen＞petal＞sepal＞carpopodium＞apical meristem＞pulp＞blade＞bract.

The present invention also provides the application of said AcPI gene in the adjusting Arabidopis thaliana is bloomed; Wherein said AcPI gene with obtain recombinant plasmid pBI121-AcPI after carrier pBI121 forward links to each other; Said recombinant plasmid pBI121-AcPI is transformed agrobacterium strains GV3101; Behind the pollen tube passage method arabidopsis thaliana transformation, impel Arabidopis thaliana on average to budding in 5.3 days in advance.

Description of drawings

Fig. 1 representes the aminoacid sequence comparison of PI homologous genes encoding.

Fig. 2 representes the expression of AcPI gene at 8 different sites.

Fig. 3 representes the design of graphics of plant expression vector pBI121-AcPI.

Embodiment

Below in conjunction with specific embodiment the present invention is done further detailed description, these embodiment only are used for explaining the present invention, do not limit the scope of the invention.

PI homologous gene provided by the present invention is from pineapple, to clone to obtain, called after AcPI gene, nucleotide sequence such as SEQ ID NO:1 (sequence 1).

The protein of AcPI genes encoding, called after AcPI protein, its aminoacid sequence such as SEQ ID NO:2 (sequence 2).

One, the clone of AcPI gene and sequential analysis thereof

The cloning process of above-mentioned AcPI gene and sequential analysis thereof comprise the steps:

1, RNA extracts

Apical meristem with pineapple kind " Bali " is a material, extracts total RNA with pillar plant RNA out 2.0 test kits (PIN is CAT#:90404-50) of sky, Beijing bounties Gene Tech. Company Limited, and concrete operations are following:

1) estimates histiocytic consumption.Each trace extracts generally needs 100～200mg apical meristem.

2) earlier fresh apical meristem is cut into fritter, behind the liquid nitrogen grinding powdered, add the solution A (with before need mixing) of 1ml, make homogenate through 65 ℃ of preheatings.

3) apical meristem behind the inkstone mill or the homogenate that makes are transferred in the clean 1.5ml plastic centrifuge tube (can shift aneroid cell debris).The plant tissue that has (such as fruit) contains a large amount of moisture content, and homogenate can also only be got 1ml more than 1ml during transfer.

4) solution B and the 0.2ml that in centrifuge tube, add 0.3ml provide chloroform for oneself, 30 seconds mixings of vibration on vibrator, and this moment, solution was uniform milkiness shape.Pipe end solution is shaken.

5) room temperature 12000rpm is centrifugal 3～5 minutes, the cytoclasis thing of two alternate 5 mm thick of will having an appointment.

6) supernatant (about 0.6ml) is transferred in another clean 1.5ml plastic centrifuge tube, DNA, protein and other impurity are contained in lower floor's organic phase and middle layer, avoid touching or drawing.Preferably staying 100 μ l supernatants does not get.

7) add isopyknic solution C, fully put upside down mixing, make mixing solutions.

8) half the above-mentioned mixing solutions is transferred in the centrifugal adsorption column, centrifugal half a minute of 12000rpm room temperature, abandoned and penetrate liquid.

The half the above-mentioned mixing solutions that 9) will be left is transferred in the same centrifugal adsorption column, centrifugal half a minute of 12000rpm room temperature, abandons and penetrates liquid.

10) the general post liquid of washing of 0.7ml is joined in the centrifugal adsorption column, centrifugal 10～30 seconds of 12000rpm room temperature is abandoned and is penetrated liquid.

11) repeating step 10) once.

12) the centrifugal above-mentioned adsorption column of 12000rpm room temperature 30 seconds is so that remove residual liquid.This step is very important, otherwise residual ethanol can influence the use of RNA.

13) centrifugal adsorption column is transferred in the collection tube of no RNA enzyme, added 50 μ l RNA elutriants, room temperature was placed 1～2 minute.

14) centrifugal half a minute of 12000rpm room temperature, solution is and contains the RNA sample that DNA pollutes in the centrifuge tube.Subsequent step mainly is to remove DNA to pollute.

15) will go up the 50ul total rna solution that obtains of step and solution D by 1: 1 mixed, fully shake half a minute.

16) add the solution E that is equivalent to RNA solution and 9 times of volumes of solution D mixed solution TV, put upside down for several times fully mixing.Attention: solution E may produce deposition after 4 ℃ of placements, must be placed on before using to take after 65 ℃ of water-baths also fully shake up the thorough dissolving of deposition again.

17) with step 16) mixed solution that makes transfers in the centrifugal adsorption column, centrifugal half a minute of room temperature 12000rpm, abandons and penetrate liquid.

18) add the general post liquid of washing of 0.7ml in centrifugal adsorption column, centrifugal half a minute of 12000rpm room temperature, abandon and penetrate liquid.

19) the general enough removal impurity of once washing.If be necessary, can add the general post liquid of washing of 0.3ml again in centrifugal adsorption column, centrifugal half a minute of 12000rpm room temperature also abandons and penetrates liquid.Generalized case, this step can omit.

The centrifugal adsorption column half a minute of 20) room temperature 12000rpm centrifugation step 19) handling.This step is very important, otherwise residual ethanol can influence the use of RNA.

21) centrifugal adsorption column is transferred in the new 1.5ml centrifuge tube, added 30～50 μ l RNA elutriants, room temperature was placed 1～2 minute.

22) with above-mentioned centrifuge tube in centrifugal half a minute of room temperature 12000rpm, solution is and removes the RNA sample that DNA pollutes in the centrifuge tube, can use immediately or deposit in-80 ℃ for use.

The quality of RNA and concentration are measured with the nucleic acid-protein appearance, use the agarose gel electrophoresis of 1.0g/100ml (being called for short 1.0%) to detect simultaneously.

2, reverse transcription

Adopt Dalian Bao Bio-Engineering Company (TAKARA) the first chain reverse transcription test kit to carry out reverse transcription, obtain cDNA first chain, as the template of pcr amplification subsequently.

3, design of primers

According to (the National Center for Biotechnology Information of U.S. biotechnology information center; Abbreviate NCBI as) (http://www.ncbi.nlm.nih.gov/) last homogenic sequence alignment of other crops, the primer of design core fragment:

Forward primer PI-F:5 '-CCAGGTCTCCVTCGTCAT-3 '

Reverse primer PI-R:5 '-ACACCAGTNAGACCATTC-3 '

Reaction system is: 12.5 μ l PCR damping fluids, the 8.4 μ l deionized water of sterilizing, 0.1 μ l Taq enzyme, forward, each 1 μ l (10 μ M) of reverse primer, cDNA template 2 μ l; The pcr amplification condition is: 94 ℃ of sex change 3min; 94 ℃ of sex change 0.5min, 50 ℃ of annealing 0.5min, 72 ℃ are extended 1.5min, 32 circulations; 72 ℃ are extended 10min.

4, target DNA reclaims

Behind the PCR product electrophoresis, the specification sheets according to the Agarose Gel DNA Purification Kit Ver2.0 (being numbered DV805A) of TAKARA reclaims target DNA fragment from sepharose.Concrete steps are following:

1) uses Tutofusin tris-acetate (abbreviating TAE as) damping fluid to make 1.0% sepharose, target DNA is carried out agarose gel electrophoresis.

2) under uv lamp, downcut the gel that contains target DNA fragment, paper towel exhausts the liquid of gel surface.Should excise the gel that does not contain the target DNA part this moment as far as possible, reduce gel volume as far as possible, improves the DNA recovery.

3) chopping blob of viscose.Can accelerate the blob of viscose thawing time after the blob of viscose chopping, improve the recovery of DNA.

4) weighing blob of viscose weight is calculated the blob of viscose volume.Calculate with 1g=1ml when calculating the blob of viscose volume.

5) in blob of viscose, add blob of viscose and melt liquid DR-I damping fluid, the dosage of DR-I damping fluid is following:

6) 75 ℃ of heating and melting blob of viscoses (the low melting-point agarose gel only needs 45 ℃ of heating) behind the uniform mixing.Should be interrupted vibration and mix this moment, makes blob of viscose fully melt (about 6～10min).

7) melt the DR-II damping fluid that adds 1/2 volume of DR-I damping fluid in the liquid, uniform mixing to above-mentioned blob of viscose.When the dna fragmentation that separates less than 400bp, should in this solution, add final concentration again and be 20% Virahol.

8) adsorption column in the test kit is arranged on the collection tube.

9) solution with the aforesaid operations step 7) is transferred in the adsorption column, and the centrifugal 1min of 12000rpm abandons filtrating.

10) the Rinse A with 500 μ l adds in the adsorption column, and centrifugal 30 seconds of 12000rpm abandons filtrating.

11) the Rinse B with 700 μ l adds in the adsorption column, and centrifugal 30 seconds of 12000rpm abandons filtrating.

12) repetitive operation step 11) once.

13) with operation steps 12) adsorption column handled is placed on the centrifuge tube of new 1.5ml, adds aqua sterilisa or the elutriant of 25ul in the centre of adsorption column film, and room temperature leaves standstill 1min.

14) the centrifugal 1min of 12000rpm, eluted dna.

15) use or-20 ℃ of preservations are subsequent use immediately.

The target DNA that reclaims is connected 2～4h in 16 ℃ with the pMD18-T carrier; Connect product transformed into escherichia coli JM109 competent cell; Adopt blue hickie screening transformant; Get hickie and carry out bacterium colony PCR and detect, the transformant of picking tests positive send company's order-checking, and sequencing result confirms to obtain is the intermediate segment of AcPI gene.

5, hold the special primer of rapid amplifying cDNA terminal (Rapid amplification of cDNA ends abbreviates RACE as) according to the core fragment design 5 ' and 3 ' that obtains:

5’PI-OUT：5′-CCATTCTGGAGAGCCTCTTCTATCGG-3′

5’PI-IN：5′-GCTCGATCTGCATGTTGTCGTTCTCT-3′

3’PI-OUT：5′-CGGGAAGATGTCCGAGTACTGTAGCC-3′

3’PI-IN：5′-AACGACAACATGCAGATCGAGCTCAG-3′

Operate according to Clontech RACE test kit; Earlier with 5 ' PI-OUT and 3 ' PI-OUT respectively with test kit in universal primer (the Universal primer that is equipped with; Abbreviate UPM as) carry out first round amplification; After 100 times of the amplified production dilutions as second take turns amplification template, carry out second with 5 ' PI-IN and 3 ' PI-IN respectively at the nido universal primer that is equipped with in the test kit (Nested universal primer abbreviates NUP as) and take turns RACE and increase.PCR total reaction volume 50 μ l, the operation experiments step should be carried out on ice bath.

After the gel recovery test kit recovery of PCR product with TAKARA; 16 ℃ are connected 2～4h with the pMD18-T carrier; Connect product and transform the JM109 competent cell, adopt blue hickie screening transformant, get hickie and carry out the PCR detection; The picking positive transformant send company order-checking, and sequencing result confirms to obtain is 5 ' and 3 ' end fragment of AcPI gene.

6, according to the sequencing result design cDNA total length amplimer that obtains:

PIQC-F：5’-AAGCAGTGGTATCAACGCAGAGTA-3’

PIQC-R：5’-ATAGCAGACAAAGTCGATGGCAGA-3’

Reaction system is: PCR damping fluid 12.5 μ l, the 8.4 μ l deionized water of sterilizing, 0.1 μ l Taq enzyme, forward, each 1 μ l (10 μ M) of reverse primer, cDNA template 2 μ l; The pcr amplification condition is: 94 ℃ of sex change 3min; 94 ℃ of sex change 0.5min, 60 ℃ of annealing 0.5min, 72 ℃ are extended 2min, 32 circulations; 72 ℃ are extended 10min.

7, after the gel recovery test kit recovery of the purpose fragment that obtains after the amplification with TAKARA; 16 ℃ are connected 2～4h with the pMD18-T carrier; Connect product and transform the JM109 competent cell, adopt blue hickie screening transformant, get hickie and carry out the PCR detection; The picking positive transformant send company's order-checking, and what the sequencing result confirmation obtained is pineapple AcPI cDNA full-length gene.

8, sequential analysis

Compare from NCBI search homologous sequence, the result shows AcPI and Stigma Croci (78.6%), Huashan ginger (77.4%), and the homology of orchid (75.7%) and jacinthe (72.4%) is very high.

The AcPI gene belongs to the MADS-box gene; Contain typical MIKC structural domain: the MADS structural domain that has comprised the high conservative of 56-58 amino acid composition; The K box that moderate is conservative; By the faint conservative region I box that about 35 amino acid are formed, the non-conservative region C-terminal of being made up of about 30 amino acid that is rich in hydrophobic residue reaches the conservative PI motif (Fig. 1) by 14 based compositions.These conserved domains and its protein function are closely related.

Two, AcPI expression of gene

The AcPI gene is carried out the real time fluorescent quantitative expression analysis at 8 different sites (blade, pulp, carpopodium, sepal, stamen, bract, apical meristem and petal) of pineapple, to verify its function.

Specific embodiments is following:

When the inflorescence height is 4～5cm, extract total RNA of 8 different sites respectively, measure its concentration with the nucleic acid-protein appearance, quantitatively take out 1 μ g RNA respectively, use the quantitative reverse transcription test kit of TAKARA to carry out reverse transcription, the cDNA that obtains is as the template of quantitative expression.Adopt 18sRNA as internal control gene.

The primer of AcPI quantitative expression:

PIdl-up：GCACCACCAAGAGATGGCGATG

PIdl-dn：AGCAGACAAAGTCGATGGCAGAGA

Reaction system: 95 ℃ of 30sec, 1 circulation; 95 ℃ of 5sec, 53 ℃ of 30sec, 72 ℃ of 30sec, 40 circulations.If the production standard curve adds the reaction of a solubility curve at last: 95 ℃ of 60sec, 56 ℃ of 30sec, 95 ℃ of 30sec, 1 circulation again.

The real time fluorescent quantitative expression of results shows; The AcPI gene all has expression at 8 positions; Expression amount is followed successively by from big to small: stamen＞petal＞sepal＞carpopodium＞apical meristem＞pulp＞blade＞bract (Fig. 2); The AcPI gene is very high at the expression amount of stamen and petal, is 306 times at bract at the expression amount of stamen, and is very little at the expression amount of blade and bract.Explain that the AcPI gene plays a significant role in pineapple flower development process.

Three, the structure that contains AcPI gene plant expression vector

Structure contains the plant expression vector of AcPI gene, changes Arabidopis thaliana over to through pollen tube passage method, further verifies the function of AcPI gene.

1, the amplification of band restriction enzyme site coding region

The primer of design band restriction enzyme site:

PImq-F：TGCTCTAGAATGGGGCGGGGGAAGATCGAGAT

XbaI

PImq-R：CGGGATCCATAGCAGACAAAGTCGATGGCAGA

BamHI

The PCR reaction system: contain the template first chain cDNA 2 μ l in the 25 μ l total reaction volume, each 1 μ l (10 μ mol/L) of upstream and downstream primer, Taq archaeal dna polymerase 0.1 μ l (5U/ μ l), 2x Mix damping fluid 12.5 μ l supply volume with aseptic double distilled water.

The PCR reaction conditions is: 94 ℃ of 3min; 94 ℃ of 30sec, 50 ℃ of 30sec, 72 ℃ of 2min, 35 circulations; 72 ℃ are extended 10min.The PImq that obtains of amplification is with after pMD18-T is connected; Called after pMD18-AcPI; After transforming the JM109 competence, adopt blue hickie screening transformant, get hickie and carry out the PCR detection; The picking positive transformant send company's order-checking, and what the sequencing result confirmation obtained is the AcPI gene that comprises the band restriction enzyme site of coding region.

2, the structure of plant expression vector

From the recombinant plasmid pMD18-AcPI that contains goal gene, downcut the purpose fragment with restriction enzyme Xbal and BamHI; Use XbaI and BamHI double digestion pBI121 carrier simultaneously; After agarose gel electrophoresis separates, reclaim the big fragment that test kit reclaims target gene fragment and pBI121 carrier respectively with TAKARA glue.Utilize the T4DNA ligase enzyme that the AcPI forward is inserted in the pBI121 carrier, will connect product transformed into escherichia coli JM109 competent cell, after PCR identifies, obtain plant expression vector pBI121-AcPI (Fig. 3).

3, plant expression vector imports Agrobacterium

After the competent cell of getting Agrobacterium GV3101 thaws on ice; Add 1 μ g pBI121-AcPI DNA, mixing, ice bath 30min; Place 1min in the liquid nitrogen; Change water-bath 5min in 37 ℃ rapidly over to, melt the back and add the fresh LB substratum (not containing microbiotic) of 0.8ml, in 28 ℃ of shaking culture 2～4h; Get 200 μ l and coat on the LB substratum that contains kantlex (abbreviating Kan as) 50mg/L and Rifampin (abbreviating Rif as) 25mg/L, cultivated 2～3 days for 28 ℃.And bacterium colony is carried out PCR detect.

4, goal gene arabidopsis thaliana transformation

Picking identifies that good positive Agrobacterium mono-clonal contains in the LB liquid nutrient medium of Rif (25mg/l) and Kan (50mg/l) in 10ml, and 28 ℃, 200rpm shaking culture to optical density (OD) (Optical density abbreviates OD as) is about 0.5.Transform previous day, getting 1ml and change in the LB substratum that 100ml contains Rif (25mg/l) and Kan (50mg/l) shaking culture over to and spend the night, second day, when bacterium liquid OD600 is between 1.0～1.5, taking out use.

Prepare the Agrobacterium bacterium liquid 100ml that has transformed the pBI121-AcPI recombinant plasmid; The centrifugal 15min of room temperature 5000rpm; Abandon supernatant; Deposition be suspended in respective volume the infiltration substratum (1/2MS+5% sucrose+0.5g 2-morpholino b acid (abbreviating MES as)/L+Silwet-77 200 μ l/L, pH5.8) in, the bacterium liquid OD600 after resuspended is about 0.8.Agrobacterium suspension is poured in the beaker, the long cultivation cup back-off that Arabidopis thaliana arranged on it, is guaranteed to be partially submerged in the Agrobacterium bacterium liquid more than the lotus throne leaf, soaked 1 minute, during shake frequently.Take out plant, be disposed across in the vinyl disc, seal to keep high humidity, be placed on thermostatic chamber and cultivate with preservative film.Opened preservative film in second day, vertically cultivate.A Zhou Houke contaminates once more as required, to improve transformation efficiency.Cultivate three to around, treat seed maturity after, collect seed, 4 ℃ of preservations after the seasoning.

5, the application of AcPI gene

Is material with Kan resistance T1 for the blade of transgenic arabidopsis plant, extracts genomic dna, is template with DNA, and with PImq-F, PImq-R is that primer carries out pcr amplification, with the not negative contrast of DNA of transgenic arabidopsis blade.The result shows that the AcPI gene has been incorporated in the arabidopsis gene group.The transgenic arabidopsis plant on average buddingged at 20.5 days, and wild-type Arabidopis thaliana plant on average buddingged at 28.2 days, and transfer-gen plant was on average buddingged than non-transformant in advance in 7.7 days.Explain that AcPI has the function that promotes that Arabidopis thaliana is bloomed.Therefore, can use the AcPI gene and regulate the pineapple to bloom time.

The above is merely preferred embodiments of the present invention, is not to be used to limit protection scope of the present invention.

Claims (10)

1. from pineapple, clone the category-B functional gene AcPI that obtains, its nucleotide sequence such as SEQ IDNO:1 for one kind.

2. AcPI gene according to claim 1, its 197 amino acid of encoding contain typical PISTILLATA homologous gene structural domain.

3. AcPI gene according to claim 1, its amino acid sequence coded such as SEQ ID NO:2.

4. AcPI gene according to claim 1; It has comprised 56～58 MADS structural domains that amino acid is formed; The K box, by the I box that 35 amino acid are formed, the non-conservative region C-terminal of being made up of 30 amino acid that is rich in hydrophobic residue reaches the PI motif by 14 based compositions.

5. AcPI gene according to claim 1; Through the real time fluorescent quantitative expression analysis; Said AcPI gene all has expression at pineapple kind " Bali " pulp, carpopodium, sepal, stamen, bract, apical meristem, blade and 8 positions of petal, and expression amount is followed successively by from big to small: stamen＞petal＞sepal＞carpopodium＞apical meristem＞pulp＞blade＞bract.

6. like the application of any described AcPI gene in the claim 1 to 5 in the adjusting Arabidopis thaliana is bloomed; Wherein said AcPI gene with obtain recombinant plasmid after the carrier forward links to each other; With said recombinant plasmid transformed Agrobacterium; Behind the pollen tube passage method arabidopsis thaliana transformation, impel Arabidopis thaliana on average to budding in 7.7 days in advance.

7. the application of AcPI gene as claimed in claim 6 in the adjusting Arabidopis thaliana is bloomed, wherein said plant expression vector is pBI121, said agrobacterium strains is GV3101.

8. like the carrier of any described AcPI gene in the claim 1 to 5.

9. like the host cell of any described AcPI gene in the claim 1 to 5.

10. like the protein of any described AcPI genes encoding in the claim 1 to 5, its aminoacid sequence such as SEQ ID NO:2.

Images