CN111118027A - Ornithogalum caudatum ait homologous structural domain transcription factor OtPHD1 gene and application thereof - Google Patents

Abstract

The invention discloses a transcription factor of a homologous structure domain of Ornithogalum caudatumOtPHD1The nucleotide sequence of the gene is shown as SEQ ID NO.1, and the amino acid sequence of the protein coded by the gene is shown as SEQ ID NO. 2; the gene can improve the resistance of plants to saline-alkali stress, provides a valuable target gene for improving the resistance of the plants to the abiotic stress such as saline-alkali stress from the molecular level, and has good application prospect in scientific research and production.

Description

Ornithogalum caudatum ait homologous domain transcription factorOtPHD1Gene and application

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a transcription factor of a homologous domain of Ornithogalum caudatum 'Rohder's eyeOtPHD1Genes and applications thereof.

Background

The adversity stress of plants mainly comprises two major types of biotic adversity and abiotic adversity, the abiotic adversity stresses such as low temperature severe cold, high temperature, drought, salt and alkali and the like are main stress factors which seriously affect the normal growth and development of the plants, limit the quality of ornamental plants such as flowers and the like and improve the ornamental value and economic benefit, and particularly, the salt and alkali of soil are continuously aggravated due to the influence of factors such as continuous cultivation, industrial and agricultural pollution, reverse irrigation of seawater, climate warming and excessive use of pesticides and fertilizers and the like, so that the growth of the plants including the flowers is seriously influenced; therefore, the research on the molecular mechanism of the plant to abiotic stress such as saline-alkali and the like improves the adaptability of the plant to the adverse environment from the molecular level so as to breed a new variety with strong stress resistance, and becomes the main content for the research on the flower genetic breeding and the biotechnology.

The bulb-bulb flower is a perennial herb plant with expanded stem or root of the underground part of the plant and a large amount of nutrients, has more basal leaves, can be used for both flower and leaf appreciation and can be cultivated as a ground cover plant.

Ardisia japonica (Baihuahu eye) Rohdea (Baihuahu eye)Ornithogalum thyrsoides) Is of the genus Ornithogalum of the family Liliaceae (Ornithogalum spp) Perennial bulb-root flowers have the characteristics of various inflorescence flowers, long flowering time, high ornamental value, simple cultivation and the like, are widely applied to cut flowers, pot flowers and landscaping, can also be used for plant ecological restoration of waste land and heavy metal polluted soil, and have wide development potential in ecological civilization construction. The plant growth regulator has the characteristics of strong growth, vigorous vitality, wide application range and the like, shows stronger stress resistance to abiotic adversity stresses such as low temperature, drought, heavy metal, particularly saline alkali and the like, but has an unclear molecular mechanism and is to be deeply researched and utilized.

The PHD transcription factor is a zinc finger protein which is widely existed in eukaryote and has important function in the aspects of gene transcription and chromatin state regulation, has one or more PHD-finger structural domains, and is a transcription factor which can be directly combined with DNA to regulate the expression of downstream genes. Researches in rice and cotton show that the expression level is remarkably improved when the rice is stressed by adversity, the resistance of transgenic rice to the adversity stress such as low temperature, drought, particularly salt and alkali can be enhanced through over-expression of the transgenic rice, and the transgenic rice is stably inherited in later generations; the main agronomic traits of the transgenic rice were also unaffected, remained essentially unchanged, and were not significantly different from the wild type.

Most of the existing stress-resistant genes are downstream genes with single functions such as proline, betaine and the like, and the coded products of the genes directly play a role in stress, but the played functions are often limited; transcription factors which are positioned at the upstream of the gene regulation network and can simultaneously regulate the expression of a plurality of downstream stress-resistant functional genes are less, so that the stress resistance of plants is improved, and the phenomena of dwarf plants, slow development, influence on agronomic traits and the like also occur; the gene for improving stress resistance at the expense of agronomic traits such as yield quality and the like is often very limited in application value in actual production. Therefore, there is a need to provide a novel transcription factor which can systematically regulate and control the synergistic expression of a plurality of downstream stress-resistant genes to enhance the stress resistance of plants and does not substantially influence the agronomic characters of the plants, such as growth, development, yield, quality and the like.

Disclosure of Invention

In view of the above, the invention provides a transcription factor of a homologous domain of Ornithogalum caudatum's eye, which aims at the problems that most of the existing stress-resistant genes are downstream genes with single function, relatively few transcription factors capable of simultaneously up-regulating the expression of a plurality of stress-resistant functional genes and most of the existing transcription factors influence the growth and development of plants and the important agronomic characters of yield and qualityOtPHD1The gene and the application thereof realize the win-win purpose of improving the stress resistance and increasing the yield.

In order to solve the technical problems, the invention discloses a transcription factor of a homologous domain of Ornithogalum caudatum aitOtPHD1A gene comprising the nucleotide sequence of any one of a) or b):

a) a nucleotide sequence shown as SEQ ID NO. 1;

b) the nucleotide sequence shown in SEQ ID NO.1 is replaced, deleted or added with base to form the nucleotide sequence with the same function.

The invention also discloses the transcription factor of the homologous structure domain of Ornithogalum caudatum 'Kadsura' SchneidOt PHD1A protein encoded by the gene.

Alternatively, the amino acid is shown as SEQ ID NO. 2.

The invention also discloses a transcription factor of the homologous structure domain of the Ornithogalum caudatum ait containing the nucleotide sequenceOt PHD1A gene expression vector.

The invention also discloses a host cell containing the expression vector.

The invention also discloses a transcription factor of the homologous domain of the Ornithogalum caudatum's eyeOt PHD1A method for producing a gene, comprising the steps of:

step 1, shearing the excised leaves of the Ornithogalum caudatum on a sterile super clean workbench, and putting the excised leaves on a culture medium containing cytokinin 6BA for excised culture and pearl bud induction;

step 2, after the bulbels are generated on the detached leaves of the star-of-Bethlehem, cutting the bulbels and extracting RNA of the bulbels, and carrying out reverse transcription to obtain a cDNA template;

step 3, carrying out PCR amplification on the cDNA template to obtainOt PHD1PCR products of gene coding regions; the primer for PCR amplification comprisesOt PHD1FAndOt PHD1r, the nucleotide sequences of which are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4; to pairOt PHD1Connecting the gene coding region PCR product to T vector, transferring it into Escherichia coli competence, coating flat plate, performing inverted culture at 37 deg.C, selecting monoclonal for PCR identification and sequencing to obtain the product with nucleotide sequence shown in SEQ ID NO.1Ot PHD1The amino acid sequence of the gene is shown in SEQ ID NO. 2.

The invention also discloses a construction method of the expression vector, and the seamless connection primer used in the method comprises XbaIOt PHD1FAnd KpnIOt PHD1R(ii) a The nucleotide sequences are respectively shown as SEQ ID NO.5 and SEQ ID NO. 6.

The invention also discloses the transcription factor of the homologous structure domain of Ornithogalum caudatum 'Kadsura' SchneidOt PHD1The gene is applied to breeding for improving the resistance of plants to saline-alkali abiotic stress at the molecular level.

Optionally, the plant is a bulb bulbous flower.

Optionally, the bulb bulbous flower is a white tiger eye rohdea japonica.

Compared with the prior art, the invention can obtain the following technical effects:

the invention is toOtThe PHD1 gene is connected to plant expression vector pUB, which is transferred into rice to obtain transgenic rice, which is then separately treated with NaCl and NaHCO in high concentration₃The solution is treated for 7 days, and meanwhile, wild rice is used as a contrast, the transgenic rice can still keep normal growth under the stress of the high-concentration saline-alkali, the growth of the wild rice is seriously influenced, and the phenomena of leaf yellowing, wilting, drooping, curling and the like appear, which shows that the transgenic rice can still keep normal growth under the stress of the high-concentration saline-alkali, and the growth of the wild rice is seriously influenced, so that the wild rice has the defects of leaf yellowingOtThe PHD1 gene can obviously improve the saline-alkali stress resistance of plants, is a valuable important functional gene and has good application prospect in scientific research and production.

Of course, it is not necessary for any one product in which the invention is practiced to achieve all of the above-described technical effects simultaneously.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention and not to limit the invention. In the drawings:

FIG. 1 is a 1% agarose gel electrophoresis of total RNA of the bead buds of Ornithogalum caudatum leaves of the invention; wherein, 1 and 2 are 1% agarose gel electrophoresis bands of total RNA;

FIG. 2 shows the protein conserved sequence analysis of the amino acids encoded by the complete coding region of the Ornithogalum albopictus OtPHHD 1 gene of the invention, together with date (Phoenixdactylifera, accession number: XM _ 008805574), wild banana (Musa acuminata subsp. malacensis, accession number: XM _009395209), oil palm (Elaeis guineensis, accession number: XM _ 010929511), etc.;

FIG. 3 shows pHB + of the present inventionOtPHD1The plant expression vector construction process is shown in the drawing;

FIG. 4 shows the molecular detection of OtPHD1 transgenic rice obtained by the present invention, wherein M is DL2000, 1-5 is transgenic rice, 6 is transgenic empty carrier rice, 7 is wild rice;

FIG. 5 is NaCl salt resistance analysis of OtPHD transgenic rice of the present invention treated with high salt 7d of 200mmol/L NaCl, wherein A: rice transformed with OtPHD gene; b: empty-carrier-transferred rice (CK);

FIG. 6 is a 200mmol/L NaHCO solution of the present invention₃NaHCO of high-alkali 7 d-treated OtPHD1 transgenic rice₃Resistance assay, wherein, a: rice transformed with OtPHD1 gene; b: rice (CK) as empty vector;

Detailed Description

The following embodiments are described in detail with reference to the accompanying drawings, so that how to implement the technical features of the present invention to solve the technical problems and achieve the technical effects can be fully understood and implemented.

Example 1 induction of shoot buds on leaves of Ornithogalum caudatum and cultivation of plant material:

cutting leaves of the sterile tissue culture seedling of the star-leaf rockfoil on a sterilized superclean workbench, transferring the leaves to a culture medium containing cytokinin, growing a plurality of green globules on the surfaces of the leaves gradually after 20-30 days, and beginning to form bulbil buds on the leaves.

The sterile tissue culture seedling of the star-of-Bethlehem is obtained by culturing a tissue culture rapid propagation method (application number: 201610431551.2 application date: 2016-06-16) of the star-of-Bethlehem.

Example 2Ot PHD1Cloning and sequence analysis of the complete coding region of the gene:

step 1, extracting total RNA by taking the bead buds of the leaves of the Ornithogalum caudatum of the white flowered tiger eye as materials, extracting the RNA by adopting the operation steps of a total RNA extraction kit (RNAioso Plus) of a Dalibao creature, and treating all consumables of the kit to ensure that the consumables of the kit do not contain RNase. The detection result of the total RNA of the star-of-Bethlehem through 1 percent agarose electrophoresis is shown in figure 1, two clear and bright spectral bands appear in both the electric lanes a and b, 18S and 28S are complete and good, and the fact that the RNA with higher quality is obtained is proved; the OD is detected by an ultraviolet spectrophotometer₂₆₀/OD₂₈₀Value 1.90, OD₂₆₀OD₂₃₀The value was 2.00, indicating that the RNA quality was good and was available for further testing.

The RNA extraction method comprises the following specific steps: cutting off upper bulbil buds of star-leaved star-like star-leaf of tissue culture glass bottle by scissors, placing into a mortar, adding liquid nitrogen, grinding, carefully placing the homogenate into a 1.5ml EP tube into which the RNAiPlus extracting solution has been added, shaking to make the plant homogenate fully contact with the extracting solution and mix uniformly, standing at room temperature for 5 minutes, then centrifuging at 12000g4 ℃ for 5 minutes on a refrigerated centrifuge, transferring the supernatant into a new 1.5ml EP tube, adding equal volume of chloroform, shaking and mixing uniformly, standing at room temperature for 5 minutes, centrifuging at 12000g4 ℃ for 15 minutes, sucking the supernatant by a pipette gun, transferring into a new centrifuge tube, adding equal volume of isopropanol, standing at room temperature for 10 minutes, centrifuging at 12000g4 ℃ for 10 minutes, sucking the supernatant, rinsing twice by 1ml of 75% ethanol, drying on a super clean bench, and dissolving by a proper amount of DEPC.

Step 2, preparing a cDNA template: the resulting RNA was used as a template to obtain cDNA by reverse transcription using HiScriptII 1 of Novozan^stStrand Cdna Synthesis Kit, 1) preparation of reaction mixture: the following reagents were added sequentially to the rnase-free centrifuge tube: 1uLPrimer (OligodT)₂₃VN), Total RNA6ul, and RNasefrede ddH was added₂O to 12 ul, heating on a PCR instrument for 5 minutes, rapidly placing on ice for quenching, standing on ice for 2 minutes, then adding 10 XRT Mix 2ul and HiScript II Enzyme Mix 2ul, gently mixing uniformly, and then placing on the PCR instrument, wherein the procedure is 50 ℃ for 50 minutes, 85 ℃ for 5 minutes, 2) then adding 1ul RNaseH into the reaction solution, and removing DNA pollution at 37 ℃ for 20 minutes to prepare the bead bud transcriptome on the Rohdea japonica leaves.

And 3, cloning a complete coding region CDS of the gene: obtained from the transcriptome of the upper bead bud of Ornithogalum caudatumOtDWARF53The complete coding region sequence of the gene, designing primers for PCR amplification, wherein the primers are as follows:

OtPHD1F: ATGGTAGTCAACGGCCGGCCGCTGAAG, the nucleotide sequence of which is shown in SEQ ID NO. 3;

OtPHD1R: CTATGGGAGGATGACTACTGTCGGCTGA, the nucleotide sequence is shown in SEQ ID NO. 4.

Gene cloning was performed using Phanta Super-Fidelity DNA Polymerase high Fidelity enzyme, Novozan, 25ul reaction system, 5 XBuffer (with 10mM MgSO4)5ul, 2.5mM dNTP2ul, 2ul forward primer, 2ul reverse primer, 2ul cDNA template, 0.5ul Super-Fidelity DNA Polymerase, and ddH for the remainder₂And (4) complementing O.

And (3) PCR reaction conditions: 95 ℃ for 4 min; 30s at 95 ℃, 30s at 65 ℃ and 2min at 72 ℃; cycle at 35 ℃; 10min at 72 ℃; 4 ℃ and Forever.

OtPHD1After electrophoresis of the gene coding region PCR product in 1% agarose gel, under ultraviolet lamp, DNA of the target band is cut off from the agarose gel carefully with a scalpel, purified and recovered, and Takara pMD-TVector vector system of Takara is adoptedThe ligation reaction was carried out as follows: 5ul Ligation Buffer, 1ul pMD-TVector, 4ul PCR purified product, ddH₂Supplementing O to 10ul, mixing, standing overnight at 16 deg.C, transferring into Escherichia coli competence, coating plate, performing inverted culture at 37 deg.C, selecting monoclonal, and performing PCR identification and sequencing; sequencing analysis is carried out on the obtained positive clone, and the result is foundOtPHD1The length of the gene coding region is 2169bp, the sequence is shown in SEQ ID NO.1, the coded amino acid sequence is shown in SEQ ID NO.2, and the coded amino acid sequence comprises a development reading frame (ORF) with 722 amino acids. Performing Blast comparison on the sequence obtained by sequencing on NCBI to find a homologous sequence of the sequence, and performing homologous sequence comparison by adopting software such as DANMAN (digital data network), as shown in figure 2, performing protein conservative sequence analysis on amino acid coded by the complete coding region of the Rohdea japonica OtPHHD 1 gene, date (accession number: XM _ 008805574), Musa acuminata subsp. malacensis (accession number: XM _009395209), oil palm (Elaeis guineensis, accession number: XM _ 010929511) and the like to show that the similarity with the amino acid is 70.03%, 66.54% and 69.35% respectively, and the conservative region of the homologous gene is included, namely the Rohdea japonica homologous structural domain transcription factor annual transcription factorOt PHD1The gene is related to species such as date, wild banana and oil palmDWARF53The gene has higher homology and is a homologous gene of PHD.

Example 3 pUB +Ot PHD1Construction of plant expression vectors:

selecting positive clone to extract plasmid, designing two seamlessly fused primers according to sequence information of pUB plant expression vector, carrying out PCR amplification on positive plasmid by adopting high fidelity enzyme, carrying out seamless fusion with pHB plant expression vector subjected to linearization treatment to construct plant expression vector, carrying out double enzyme digestion on pUB plant expression vector by adopting XbaI and KpnI to linearize the pUB plant expression vector, purifying, and carrying out plasmid purification according to the above methodOtPHD1The gene cDNA sequence and 15-20 bases near two enzyme cutting sites of XbaI and KpnI of the pUBBGFP vector are designed into seamless connection primers, and the sequences are as follows:

XbaIOtPHD1F: gttgatgtgattacagtctagaATGGTAGTCAACGGCCGGCC, the nucleotide sequence of which is shown as SEQ ID NO.5 is shown in the specification; the lower case part represents a base sequence beside a restriction enzyme site on a plant expression vector, the italic part represents the restriction enzyme site, and the upper case part represents an initiation codon of a target gene and a base sequence behind the initiation codon;

KpnIOtOtPHD1: atcgatggcgcgcctaggtaccTCAGCCGACAGTAGTCATCCT, the nucleotide sequence of which is shown in SEQ ID NO. 6; the lower case part represents a base sequence beside a restriction enzyme site on a plant expression vector, the italic part represents a restriction enzyme site, and the upper case part represents a base sequence behind a termination codon according to a target gene;

and using XbaIOtPHD1FAnd KpnIOtPHD1RAmplifying the obtained cDNA template of the star-like Ornithogalum caudatum, recovering a target band, carrying out seamless fusion connection with a linearized pUBSGFP vector subjected to XbaI and KpnI double enzyme digestion treatment, converting a reaction product into escherichia coli, coating a flat plate, selecting a single clone, shaking the bacteria, extracting a plasmid, sequencing by using a specific primer designed according to the sequence of a target gene, wherein the sequencing result shows that the plant expression vector is successfully constructed, and pHB + isOtPHD1The schematic diagram of the construction process of the plant expression vector is shown in FIG. 3.

Compared with a method for constructing the plant expression vector connected with the T4DNA, the method for constructing the plant expression vector connected with the T4DNA by adopting a seamless fusion plant expression vector construction technology can be completed only by one-time amplification and transformation without connecting to the T vector and carrying out two-time transformation, thereby saving time and reagents; and the method of fast cutting enzyme and double enzyme cutting is adopted, so that the time is saved, and the efficiency is obviously improved.

Example 4 obtaining of transgenic RiceOtPHD1Genetic transformation of rice:

1. culturing the rice young embryo callus:

(1) the hulled mature rice seeds are sterilized by 70% ethanol for 5 min.

(2) Pouring out ethanol, sterilizing for 15min by using 2.5% sodium hypochlorite (adding one drop of Tween 20 per 50 mL), washing with sterile water for 5 times, sterilizing for 15min by using 2.5% sodium hypochlorite, pouring out the sodium hypochlorite, washing with sterile water for 3-4 times, pouring seeds onto sterile filter paper to absorb water, placing embryos on a callus induction culture medium upwards, culturing for 8-10 days by using weak light, selecting callus to transfer onto a subculture medium, continuously culturing under the dark condition, subculturing for once after two weeks, selecting callus with light yellow color for 5-7 days of secondary subculture, and infecting agrobacterium tumefaciens.

2. Preparation of Agrobacterium tumefaciens for genetic transformation of rice:

(1) the plasmid pUBSGFP +OtPHD1Transferring the plant expression vector into agrobacterium tumefaciens LBA4404 competence by a freeze-thaw method, and coating a flat plate;

(2) picking positive colonies on the plate under aseptic conditions, inoculating the positive colonies in a YEB liquid culture medium (Sm +, Kan +), performing shaking culture at 28 ℃ and 200rpm for 24-36 hours;

(3) and centrifuging at 4000g for 5min on a centrifugal machine, discarding the supernatant, and suspending and diluting mycelium by using 1/2MS liquid culture medium to ensure that the OD600 value of the bacterial liquid is about 0.6, namely the agrobacterium tumefaciens suspension for co-culturing and transforming rice.

3. Carrying out genetic transformation on rice by using agrobacterium tumefaciens:

(1) co-culture of Agrobacterium tumefaciens and rice: placing callus with good secondary culture state for 5-7 days and light yellow color into a sterile triangular flask containing Agrobacterium tumefaciens suspension, shaking without time to make the bacterial liquid fully contact with plant material, standing for 20m, pouring off the bacterial liquid, placing the callus on sterile filter paper to absorb excess bacterial liquid, transferring onto co-culture medium, and standing at 28 deg.C in dark for three days;

(2) screening of resistant calli and resistant adventitious buds: and (3) placing the callus after co-culture on a hygromycin screening culture medium containing 50mg/L, transferring to a new screening culture medium after dark culture at 26 ℃ for 14 days, continuing screening for 14 days, enabling milky-white resistant callus to begin to form at the edge, and transferring to a hygromycin differentiation culture medium containing 50mg/L to promote the generation of resistant buds.

(3) Cultivation of positive plants and acquisition of transgenic rice:

when the resistant bud grows to 2cm, transferring the resistant bud to a rooting culture medium, selecting a seedling with a developed root system after two weeks, washing off the culture medium, transplanting the seedling, planting the seedling in a field, cultivating and managing the seedling, and harvesting seeds of the T1 generation for later use.

Example 5 molecular characterization and phenotypic analysis of transgenic Rice

1. PCR identification of transgenic rice: extracting genome DNA of transgenic rice and wild rice by a CTAB method, carrying out agarose gel electrophoresis and enzyme-labeling instrument detection and analysis on the integrality and the concentration of the genome DNA, then carrying out PCR amplification by using the DNA as a template and specific primers (SEQ ID NO.3 and SEQ ID NO. 4) for amplifying target genes of coding regions of the genome DNA, carrying out agarose electrophoresis detection by using empty-transferred rice and wild rice as a control after the PCR amplification is finished, wherein the results are shown in figure 4, and 6-7 are the empty-transferred rice and wild tobacco, and target bands cannot be amplified; 1-5, the transgenosis positive tobacco after hygromycin all amplifies a target strip of about 2000bp, which shows that the target gene is transferred into rice.

2. Rotating shaftOtPHD1The salt tolerance of the gene rice is identified:

harvesting of T1 GenerationOtPHD1Soaking the genetic rice seeds in water, culturing for 3 days to germinate, then carrying out resistance screening by using 50mg/L hygromycin, and taking empty carrier-transferred rice T1 generation seeds as a control; after screening for 5 days, the control plants are dead, the number of resistant seedlings and dead seedlings of the transgenic plants is counted, the resistance segregation ratio of the transgenic plants is analyzed, and seedlings with the segregation ratio of the resistant seedlings to non-resistant seedlings being about 3:1 are selected for culture.

Transferring the plantlet from the culture dish to a triangular flask when the plantlet grows to about 8cm, culturing to three-leaf stage (3 rd leaf is completely unfolded), cleaning the root of the plantlet, selecting plantlets with consistent growth state (thickness and height), and respectively placing the plantlets in high salt (200 mmol/LNaCl) and high alkali (120 mmol/LNaHCO)₃) The Hoagland solution is subjected to salt and alkali stress treatment for about 7 days, wherein the salt solution in the triangular flask is replaced once every other day, and the nutrient solution in the triangular flask is replaced once every other day for 2 days, so that the fresh state of the nutrient solution is maintained.

By obtaining a rotationOtPHD1The high salt (200 mmol/LNaCl) and high alkali (120 mmol/LNaH) are carried out on the genic rice and the wild rice simultaneouslyCO₃) The stress treatment results are shown in fig. 5 and fig. 6, and most of the leaves of the wild rice of the control show pathological manifestations of tiny, wilting, drooping, curling and the like, so that the plants are withered and short and grow obviously bad; only a small part of leaves of the transgenic plant have the phenomenon of yellowing and whitening, but only a few leaves of the transgenic plant have the phenomena of yellowing, wilting and curling, so that the vigorous growth state is basically kept and is obviously better than that of the wild type; the high-salt treatment seriously influences the growth of plants, and the OtPHD1 transgenic rice is slightly influenced and grows well.

The results of the above-mentioned studies show that,OtPHD1the gene rice can obviously improve the resistance to saline-alkali stress and has wide prospect in resistance breeding of plants such as flowers and the like.

While the foregoing description shows and describes several preferred embodiments of the invention, it is to be understood, as noted above, that the invention is not limited to the forms disclosed herein, but is not to be construed as excluding other embodiments and is capable of use in various other combinations, modifications, and environments and is capable of changes within the scope of the inventive concept as expressed herein, commensurate with the above teachings, or the skill or knowledge of the relevant art. And that modifications and variations may be effected by those skilled in the art without departing from the spirit and scope of the invention as defined by the appended claims.

Sequence listing

<110> Sichuan environmental science and technology Limited

Sichuan university of agriculture

Sichuan Tianyi ecological garden group, Ltd

<120> Ornithogalum caudatum ait homologous structural domain transcription factor OtPHD1 gene and application

<130>2020

<141>2020-01-17

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>2169

<212>DNA

<213> white tiger eye permanent greens (Ornithogalum thyrsoides)

<400>1

atggtagtca acggccggcc gctgaagcga gcgaagaggc gggtaaccgc agatctgcac 60

gatttcctca cgtttccgtc ggcggcggcg gccggtgacg ggatctatga ggggccgttc 120

agatccaaca tcagatcgtt cctctcgaag cacgcgaggc tgccgccgcc gccgctggcg 180

ctgatattct caccgtcggc catcacgacg tggcgggtgg cgtttcggat cggcgagggg 240

gatgcggatg agatcgggat ggatgggatc gtggagatgg acgtcgtcga ggaggaggtg 300

atgaggtcga ggtcggtgta ttgcgatcag tgccgagtcg taggttggag tggccacccg 360

gtctgcagga aacgttatca cttcattata aggaacaata gtagcccctt ttctggctat 420

catcagatgt gtacacgctg tggatccgtg ctgcatatgt tggattcacg gtgcgtctca 480

tgcaagtatg agatgacagc tgaagatttt gaagattggg cgtaccgtca attggaagat 540

tctacccact tgttgcatgg agtagtgcat gctaatggct atggccatct tcttagagtt 600

aatggtcgag aagggggttc aaggtgtcta acaggctgtg atattatgag tttttgggat 660

cgcttgtgca aaatgcttcg tgtcaggaag gttacagtta tggacatatc aaaaaaacac 720

gggatggagt atcgtcttct tcatgctgta actgcaggcc atccatggta tggcgagtgg 780

ggttacaagt ttggcgctgg gagctatgct cttactgcag aagcctacca aacagctgtt 840

gactcattgt cgaacattcc cttgtcattc tttttctccc aatcccggtc tccacggacc 900

tccttgcata atgcaattac attatattgg tctcttgctg accggaagct agagactgtg 960

agggatcttt tctgtttcat tacccgtctg cttcatgaat ctcatgagca gtcgaccttg 1020

agacctaatt tcaggaagaa gcttaagaaa gaaggtacct caactgctct ttgtgcatgg 1080

gccaaagatg atgttgagaa ggttgaagag gcaatggtga aagttttacg agctgttggg 1140

acgagccggt gggtaacttg gcatgctctt agaggagcaa catgccgagc agccacttca 1200

cctgagttgc ttgattattg tctcaagggt ttatgcggaa aagtttgcag tgacggtaag 1260

gttgttgctg cccgctgcaa tcctgagaac agtgctatag aatacaggat tgaagctgat 1320

ggtgcggagg aattgttggc aaccagatgt cctattagac catcaactga acacctctta 1380

caagacctta aatttctgta cgacgctctt ctagaccctg ccaccatgca tgcctataaa 1440

ctccggaaga tgcatgaaag tgcacgtagc tcagcagcta agctccttga cggcaagcag 1500

ttcataaaga attatgagga tctaaccaag atgctgcctt cgagtccaca ttccctgtgc 1560

atttggtgtc atgtagaact tgtaaaccag ccaaaaggtt ccccagcccc accgccagag 1620

cttattgtct tgcccttaga tgctaccgtg gctgacctca agcttcaagc aacaaaagct 1680

tttcaagata cctacctggt ttttcaaaag tttcaagcag agcagcttgt tggctgtgga 1740

gatgtgagtg actccactaa tgtcaagcta ctgcttggtg caaatgggag tgtcaaggtc 1800

agaggaagat gttttggaga tgagtgcaag cttggacaat tcaggatgga aagagggctg 1860

gagaattgga ttgtggactg tgcatgtggt gcaaaggatg atgatggaga aaggatgctt 1920

gcctgtgatt cttgtggtgt ttggcagcac actaggtgtg ctgggattag cgatttggac 1980

agggtgcctg taaaattcat ctgtaaaaag tgtttgaaca agagcagaag catccatggt 2040

ggaagcaata gcaatggaaa cagcaaatac aagaacggtc caatggtaaa cggaaggtgc 2100

aaggatgaag tgtcatcatc ttctgtggtc gatgcaaaga gctatgggag gatgactact 2160

gtcggctga 2169

<210>2

<211>722

<212>PRT

<213> white tiger eye permanent greens (Ornithogalum thyrsoides)

<400>2

Met Val Val Asn Gly Arg Pro Leu Lys Arg Ala Lys Arg Arg Val Thr

1 5 10 15

Ala Asp Leu His Asp Phe Leu Thr Phe Pro Ser Ala Ala Ala Ala Gly

20 25 30

Asp Gly Ile Tyr Glu Gly Pro Phe Arg Ser Asn Ile Arg Ser Phe Leu

35 40 45

Ser Lys His Ala Arg Leu Pro Pro Pro Pro Leu Ala Leu Ile Phe Ser

50 55 60

Pro Ser Ala Ile Thr Thr Trp Arg Val Ala Phe Arg Ile Gly Glu Gly

65 70 75 80

Asp Ala Asp Glu Ile Gly Met Asp Gly Ile Val Glu Met Asp Val Val

85 90 95

Glu Glu Glu Val Met Arg Ser Arg Ser Val Tyr Cys Asp Gln Cys Arg

100 105 110

Val Val Gly Trp Ser Gly His Pro Val Cys Arg Lys Arg Tyr His Phe

115 120125

Ile Ile Arg Asn Asn Ser Ser Pro Phe Ser Gly Tyr His Gln Met Cys

130 135 140

Thr Arg Cys Gly Ser Val Leu His Met Leu Asp Ser Arg Cys Val Ser

145 150 155 160

Cys Lys Tyr Glu Met Thr Ala Glu Asp Phe Glu Asp Trp Ala Tyr Arg

165 170 175

Gln Leu Glu Asp Ser Thr His Leu Leu His Gly Val Val His Ala Asn

180 185 190

Gly Tyr Gly His Leu Leu Arg Val Asn Gly Arg Glu Gly Gly Ser Arg

195 200 205

Cys Leu Thr Gly Cys Asp Ile Met Ser Phe Trp Asp Arg Leu Cys Lys

210 215 220

Met Leu Arg Val Arg Lys Val Thr Val Met Asp Ile Ser Lys Lys His

225 230 235 240

Gly Met Glu Tyr Arg Leu Leu His Ala Val Thr Ala Gly His Pro Trp

245 250 255

Tyr Gly Glu Trp Gly Tyr Lys Phe Gly Ala Gly Ser Tyr Ala Leu Thr

260 265 270

Ala Glu Ala Tyr Gln Thr Ala Val Asp Ser Leu Ser Asn Ile Pro Leu

275 280285

Ser Phe Phe Phe Ser Gln Ser Arg Ser Pro Arg Thr Ser Leu His Asn

290 295 300

Ala Ile Thr Leu Tyr Trp Ser Leu Ala Asp Arg Lys Leu Glu Thr Val

305 310 315 320

Arg Asp Leu Phe Cys Phe Ile Thr Arg Leu Leu His Glu Ser His Glu

325 330 335

Gln Ser Thr Leu Arg Pro Asn Phe Arg Lys Lys Leu Lys Lys Glu Gly

340 345 350

Thr Ser Thr Ala Leu Cys Ala Trp Ala Lys Asp Asp Val Glu Lys Val

355 360 365

Glu Glu Ala Met Val Lys Val Leu Arg Ala Val Gly Thr Ser Arg Trp

370 375 380

Val Thr Trp His Ala Leu Arg Gly Ala Thr Cys Arg Ala Ala Thr Ser

385 390 395 400

Pro Glu Leu Leu Asp Tyr Cys Leu Lys Gly Leu Cys Gly Lys Val Cys

405 410 415

Ser Asp Gly Lys Val Val Ala Ala Arg Cys Asn Pro Glu Asn Ser Ala

420 425 430

Ile Glu Tyr Arg Ile Glu Ala Asp Gly Ala Glu Glu Leu Leu Ala Thr

435 440 445

Arg Cys Pro Ile Arg Pro Ser Thr Glu His Leu Leu Gln Asp Leu Lys

450 455 460

Phe Leu Tyr Asp Ala Leu Leu Asp Pro Ala Thr Met His Ala Tyr Lys

465 470 475 480

Leu Arg Lys Met His Glu Ser Ala Arg Ser Ser Ala Ala Lys Leu Leu

485 490 495

Asp Gly Lys Gln Phe Ile Lys Asn Tyr Glu Asp Leu Thr Lys Met Leu

500 505 510

Pro Ser Ser Pro His Ser Leu Cys Ile Trp Cys His Val Glu Leu Val

515 520 525

Asn Gln Pro Lys Gly Ser Pro Ala Pro Pro Pro Glu Leu Ile Val Leu

530 535 540

Pro Leu Asp Ala Thr Val Ala Asp Leu Lys Leu Gln Ala Thr Lys Ala

545 550 555 560

Phe Gln Asp Thr Tyr Leu Val Phe Gln Lys Phe Gln Ala Glu Gln Leu

565 570 575

Val Gly Cys Gly Asp Val Ser Asp Ser Thr Asn Val Lys Leu Leu Leu

580 585 590

Gly Ala Asn Gly Ser Val Lys Val Arg Gly Arg Cys Phe Gly Asp Glu

595 600 605

Cys Lys Leu Gly Gln Phe Arg Met Glu Arg Gly Leu Glu Asn Trp Ile

610 615 620

Val Asp Cys Ala Cys Gly Ala Lys Asp Asp Asp Gly Glu Arg Met Leu

625 630 635 640

Ala Cys Asp Ser Cys Gly Val Trp Gln His Thr Arg Cys Ala Gly Ile

645 650 655

Ser Asp Leu Asp Arg Val Pro Val Lys Phe Ile Cys Lys Lys Cys Leu

660 665 670

Asn Lys Ser Arg Ser Ile His Gly Gly Ser Asn Ser Asn Gly Asn Ser

675 680 685

Lys Tyr Lys Asn Gly Pro Met Val Asn Gly Arg Cys Lys Asp Glu Val

690 695 700

Ser Ser Ser Ser Val Val Asp Ala Lys Ser Tyr Gly Arg Met Thr Thr

705 710 715 720

Val Gly

<210>3

<211>27

<212>DNA

<213> Artificial sequence (Artificial seOuence)

<400>3

atggtagtca acggccggcc gctgaag 27

<210>4

<211>28

<212>DNA

<213> Artificial sequence (Artificial seOuence)

<400>4

ctatgggagg atgactactg tcggctga 28

<210>5

<211>42

<212>DNA

<213> Artificial sequence (Artificial seOuence)

<400>5

gttgatgtga ttacagtcta gaatggtagt caacggccgg cc 42

<210>6

<211>43

<212>DNA

<213> Artificial sequence (Artificial seOuence)

<400>6

atcgatggcg cgcctaggta cctcagccga cagtagtcat cct 43

Claims (10)

1. Ornithogalum caudatum ait homologous domain transcription factorOt PHD1A gene comprising the nucleotide sequence of any one of a) or b):

a) a nucleotide sequence shown as SEQ ID NO. 1;

b) the nucleotide sequence shown in SEQ ID NO.1 is replaced, deleted or added with base to form the nucleotide sequence with the same function.

2. The Ornithogalum caudatum homologous domain transcription factor of claim 1Ot PHD1A protein encoded by the gene.

3. The protein of claim 2, wherein the amino acid sequence is as set forth in SEQ ID No. 2.

4. A Ornithogalum caudatum homologous domain transcription factor containing the nucleotide sequence of claim 1Ot PHD1A gene expression vector.

5. A host cell comprising the expression vector of claim 4.

6. Ornithogalum caudatum ait homologous domain transcription factorOt PHD1A method for producing a gene, comprising the steps of:

step 1, shearing the excised leaves of the Ornithogalum caudatum on a sterile super clean workbench, and putting the excised leaves on a culture medium containing cytokinin 6BA for excised culture and pearl bud induction;

step 2, after the bulbels are generated on the detached leaves of the star-of-Bethlehem, cutting the bulbels and extracting RNA of the bulbels, and carrying out reverse transcription to obtain a cDNA template;

step 3, carrying out PCR amplification on the cDNA template to obtainOt PHD1PCR products of gene coding regions; the primer for PCR amplification comprisesOt PHD1FAndOt PHD1r, the nucleotide sequences of which are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4; to pairOt PHD1Connecting the gene coding region PCR product to T vector, transferring it into Escherichia coli competence, coating flat plate, performing inverted culture at 37 deg.C, selecting monoclonal for PCR identification and sequencing to obtain the product with nucleotide sequence shown in SEQ ID NO.1Ot PHD1The amino acid sequence of the gene is shown in SEQ ID NO. 2.

7. A method of producing the expression vector of claim 4The construction method is characterized in that the seamless connection primer used in the method comprises XbaIOt PHD1FAnd KpnIOt PHD1R(ii) a The nucleotide sequences are respectively shown as SEQ ID NO.5 and SEQ ID NO. 6.

8. The Ornithogalum caudatum homeodomain transcription factor of claim 1Ot PHD1The gene is applied to breeding for improving the resistance of plants to saline-alkali abiotic stress at the molecular level.

9. Use according to claim 8, wherein the plant is a bulb bulbous flower.

10. The use of claim 9, wherein the bulb bulbous flower is Ornithogalum caudatum.

Images