CN111118188A - Visual brucella interspecific identification detection kit - Google Patents
Visual brucella interspecific identification detection kit Download PDFInfo
- Publication number
- CN111118188A CN111118188A CN202010136434.XA CN202010136434A CN111118188A CN 111118188 A CN111118188 A CN 111118188A CN 202010136434 A CN202010136434 A CN 202010136434A CN 111118188 A CN111118188 A CN 111118188A
- Authority
- CN
- China
- Prior art keywords
- brucella
- seq
- primer
- primer pair
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a visual brucella interspecies identification detection kit. The kit comprises eight-tube and ddH containing a mixed system2O and a positive quality control template; the mixed system comprises a PCR Mix, a primer pair and SYBR Green I; each tube in the eight-tube contains a pair of different primers. The kit can be applied to interspecies identification and detection of different Brucella, and realizes quick, simple and convenient and visual detection of PCR products.
Description
Technical Field
The invention relates to the technical field of scientific research and species detection and identification of brucella, in particular to a visual brucella interspecific identification and detection kit.
Background
The brucellosis is a zoonosis, seriously harms the development of the animal husbandry in China and causes serious social public health problems, and because different species of brucella have different host tropisms and different pathogenicity to people and animals, the rapid and accurate identification of pathogens has important significance for the prevention, control and purification of the brucellosis in China. The PCR technology in molecular biology can specifically amplify and identify a large amount of brucella nucleic acid, and can identify different types of brucella simultaneously. Compared with separation identification and immunological methods, the PCR diagnosis has strong specificity and high sensitivity, and plays an important role in the field of nucleic acid detection.
However, the application of brucella field detection is difficult to realize by the traditional molecular biology and immunology diagnosis methods, firstly, the detection time is long, the result judgment detection operation process is complex, and the clinical application is limited, so that the amplification electrophoresis detection of nucleic acid molecules, the quantitative and qualitative detection of an enzyme labeling instrument of the immunology method and the occurrence of false positive are not suitable for field detection, and different types of brucella cannot be identified. How to simplify the operation flow, save the detection time, realize the field detection of the Brucella, and complete the species differentiation and identification of the Brucella, and has important significance for the prevention and control of the brucellosis in China. Secondly, most of the current PCR detection is a single-PCR system and a multiple-PCR system, AMOS-PCR is used as a main part, the detected type is less, and the detection result can be used for judging the type only by means of agarose gel electrophoresis. However, at present, 12 brucella research reports exist, none of the detection methods can provide a reasonable and effective means for field prevention and control and purification of brucella, and at present, there are many domestic and foreign detection methods for brucella, which have advantages and disadvantages, and the detection technology comprises a traditional bacteria isolation culture method, an immunological detection technology and an emerging molecular biology technology. Nucleic acid-based molecular detection methods have become a revolutionary technology for the detection of disease-causing pathogens due to their rapid, sensitive, specific, time-saving and labor-saving characteristics. The brucella detection method is a multiplex PCR technology, and is characterized in that multiple pairs of specific primers are added into the same reaction system, agarose gel electrophoresis detection is carried out, and strain types are distinguished according to different nucleic acid electrophoresis band types of different brucella PCR amplifications. However, how to simplify the complex operation and result judgment process of the technology and meanwhile, the technology can be suitable for rapidly determining the pathogen type on site always troubles researchers.
Disclosure of Invention
The invention aims to provide a visual brucella interspecies identification detection kit. The kit can be applied to interspecies identification and detection of different Brucella, and realizes quick, simple and convenient and visual detection of PCR products.
The invention provides a visual brucella interspecific identification detection kit, which comprises an eight-connecting pipe and ddH containing a mixed system2O and a positive quality control template; the mixed system comprises a PCR Mix, a primer pair and SYBR Green I; each tube in the eight-tube contains a pair of different primers.
Preferably, the mixing system includes a PCR liquid mixing system, a concentrated semi-liquid jelly-like mixing system, and a concentrated dry mixing system.
Preferably, the primer pair comprises 8 pairs of primers:
the sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 1 are respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2;
the sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 2 are respectively shown as SEQ ID NO. 3 and SEQ ID NO. 4;
the sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 3 are respectively shown as SEQ ID NO. 5 and SEQ ID NO. 6;
the sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 4 are respectively shown as SEQ ID NO. 7 and SEQ ID NO. 8;
the sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 5 are respectively shown as SEQ ID NO. 9 and SEQ ID NO. 10;
the sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 6 are respectively shown as SEQ ID NO. 11 and SEQ ID NO. 12;
the sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 7 are respectively shown as SEQ ID NO. 13 and SEQ ID NO. 14;
the sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 8 are shown as SEQ ID NO. 15 and SEQ ID NO. 16, respectively.
Preferably, the PCR Mix comprises 0.1U/. mu.L Taq DNA polymerase, 3mM Mg2+400. mu.M dNTPs and 2 XPCR Buffer.
Preferably, the volume ratio of the PCR Mix to the raw materials for preparing the primer pair in the mixed system is 10: 2.
Preferably, the raw material for preparing SYBR Green I is 0.5-2 muL of 50 XSSYBR Green I based on 10 muL of PCR Mix.
Preferably, the preparation method of the mixed system comprises the following steps:
mixing the PCR Mix with each of 8 pairs of primers, and adding dried SYBR Green I to obtain 8 PCR liquid mixed systems;
or mixing the PCR Mix with each pair of 8 pairs of primers respectively, concentrating, and then adding dried SYBRGreen I respectively to obtain 8 concentrated semi-liquid jelly sample mixed systems;
or mixing the PCR Mix with each primer of 8 pairs of primers respectively, concentrating and drying, and then adding dried SYBR Green I to obtain 8 concentrated and dried mixed systems.
Preferably, the positive quality control template is a recombinant plasmid inserted with each primer pair to amplify a target DNA fragment.
Preferably, the Brucella detected and identified by the kit comprises Brucella melitensis, Brucella epididymis, Brucella suis, Brucella melitensis vaccine strain S19, Brucella melitensis vaccine strain RB51, Brucella melitensis vaccine strain Rev1, Brucella canis, Brucella melitensis, Brucella marinus, Brucella melitensis and Brucella melitensis.
The invention provides a visual brucella interspecies identification detection kit. The invention utilizes Polymerase Chain Reaction (PCR) technology, can carry out field species detection on the Bruce-Ladder by improving the Bruce-Ladder detection method, simplifies detection conditions and steps and greatly shortens detection time. The kit comprises eight-connected tubes and ddH containing a PCR Mix, a primer pair and a SYBR Green I mixed system2O and positive quality control template, and only the sample and ddH are required to be detected2And adding the mixture O into an eight-connection tube, carrying out a PCR amplification procedure, observing each tube by naked eyes or irradiating each tube by using an ultraviolet lamp with the wavelength of 300-500 nm after the reaction is finished, and finishing the identification among Brucella species according to the color or the fluorescence brightness of each tube bottom reaction system. The kit has the advantages of strong specificity, good sensitivity, simple operation, good repeatability, rapid detection, easy result judgment, convenience for field application and the like, and provides a tool for species identification and field detection application of the Brucella.
Drawings
FIG. 1 is a diagram of a concentrated dry PCR reaction system stored in a 8-tube with a cover according to the present invention;
FIG. 2 is a visual chart of the detection result of Brucella epididymis irradiated by 365nm ultraviolet flashlight provided by the invention;
FIG. 3 is an agarose gel electrophoresis chart and a visualization result chart for detecting Brucella melitensis provided by the invention;
FIG. 4 is an agarose gel electrophoresis chart and a visualization result chart for detecting Brucella melitensis provided by the invention;
FIG. 5 is an agarose gel electrophoresis chart and a visualization result chart for detecting Brucella epididymis provided by the invention;
FIG. 6 is an agarose gel electrophoresis chart and a visualization result chart for detecting Brucella in swine provided by the invention;
FIG. 7 is an agarose gel electrophoresis chart and a visualization result chart of the detecting Brucella vaccine strain S19 provided by the invention;
FIG. 8 is an agarose gel electrophoresis chart and a visualization result chart for detecting a Brucella vaccine strain RB51 provided by the invention;
FIG. 9 is an agarose gel electrophoresis chart and a visualization result chart for detecting Brucella melitensis vaccine strain Rev1 provided by the invention;
FIG. 10 is an agarose gel electrophoresis chart and a visualization result chart for detecting Brucella canicola provided by the invention;
FIG. 11 is an agarose gel electrophoresis chart and a visualization result chart for detecting Brucella species in Serratia mice provided by the invention;
FIG. 12 is an agarose gel electrophoresis chart and a visualization result chart for detecting the marine species Brucella provided by the invention;
FIG. 13 is an agarose gel electrophoresis chart and a visualization result chart for detecting Brucella species provided by the present invention;
FIG. 14 is an agarose gel electrophoresis image and a visualization result image of Brucella species for detecting Bifidobacterium longum provided by the present invention;
FIG. 15 is a negative control electropherogram and visualization results provided herein;
FIG. 16 is a schematic diagram of a result determination provided by the present invention;
FIG. 17 is a detection sensitivity chart of the kit using the genome of Brucella epididymis as a template.
Detailed Description
The invention provides a visual brucella interspecific identification detection kit, which comprises an eight-connecting pipe and ddH containing a mixed system2O and a positive quality control template; the mixed system comprises a PCR Mix, a primer pair and SYBR Green I; each tube in the eight-tube contains a pair of different primers.
In the invention, the mixed system comprises a PCR liquid mixed system, a concentrated semi-liquid jelly-like mixed system and a concentrated drying mixed system.
In the present invention, the primer pair comprises 8 pairs of primers:
the sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 1 are respectively shown as SEQ ID NO. 1(ATCCTATTGCCCCGATAAGG) and SEQ ID NO. 2 (GCTTCGCATTTTCACTGTAGC); the primer pair 1 can complete DNA amplification detection aiming at the following different Brucella genomes, and comprises the following steps: brucella (Brucella, abortus), Brucella (B, melitensis), Brucella (B, suis), Brucella (B, abortus) vaccine strain S19, Brucella (B, melitensis) vaccine strain Rev1, Brucella (B, canis), Brucella (B, neotame), Brucella (B, pinnipedialis and B, ceti), Brucella (B, micoti) and Bifidobacterium (B, inopinata).
The sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 2 are respectively shown as SEQ ID NO. 3(GCGCATTCTTCGGTTATGAA) and SEQ ID NO. 4 (CGCAGGCGAAAACAGCTATAA); the primer pair 2 can complete DNA amplification detection aiming at the following different Brucella genomes, and comprises the following steps: the vaccine comprises Brucella melitensis, Brucella epididymis (B.ovis), Brucella suis, Brucella melitensis vaccine strain S19, Brucella melitensis vaccine strain RB51, Brucella melitensis vaccine strain Rev1, Brucella canicola, Brucella arenicola, Brucella marinus, Brucella volvacea and Brucella melitensis.
The sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 3 are respectively shown as SEQ ID NO. 5(TTTACACAGGCAATCCAGCA) and SEQ ID NO. 6 (GCGTCCAGTTGTTGTTGATG); the primer pair 3 can complete DNA amplification detection aiming at the following different Brucella genomes, and comprises the following steps: brucella melitensis, Brucella epididymis, Brucella suis, Brucella melitensis vaccine Rev1, Brucella canicola, Brucella suis, Brucella marinus, Brucella marinum, and Brucella volvacea.
The sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 4 are shown as SEQ ID NO. 7(TCGTCGGTGGACTGGATGAC) and SEQ ID NO. 8(ATGGTCCGCAAGGTGCTTTT), respectively; the primer pair 4 can complete DNA amplification detection aiming at the following different Brucella genomes, and comprises the following steps: the vaccine comprises Brucella melitensis, Brucella epididymis, Brucella suis, Brucella melitensis vaccine strain S19, Brucella melitensis vaccine strain RB51, Brucella melitensis vaccine strain Rev1, Brucella sarmentosa, Brucella marianus, Brucella volvacea and Brucella melitensis.
The sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 5 are respectively shown as SEQ ID NO. 9(GCCGCTATTATGTGGACTGG) and SEQ ID NO. 10 (AATGACTTCACGGTCGTTCG); the primer pair 5 can complete DNA amplification detection aiming at the following different Brucella genomes, and comprises the following steps: the brucella abortus vaccine comprises Brucella abortus, Brucella melitensis, Brucella epididymis, Brucella suis, Brucella abortus vaccine RB51, Brucella melitensis vaccine Rev1, Brucella canis, Brucella serotina, Brucella mariesii, Brucella volvacea and Brucella melitensis.
The sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 6 are respectively shown as SEQ ID NO. 11(GGAACACTACGCCACCTTGT) and SEQ ID NO. 12 (GATGGAGCAAACGCTGAAG); the primer pair 6 can complete DNA amplification detection aiming at the following different Brucella genomes, and comprises the following steps: brucella suis, Brucella canicola, Brucella suis, Brucella volvacea and Brucella divergens.
The sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 7 are shown as SEQ ID NO. 13(CAGGCAAACCCTCAGAAGC) and SEQ ID NO. 14(GATGTGGTAACGCACACCAA), respectively; the primer pair 7 can complete DNA amplification detection aiming at the following different Brucella genomes, and comprises the following steps: brucella melitensis vaccine strain Rev 1.
The sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 8 are shown as SEQ ID NO. 15(CGCAGACAGTGACCATCAAA) and SEQ ID NO. 16(GTATTCAGCCCCCGTTACCT), respectively; the primer pair 8 can complete DNA amplification detection aiming at the following different Brucella genomes, and comprises the following steps: the vaccine comprises Brucella melitensis, Brucella epididymis, Brucella suis, Brucella melitensis vaccine strain S19, Brucella melitensis vaccine strain RB51, Brucella melitensis vaccine strain Rev1, Brucella canicola, Brucella marinus, Brucella microti and Brucella diversicoloris.
In the present invention, the PCR Mix comprises 0.1U/. mu.L Taq DNA polymerase, 3mM Mg2+400. mu.M dNTPs and 2 XPCR Buffer. In the present invention, the Mg2+The source of (B) is preferably MgCl2。
In the present invention, the volume ratio of the raw materials for preparing the PCR Mix and the primer pair in the mixed system is 10: 2. In the present invention, the concentration of the primer is preferably 10. mu.M each. In the invention, the raw material for preparing SYBRGreen I is preferably 0.5-2 mu L of 50 xSYBR Green I based on 10 mu L of PCR Mix. The addition of SYBR Green I enables visual detection.
In the present invention, the preparation method of the mixed system comprises the following steps:
mixing the PCR Mix with each of 8 pairs of primers, and adding dried SYBR Green I to obtain 8 PCR liquid mixed systems;
or mixing PCR Mix with each of 8 pairs of primers, concentrating, and adding dried SYBRGreen I to obtain 8 concentrated semi-liquid jelly sample mixed systems. The method of concentration in the present invention is not particularly limited, and a conventional centrifugal concentration method known to those skilled in the art may be used.
Or mixing the PCR Mix with each primer of 8 pairs of primers respectively, concentrating and drying, and then adding dried SYBR Green I to obtain 8 concentrated and dried mixed systems. The method of concentration and drying in the present invention is not particularly limited, and a conventional vacuum freeze-drying method well known to those skilled in the art may be used.
Preferably, in the specific embodiment of the present invention, the PCR liquid mixing system preferably mixes 10 μ L of PCR Mix with 2 μ L of any pair of primers of the eight sets of primer pairs, and then 0.5 to 2 μ L of 50 × SYBR Green i dry matter is added; the concentrated semi-liquid jelly-like mixed system or the concentrated dry mixed system is preferably prepared by mixing 10 mu L of PCR Mix with 2 mu L of any one pair of eight primer pairs, concentrating or concentrating and drying, and then adding 0.5-2 mu L of 50 xSYBRGreen I dry substance. Specifically, when the kit of the present invention is used, each tube of the PCR liquid mixing system is preferably diluted with a total volume of 10 μ L of liquid for use; each tube of the concentrated semi-liquid jelly-like mixed system or the concentrated dry mixed system is preferably diluted and dissolved with a total volume of 20. mu.L of the liquid.
In the invention, the positive quality control template is a recombinant plasmid inserted into each primer pair to amplify a target DNA fragment. The method for preparing the recombinant plasmid is not particularly limited in the present invention, and a conventional method for preparing a recombinant plasmid known to those skilled in the art may be used.
In the invention, the Brucella detected and identified by the kit comprises Brucella of cattle species, Brucella of sheep epididymis species, Brucella of pig species, Brucella of cattle species S19, Brucella of cattle species RB51, Brucella of sheep species Rev1, Brucella of dog species, Brucella of Salin rat species, Brucella of ocean species, Brucella of hamster species and Brucella of Digitalis of Goubaceae.
When the kit is used for detecting the brucella, the total time is 60-70 min, and the method preferably comprises the following steps:
(1) crude extraction of brucella DNA: the single colony cultured on the plate is inoculated with sterilized loop strain, added into 200 mu L of physiological saline, boiled for 30min, and centrifuged for 30s at 12000g, and 1 mu L of supernatant is taken as a DNA template for PCR amplification (about 0.1 mu g/mu L), or a commercial DNA extraction kit is used for extracting DNA as the template, and the single colony can be extracted and detected immediately, and can also be placed at-20 ℃ for standby.
(2) And (3) PCR amplification: apply 8. mu.L template to 72. mu.L ddH2Mixing O, evenly dividing the mixture into eight tubes with 10 mu L of each tube in an eight-tube connected PCR liquid mixing system, and evenly mixing; or taking 8 μ L template in 152 μ L ddH2Mixing O, evenly dividing into eight tubes containing concentrated semi-liquid jelly sample mixed system or concentrated dry mixed system, wherein each tube has 20 μ L, and fully dissolving the concentrated semi-liquid jelly sample mixed system or concentrated dry mixed system; the amplification procedure was as follows: pre-denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 30S, annealing at 64 ℃ for 50S, extension at 72 ℃ for 32S, and final extension at 72 ℃ for 3min for 27 cycles. A positive control and a negative control are set simultaneously. Adding positive quality control template into positive control, and adding ddH into negative control2And O is used as a template.
(3) After amplification is finished, the eight-tube coupling is turned upside down and shaken for several times, the eight-tube coupling is fully dissolved and uniformly mixed, the eight-tube coupling is subjected to instantaneous centrifugation, a liquid reaction system is collected at the bottom of the eight-tube coupling, the liquid reaction system is observed by naked eyes or is irradiated by an ultraviolet lamp with the wavelength of 300-500 nm, preferably 365nm, the color or the fluorescence brightness of each tube is compared with the positive quality control product, and the type of the Brucella is determined. If the amplified product exists in the reaction, the amplified product is judged to be a positive hole if the amplified product is observed to be green by naked eyes or shows green fluorescence under an ultraviolet lamp; if the reaction is colorless by visual observation or no green fluorescence exists under an ultraviolet lamp, the reaction is judged to be a negative hole, the amplification result is compared with the comparison table 1, and finally the strain is judged.
In the present invention, the 8 pairs of primers, SEQ ID NO 1 and SEQ ID NO 2, SEQ ID NO 3 and SEQ ID NO 4, SEQ ID NO 5 and SEQ ID NO 6, SEQ ID NO 7 and EQ ID NO 8, EQ ID NO 9 and EQ ID NO 10, SEQ ID NO 11 and SEQ ID NO 12, SEQ ID NO 13 and SEQ ID NO 14, SEQ ID NO 15 and SEQ ID NO 16, are numbered 1-8 corresponding to tubes 1-8, respectively. The results are shown in table 1:
TABLE 1 visual interspecies identification comparison table for Brucella
Note: the positive amplification result is indicated by plus, the negative amplification result is indicated by minus, and the brucella plus comprises brucella of sheep species, pig species, ocean species and hamster species, wherein the visual results of the brucella of sheep species and the brucella of ocean species and the brucella of pig species and the brucella of hamster species are the same, but the agarose gel electrophoresis result is different. Because different species of brucella have different host tropisms, when the kit is used in actual field application, the identification of the Brucella melitensis of sheep species and marine species, the Brucella melitensis of pig species and vole species can be determined according to the source of the detected sample, and if necessary, the type can be further determined by agarose gel electrophoresis.
The brucella detection method is improved, the multiplex PCR is changed into the tube-dividing single PCR, the fluorescent dye SYBR Green I is directly added into the product, the result can be directly observed and read by naked eyes, the detection result is judged in the reaction hole, the pollution possibility is reduced, the whole PCR reaction time is only about 60-70 min, the steps of agarose gel electrophoresis, nucleic acid gel imaging system detection and the like are not needed, and the detection time of the original method is greatly shortened. After the improvement, the specificity and the sensitivity of the original method are still ensured, and an application kit is provided for the field visual interspecies identification and detection of the Brucella.
The visualized brucella interspecific identification detection kit of the present invention is further described in detail with reference to the following specific examples, and the technical solution of the present invention includes, but is not limited to, the following examples.
Example 1
Procedure of experiment
Experimental reagent and instrument
Reagent: PCR Mix, SBYR Green I, DL2000 DNA Marker, ddH2O；
The instrument comprises the following steps: small PCR instrument, small centrifuge, single channel liquid transfer device.
Genome extraction
Crude extraction of brucella DNA: the single colony cultured on the plate is inoculated with sterilized loop strain, added into 200 mu L of physiological saline, boiled for 30min, centrifuged for 30s at 12000g/min, and 1 mu L of supernatant is taken as a DNA template for PCR amplification (about 0.1 mu g/mu L), or a commercial DNA extraction kit is used for extracting DNA (the extraction process is carried out according to the operation instruction) as the template, and the single colony can be extracted and detected immediately or can be placed at-20 ℃ for standby.
The primer pairs are shown below:
the primer pair 1 is composed of two sequences shown as SEQ ID NO 1 and SEQ ID NO 2, and the primer pair 1 is directed against Brucella melitensis (B.abortus), Brucella melitensis (B.melitensis), Brucella suis (B.suis), Brucella melitensis (B.abortus) vaccine strain S19, Brucella melitensis (B.melitensis) vaccine strain Rev1, Brucella canis (B.canis), Brucella sarmentosa (B.neotamae), Brucella marini (B.pinipendialis, B.ceti), Brucella microti (B.miconti), and Brucella melitensis (B.inopinata);
a primer pair 2 consisting of two sequences shown in SEQ ID NO 3 and SEQ ID NO 4, wherein the primer pair 2 is directed against Brucella melitensis (B.abortus), Brucella melitensis (B.melitensis), Brucella epididymis ovis (B.ovis), Brucella suis (B.suis), Brucella melitensis (B.abortus) vaccine strain S19, Brucella melitensis (B.abortus) vaccine strain RB51, Brucella melitensis (B.melitensis) vaccine strain Rev1, Brucella canis (B.canis), Brucella sarrinae (B.neootae), Brucella marini (B.pinnipedialis, B.ceuti), Brucella melitensis (B.micans), and Bifidobacterium, see Brucella agana (B.inopoensis);
a primer pair 3 consisting of two sequences shown in SEQ ID NO. 5 and SEQ ID NO. 6, wherein the primer pair 3 is directed against Brucella melitensis (B.melitensis), Brucella epididymidis (B.ovis), Brucella suis (B.suis), Brucella melitensis (B.melitensis) vaccine strain Rev1, Brucella canis (B.canis), Brucella suis (B.neotamae), Brucella marini (B.pinnipedialis, B.ceti) and Brucella microti (B.micrti);
a primer pair 4 consisting of two sequences shown in SEQ ID NO 7 and SEQ ID NO 8, wherein the primer pair 4 is directed against Brucella melitensis (B.abortus), Brucella melitensis (B.melitensis), Brucella epididymis (B.ovis), Brucella suis (B.suis), Brucella melitensis (B.abortus) vaccine strain S19, Brucella melitensis (B.abortus) vaccine strain RB51, Brucella melitensis (B.melitensis) vaccine strain Rev1, Brucella sarrinae (B.neotamae), Brucella marini (B.pinnipedialis, B.ceti), Brucella volvatus (B.micorti), and Strongella melitensis (B.inopinata);
a primer pair 5 consisting of two sequences shown in SEQ ID NO 9 and SEQ ID NO 10, wherein the primer pair 5 is directed against Brucella melitensis (B.abortus), Brucella melitensis (B.melitensis), Brucella epididymis ovis (B.ovis), Brucella suis (B.suis), Brucella melitensis (B.abortus) vaccine strain RB51, Brucella melitensis (B.melitensis) vaccine strain Rev1, Brucella canis (B.canis), Brucella sarrinae (B.neotamae), Brucella marinalis (B.pinnipediis, B.ceoti), Brucella microti (B.microMariotica), Brucella melitensis (B.inolinata);
a primer pair 6 consisting of two sequences shown in SEQ ID NO. 11 and SEQ ID NO. 12, wherein the primer pair 6 is directed against Brucella suis (B.suis), Brucella canis (B.canis), Brucella suis (B.neotomae), Brucella volvacea (B.micoti), and Brucella diversicolor (B.inopinata);
a primer pair 7 consisting of two sequences shown as SEQ ID NO. 13 and SEQ ID NO. 14, wherein the primer pair 7 aims at Brucella melitensis (B.melitensis) vaccine strain Rev 1;
the primer pair 8 is composed of two sequences shown in SEQ ID NO. 15 and SEQ ID NO. 16, and the primer pair 8 is directed against Brucella melitensis (B.abortus), Brucella melitensis (B.melitensis), Brucella epididymis Brucella ovii (B.ovis), Brucella suis (B.suis), Brucella melitensis (B.abortus) vaccine strain S19, Brucella melitensis (B.abortus) vaccine strain RB51, Brucella melitensis (B.melitensis) vaccine strain Rev1, Brucella canis (B.canis), Brucella marinus (B.pinnipedialis, B.ceti), Brucella volvata (B.micrti), and Brucella melitensis (B.inopinata).
PCR amplification
The PCR system was set to 20. mu.L, and 8. mu.L of the template was put in 152. mu.L ddH2O mixing, evenly dividing the mixture into 8-tube sets, fully dissolving 20 mu L of each tube, concentrating and drying the system, and carrying out the following amplification procedure: pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30S, annealing at 64 deg.C for 50S, extension at 72 deg.C for 32S, final extension at 72 deg.C for 3min, and performing 27 cycles of amplification to obtain the final productPCR amplification products are provided with positive and negative controls. Adding positive quality control as template for positive control, and adding ddH for negative control2And O is used as a template.
Determination of results
Fully mixing a reaction mixing system under the condition that a PCR product is inverted upside down, performing instantaneous centrifugation, observing by naked eyes or irradiating by using a 365nm ultraviolet flashlight, judging a detection result according to the color or fluorescence brightness change of the reaction system, and judging a positive hole if the amplified product exists in the reaction if the amplified product is shown by the green fluorescence under the condition of the green fluorescence under the naked eyes or the ultraviolet flashlight; if the reaction is colorless when observed by naked eyes or no green fluorescence exists under an ultraviolet flashlight, the reaction is judged to be a negative hole. The positive control should be green or green fluorescence under the ultraviolet flashlight when observed by naked eyes, and the negative control should be colorless or no green fluorescence under the ultraviolet flashlight when observed by naked eyes, so that the detection experiment is effective. According to the positive or negative result of amplification of each tube of the 8-tube, referring to the visual interspecies identification comparison table of the Brucella in the table 1, and finally judging different Brucella species. The primer pairs are numbered 1-8 and correspond to the tubes No. 1-8 respectively, and the judgment results are shown in Table 1. The identification results are shown in fig. 2-14, fig. 1 is a real object diagram of a concentrated and dried PCR reaction system stored in a covered 8-tube (the PCR reaction system of the present invention includes a PCR liquid mixing system, a concentrated semi-liquid jelly sample mixing system, and a concentrated and dried mixing system); FIG. 15 is a negative control electropherogram and visualization results provided herein; negative control has no positive amplification result, which shows that the invention can be used for identifying the Brucella. Fig. 16 is a schematic diagram for determining the result provided by the present invention, in which the reaction system of the schematic diagram shows fluorescence results corresponding to those in table 1, the reaction system showing green fluorescence in the schematic diagram is the "+" amplification positive result in table 1, and the reaction system not showing green fluorescence in the schematic diagram is the "-" amplification negative result in table 1. FIG. 2 is a visual chart of the detection result of Brucella epididymis irradiated by 365nm ultraviolet flashlight provided by the invention; the tube number sequence of the eight-tube in the figure is from tube number 1 to tube number 8 from left to right, the ultraviolet flashlight is used for successfully carrying out visual identification on the Brucella epididymis, and the results show that tube numbers 2, 3, 4, 5 and 8 are positive and show macroscopic fluorescence. FIG. 3 is an agarose gel electrophoresis chart and a visualization result chart for detecting Brucella melitensis provided by the invention; the ultraviolet flashlight is used for successfully carrying out visual identification on the Brucella melitensis, the result is consistent with the electrophoresis result, and the results show that tubes No. 1, 2, 4, 5 and 8 are positive and show macroscopic fluorescence. FIG. 4 is an agarose gel electrophoresis chart and a visualization result chart for detecting Brucella melitensis provided by the invention; the ultraviolet flashlight is used for successfully carrying out visual identification on the Brucella melitensis, the result is consistent with the electrophoresis result, and the results show that tubes No. 1, 2, 3, 4, 5 and 8 are positive and show macroscopic fluorescence. FIG. 5 is an agarose gel electrophoresis chart and a visualization result chart for detecting Brucella epididymis provided by the invention; the ultraviolet flashlight is used for successfully carrying out visual identification on the Brucella epididymis, the result accords with the electrophoresis result, and the result shows that the No. 2, 3, 4, 5 and 8 tubes are positive and show visible fluorescence. FIG. 6 is an agarose gel electrophoresis chart and a visualization result chart for detecting Brucella in swine provided by the invention; the ultraviolet flashlight is used for successfully carrying out visual identification on the brucella suis, the result is consistent with the electrophoresis result, and the results show that the number 1, 2, 3, 4, 5, 6 and 8 tubes are positive and show visible fluorescence. FIG. 7 is an agarose gel electrophoresis chart and a visualization result chart of the detecting Brucella vaccine strain S19 provided by the invention; the ultraviolet flashlight is used for successfully carrying out visual identification on the Brucella vaccine strain S19, the result is consistent with the electrophoresis result, and the result shows that the number 1, 2, 4 and 8 tubes are positive and show visible fluorescence. FIG. 8 is an agarose gel electrophoresis chart and a visualization result chart for detecting a Brucella vaccine strain RB51 provided by the invention; the ultraviolet flashlight is used for successfully carrying out visual identification on the Brucella vaccine strain RB51, the result is consistent with the electrophoresis result, and the result shows that the No. 2, 4, 5 and 8 tubes are positive and show visible fluorescence. FIG. 9 is an agarose gel electrophoresis chart and a visualization result chart for detecting Brucella melitensis vaccine strain Rev1 provided by the invention; the ultraviolet flashlight is used for successfully carrying out visual identification on the Brucella melitensis vaccine strain Rev1, the result is consistent with the electrophoresis result, and the result shows that the number 1, 2, 3, 4, 5, 7 and 8 tubes are positive and show visible fluorescence. FIG. 10 is an agarose gel electrophoresis chart and a visualization result chart for detecting Brucella canicola provided by the invention; the ultraviolet flashlight is used for successfully carrying out visual identification on the Brucella canicola, the result is consistent with the electrophoresis result, and the results show that tubes No. 1, 2, 3, 5, 6 and 8 are positive and show visible fluorescence. FIG. 11 is an agarose gel electrophoresis chart and a visualization result chart for detecting Brucella species in Serratia mice provided by the invention; the ultraviolet flashlight is used for successfully carrying out visual identification on the Brucella species of the Serratia arenicola, the result is consistent with the electrophoresis result, and the results show that the tubes 1, 2, 3, 4, 5 and 6 are positive and show macroscopic fluorescence. FIG. 12 is an agarose gel electrophoresis chart and a visualization result chart for detecting the marine species Brucella provided by the invention; the ultraviolet flashlight is used for successfully carrying out visual identification on the marine brucella, the result is consistent with the electrophoresis result, and the results show that tubes No. 1, 2, 3, 4, 5 and 8 are positive and show visible fluorescence. FIG. 13 is an agarose gel electrophoresis chart and a visualization result chart for detecting Brucella species provided by the present invention; the ultraviolet flashlight is used for successfully carrying out visual identification on the brucella species of the field rat, the result is consistent with the electrophoresis result, and the results show that the number 1, 2, 3, 4, 5, 6 and 8 tubes are positive and show visible fluorescence. FIG. 14 is an agarose gel electrophoresis image and a visualization result image of Brucella species for detecting Bifidobacterium longum provided by the present invention; the ultraviolet flashlight is used for successfully carrying out visual identification on the brucella melitensis of the agate Bao variety, the result is consistent with the electrophoresis result, and the results show that the tubes 1, 2, 4, 5, 6 and 8 are positive and show macroscopic fluorescence.
Sensitivity detection
The extracted epididymis brucella ovis genome is used as a standard substance, the diluted epididymis brucella ovis genome is diluted by 10 times, the diluted epididymis brucella ovis genome is added into an 8-in-tube system, amplification is carried out under the conditions, ultraviolet lamp irradiation with 365nm wavelength is carried out after the reaction is finished, the sensitivity of the kit is analyzed, the initial concentration of the epididymis brucella ovis genome is measured to be 138.283 ng/muL through a conventional microplate spectrophotometer, as shown in figure 17 (the detection sensitivity graph of the kit is analyzed by using the epididymis brucella ovis genome as a template), the result shows that the visualization result is good when 138.238 pg/muL is detected, and the sensitivity of the invention can reach 138.238 pg/muL.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Jilin university
<120> visual brucella interspecies identification detection kit
<160>16
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atcctattgc cccgataagg 20
<210>2
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
gcttcgcatt ttcactgtag c 21
<210>3
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
gcgcattctt cggttatgaa 20
<210>4
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
cgcaggcgaa aacagctata a 21
<210>5
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
tttacacagg caatccagca 20
<210>6
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
gcgtccagtt gttgttgatg 20
<210>7
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
tcgtcggtgg actggatgac 20
<210>8
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
atggtccgca aggtgctttt 20
<210>9
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
gccgctatta tgtggactgg 20
<210>10
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
aatgacttca cggtcgttcg 20
<210>11
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
ggaacactac gccaccttgt 20
<210>12
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
gatggagcaa acgctgaag 19
<210>13
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
caggcaaacc ctcagaagc 19
<210>14
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
gatgtggtaa cgcacaccaa 20
<210>15
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>15
cgcagacagt gaccatcaaa 20
<210>16
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>16
gtattcagcc cccgttacct 20
Claims (9)
1. Visual identification and detection between brucella speciesThe kit comprises eight-tube and ddH containing a mixed system2O and a positive quality control template; the mixed system comprises PCRMix, a primer pair and SYBR Green I; each tube in the eight-tube contains a pair of different primers.
2. The kit of claim 1, wherein the mixing system comprises a PCR liquid mixing system, a concentrated semi-liquid jelly-like mixing system, and a concentrated dry mixing system.
3. The kit of claim 1, wherein the primer pair comprises 8 primer pairs:
the sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 1 are respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2;
the sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 2 are respectively shown as SEQ ID NO. 3 and SEQ ID NO. 4;
the sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 3 are respectively shown as SEQ ID NO. 5 and SEQ ID NO. 6;
the sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 4 are respectively shown as SEQ ID NO. 7 and SEQ ID NO. 8;
the sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 5 are respectively shown as SEQ ID NO. 9 and SEQ ID NO. 10;
the sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 6 are respectively shown as SEQ ID NO. 11 and SEQ ID NO. 12;
the sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 7 are respectively shown as SEQ ID NO. 13 and SEQ ID NO. 14;
the sum nucleotide sequences of the forward primer and the reverse primer of the primer pair 8 are shown as SEQ ID NO. 15 and SEQ ID NO. 16, respectively.
4. The kit of claim 1, wherein the PCR Mix comprises 0.1U/μ LTaq DNA polymerase, 3mM Mg2+400. mu.M dNTPs and 2 XPCR Buffer.
5. The kit according to claim 1, wherein the volume ratio of the PCR Mix to the raw materials for preparing the primer pair in the mixed system is 10: 2.
6. The kit according to claim 5, wherein the SYBR Green I is prepared from 0.5-2 μ L of 50 XSSYBR Green I based on 10 μ L of LPCR Mix.
7. The kit according to claim 5 or 6, wherein the preparation method of the mixed system comprises the following steps:
mixing the PCR Mix with each of 8 pairs of primers, and adding dried SYBR Green I to obtain 8 PCR liquid mixed systems;
or mixing the PCR Mix with each pair of 8 pairs of primers respectively, concentrating, and then adding dried SYBR Green I respectively to obtain 8 concentrated semi-liquid jelly sample mixed systems;
or mixing PCR Mix with each primer of 8 pairs of primers, concentrating and drying, and adding dried SYBRGreen I to obtain 8 concentrated and dried mixed systems.
8. The kit of claim 1, wherein the positive quality control template is a recombinant plasmid inserted into each primer pair to amplify a DNA fragment of interest.
9. The kit of claim 1, wherein the brucella detected and identified by the kit comprises brucella bovis, brucella melitensis, brucella ovis epididymis, brucella suis, brucella bovis S19, brucella melitensis RB51, brucella melitensis Rev1, brucella canis, brucella arenicola, brucella marinum, brucella volvacea and brucella divergens.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010136434.XA CN111118188A (en) | 2020-03-02 | 2020-03-02 | Visual brucella interspecific identification detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010136434.XA CN111118188A (en) | 2020-03-02 | 2020-03-02 | Visual brucella interspecific identification detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111118188A true CN111118188A (en) | 2020-05-08 |
Family
ID=70493375
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010136434.XA Pending CN111118188A (en) | 2020-03-02 | 2020-03-02 | Visual brucella interspecific identification detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111118188A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101659995A (en) * | 2009-06-24 | 2010-03-03 | 吉林大学 | PCR method for quickly detecting brucella in milk sample |
| CN103602721A (en) * | 2013-07-16 | 2014-02-26 | 黄耀江 | LAMP primer for detecting Brucella and kit containing same |
| CN105200140A (en) * | 2015-10-14 | 2015-12-30 | 中国中医科学院中药研究所 | PCR (Polymerase Chain Reaction) method for identifying geckos and specific primer thereof |
| CN105695620A (en) * | 2016-04-27 | 2016-06-22 | 成都中医药大学 | Method for rapidly detecting Chinese caterpillar fungus |
| CN109266767A (en) * | 2018-10-14 | 2019-01-25 | 中国人民武装警察部队学院 | Live brucella quick detection kit and detection method are probably attacked applied to biology |
-
2020
- 2020-03-02 CN CN202010136434.XA patent/CN111118188A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101659995A (en) * | 2009-06-24 | 2010-03-03 | 吉林大学 | PCR method for quickly detecting brucella in milk sample |
| CN103602721A (en) * | 2013-07-16 | 2014-02-26 | 黄耀江 | LAMP primer for detecting Brucella and kit containing same |
| CN105200140A (en) * | 2015-10-14 | 2015-12-30 | 中国中医科学院中药研究所 | PCR (Polymerase Chain Reaction) method for identifying geckos and specific primer thereof |
| CN105695620A (en) * | 2016-04-27 | 2016-06-22 | 成都中医药大学 | Method for rapidly detecting Chinese caterpillar fungus |
| CN109266767A (en) * | 2018-10-14 | 2019-01-25 | 中国人民武装警察部队学院 | Live brucella quick detection kit and detection method are probably attacked applied to biology |
Non-Patent Citations (3)
| Title |
|---|
| I. LO´PEZ-GON˜I ET AL.: "Evaluation of a Multiplex PCR Assay (Bruce-ladder) for Molecular Typing of All Brucella Species, Including the Vaccine Strains", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
| 中华人民共和国国家质量监督检验检疫总局和中国国家标准化管理委员会: "GB/T 18646-2018 动物布鲁氏菌病诊断技术", 《中华人民共和国国家标准》 * |
| 吴彤等: "动物布鲁氏菌病快速诊断方法研究进展", 《中国人兽共患病学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| DK2547782T3 (en) | METHODS, KITS AND COMPOSITIONS FOR MRSA DETECTION | |
| CN115029459A (en) | Kit for visually detecting Pasteurella multocida based on CRISPR-Cas12a and application | |
| CN111440886A (en) | Primer group, kit and detection method for rapidly detecting carbapenemase gene | |
| CN108192965B (en) | Method for detecting heterogeneity of mitochondrial genome A3243G locus | |
| CN107083446B (en) | Diarrhea pathogenic bacteria multiple gene detection system and kit and application thereof | |
| CN108486223B (en) | Babesia gibsoni RPA molecular detection method | |
| CN107190103B (en) | Multiplex PCR primer group, kit and method for simultaneously detecting three fish viruses | |
| CN109371110B (en) | LAMP (loop-mediated isothermal amplification) detection kit for bacterial canker pathogen of poplar | |
| CN110607398B (en) | RT-LAMP kit for fluorescent visual rapid detection of porcine epidemic diarrhea virus | |
| CN109762910B (en) | Primer and kit for simultaneously detecting two types of echinococcosis | |
| CN116814857A (en) | Cat parvovirus and kit thereof and fluorescent recombinase polymerase amplification method | |
| CN107164506B (en) | Method for detecting multiple sheep babesia and detection kit | |
| CN111118188A (en) | Visual brucella interspecific identification detection kit | |
| CN110760601B (en) | Primer group and kit for simultaneously detecting Brucella, Chlamydia abortus and Clostridium perfringens and application of primer group and kit | |
| JP7440882B2 (en) | Molecular identification technology for thrips | |
| CN107557456B (en) | LAMP (loop-mediated isothermal amplification) detection primer group and kit for ureaplasma urealyticum | |
| CN112899385A (en) | Primer group and probe for identifying Brucella S2 vaccine strain and wild strain and application of primer group and probe | |
| CN111254226A (en) | Primer group, fluorescence visualization RT-LAMP kit and method for rapidly detecting canine distemper virus | |
| CN111197094B (en) | Compositions, kits and methods for genotyping vibrio parahaemolyticus | |
| CN114836581B (en) | Primer combination for detecting pathogens of digestive tract infectious diseases | |
| CN110656190B (en) | Multiple PCR detection kit for common bacterial disease pathogens of cattle | |
| RU2744665C1 (en) | Method for detecting lujo virus rna by reverse transcription and polymerase chain reaction, taking into account real-time results | |
| CN113293223B (en) | Application of primer combination in preparation of reagent for detecting bovine babesia ovale and anaplasma by adopting double PCR (polymerase chain reaction) method | |
| CN109439782B (en) | Kit for identifying and detecting babesia bovis and detection method | |
| CN110184370B (en) | Specific primer for detecting Acinetobacter johnsonii, method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200508 |