CN111117948A

CN111117948A - Fibroblast culture method

Info

Publication number: CN111117948A
Application number: CN202010039292.5A
Authority: CN
Inventors: 杨一凡; 刘丹; 吴疆; 王保如
Original assignee: Anhui Ruida Health Industry Co ltd
Current assignee: Anhui Ruida Health Industry Co ltd
Priority date: 2020-01-15
Filing date: 2020-01-15
Publication date: 2020-05-08

Abstract

The invention discloses a fibroblast culture method and a culture medium thereof, and fibroblasts obtained by the method. The application adopts the method of co-culturing the culture supernatant containing the stem cell culture medium and the growth culture medium to culture the fibroblasts, thereby not only improving the activity of the fibroblasts and promoting the fibroblasts to secrete collagen, but also shortening the anti-aging and wrinkle-removing time of the fibroblasts, shortening the waiting time for the therapist who needs to be improved urgently, and reducing the economic cost and the time cost of treatment.

Description

Fibroblast culture method

Technical Field

The invention relates to the technical field of cell culture, in particular to a cell culture medium and application thereof, and more particularly relates to a fibroblast culture medium, a culture method thereof and fibroblasts obtained by the method.

Background

Fibroblasts, also called fibroblasts, are the main cellular components of loose connective tissue and belong to terminally differentiated cells, which produce proteins such as collagen. The fibroblasts have the largest number, large cell bodies, and are multi-protruding spindle-shaped or star-shaped flat cells, and the cell nuclei are in a regular oval shape, have unclear cell outlines and have protrusions. The morphology of the cells can be changed according to the functional changes of the cells and the physical properties of the attachment sites.

The fibroblast is large in cell body, weak in cytoplasm alkalophilicity, large in nucleus and oval, loose and light in chromatin and obvious in nucleolus. Under an electron microscope, the cytoplasm of the cell can see rich rough endoplasmic reticulum, free ribosome and developed Golgi complex, which shows that the cell has the function of synthesizing and secreting protein. Fibroblasts can synthesize and secrete collagen fibers, elastic fibers, reticular fibers and organic matrixes. The synthesized procollagen molecules are subjected to endonuclease action, polymerization and rearrangement to form collagen fibrils with 64nm periodic striations, which are the same as collagen fibrils synthesized and secreted by osteoblasts, and the collagen fibrils are bonded with each other to form collagen fibers. Through detection, the collagen fibers synthesized and secreted by the two cells are I-type collagen fibers which are completely identical in morphology and biochemical structure. Fibroblasts in the mature or quiescent state are called fibroblasts because they have small cells, are in the form of long fusiform, and have neither rough endoplasmic reticulum nor Golgi complex developed. Under the stimulation of factors such as trauma, part of the fibroblasts can be converted into immature fibroblasts again, the functional activity of the fibroblasts is recovered, and the fibroblasts participate in the repair of damaged tissues. In addition, in the connective tissue, a small amount of mesenchymal cells having differentiation potential, which can proliferate and differentiate into fibroblasts in the case of wound repair or the like, remain.

laViv autologous fibroblast injection is an autologous fibroblast transplantation cosmetic technology developed by the american company fibrell, and is approved by the U.S. Food and Drug Administration (FDA) for improving severe nasolabial fold wrinkles in adults on 6-22 months in 2011. laViv is an individualized aesthetic cell therapy, which is patented by extracting and proliferating the skin cells, fibroblasts, which are collagen-producing cells of patients themselves. laViv requires 3 consecutive injections with 3-6 weeks between 2 consecutive treatments.

The treatment process is roughly as follows:

(1) taking a skin with a square millimeter of about 3-4 mm from the back of the ear of a patient, separating out fibroblasts in the dermis, and sending the fibroblast to a factory (Fibrocell cGMP) of a manufacturer;

(2) culturing and proliferating a large amount of new cells by the sample fibroblast in a factory, and freezing and storing the new cells for multiple injection treatment;

(3) and during treatment, the cultured and proliferated cells are injected into the autologous skin of a patient, so that the effects of increasing the number of local fibroblasts, promoting the formation of collagen and promoting the self-regeneration and repair process are achieved.

The advantages are that: autologous cells are compatible with the patient's tissue, successfully solving the rejection problem, and can survive in vivo and have therapeutic effects on wrinkles or skin depressions both immediately after injection and for extended periods of time. There is no evidence that the cells are absorbed or lost by the body after injection, and the wrinkle-removing effect is more remarkable with the lapse of time.

The laViv autologous fibroblast injection technique has been carried out in 6000 clinical cases in the uk since 1995, 2000 clinical cases in the us, and up to 6 years in the longest follow-up case. The patient satisfaction is high, and no serious adverse reaction occurs except the adverse reaction at the injection part.

Adverse reactions: in clinical trials, the most common adverse reactions were injection site redness, bruising, swelling, pain, bleeding, edema, nodules, papules, irritation, dermatitis and itching. Injection site reactions were mostly mild to moderate in severity and resolved within 1 week.

Disclosure of Invention

In order to solve the problems of slow effect, high time cost and economic cost of lavv cell reinfusion of the prior human fibroblast in the field of beauty and anti-aging, a cell culture medium, application thereof and a fibroblast culture method are provided, so that the activity of the fibroblast is improved, the fibroblast is promoted to secrete collagen, the anti-aging and wrinkle-removing time of the fibroblast is shortened, the waiting time of a curer who urgently needs to be improved is shortened, and the economic cost and time cost of treatment are reduced.

In order to achieve the purpose, the invention is realized by the following technical scheme:

the invention provides a cell culture medium, which comprises the following culture medium components: growth medium and culture supernatant of stem cell medium.

Wherein the growth medium is: taking high glucose DMEM as a basic culture medium, and adding 0.5-15% (V/V) fetal calf serum and 0.05-1% antibiotic with the concentration of 1%. Wherein the antibiotics are conventional antibiotics in the field of cell culture, such as streptomycin, penicillin, gentamicin and the like.

The culture supernatant of the stem cell culture medium refers to a culture medium used in the stem cell culture process, and a culture solution of the cultured stem cells discarded after the stem cell culture process is changed or passaged is aspirated.

The culture solution of the cultured stem cells which is sucked and discarded is centrifuged to obtain the culture supernatant of the stem cell culture medium.

Wherein the ratio of culture supernatants of the growth medium and the stem cell medium in the cell culture medium is 0.1-100: 0.1-30.

Furthermore, the ratio of the culture supernatants of the growth medium and the stem cell medium in the cell culture medium is 0.1-50: 0.1-10.

Furthermore, the ratio of culture supernatants of the growth medium and the stem cell medium in the cell culture medium is 1-20: 5-10.

Wherein the stem cells can be totipotent stem cells, pluripotent stem cells, multipotent stem cells or specific stem cells which are divided according to functions; or various stem cells classified according to the development process, such as embryonic stem cells, adult stem cells and the like.

Among them, the stem cells are preferably Umbilical Cord Mesenchymal Stem Cells (UCMSC).

It is another object of the present application to provide the use of the above cell culture medium for culturing animal cells, particularly human fibroblasts.

A third object of the present application is to provide a method for culturing fibroblast cells (LaViv), comprising the steps of:

a. obtaining fibroblasts according to the methods conventional in medicine or the field;

b. culturing with the cell culture medium until the cell confluency reaches 80-90%;

c. the above cell culture medium was used for each passage.

The fourth purpose of the present application is to provide a fibroblast (LaViv) and an application thereof, wherein the fibroblast obtained by culturing the cell culture medium has high activity and high collagen secretion amount, and is more suitable for application in the field of beauty treatment and anti-aging.

The invention has the beneficial effects that:

the nutrient components of the culture medium provided by the invention are simple, the preparation is convenient, and the culture medium is applied to culturing fibroblasts, so that the activity of the fibroblasts is improved, the collagen secretion of the fibroblasts is promoted, the anti-aging and wrinkle-removing time of the fibroblasts is shortened after the fibroblasts are applied to a human body, the waiting time of a therapist who urgently needs to be improved is shortened, and the economic cost and the time cost of treatment are reduced; the culture medium used in the invention has simple and convenient components, fully utilizes waste resources, reasonably develops and recycles wastes, changes wastes into valuables and saves the cost.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are some embodiments of the present invention, but not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The experimental procedures in the following examples are conventional unless otherwise specified. The reagent materials and the like used in the following examples are commercially available products unless otherwise specified.

EXAMPLE 1 obtaining culture supernatant of Stem cell Medium

1. Resuscitating umbilical cord mesenchymal stem cells to T-175 culture flask

1.1 according to DMEM: FBS: preparing a cell growth culture medium with the concentration of 1% antibiotic being 100:10:1, and respectively measuring 500ml of DMEM, 50ml of FBS and 5ml of 1% antibiotic, wherein the antibiotic is the antibiotic which is conventionally used in cell culture;

1.2 taking out the cryopreservation tube of the umbilical cord mesenchymal stem cells from the liquid nitrogen storage tank, and unfreezing and recovering the cryopreservation tube in a constant temperature water bath kettle at 37 ℃;

1.3 when the mixture is unfrozen to a state of micro ice crystals, the mixture is quickly transferred into a biological safety cabinet;

1.4 sucking the liquid in the frozen tube into a 15ml centrifuge tube, adding 10ml PBS, uniformly mixing, sucking 200ul for counting, and centrifuging the rest under the centrifugation condition of 400G for 5 min;

1.5 after the centrifugation is finished, discarding the supernatant, transferring the cells into a T-175 culture bottle by using the growth culture medium prepared in the step 1.1, and supplementing the culture medium to 40 ml;

1.6 the T-175 flask was placed in an incubator at 37 ℃ and 5% carbon dioxide concentration for culture.

2. Liquid changing device

2.1, under a microscope, changing the liquid every other day before the confluent rate of the umbilical cord mesenchymal stem cells reaches 80%;

2.2 taking out the T-175 culture bottle from the carbon dioxide incubator and placing the T-175 culture bottle in a biological safety cabinet;

2.3 discard 20ml of original culture medium;

2.4 Add 20ml fresh growth medium;

2.5 shaking up, putting the mixture back to a carbon dioxide incubator for continuous culture;

2.6 centrifuging the original culture medium which is discarded in the step 2.3 to obtain culture supernatant (UCMSC supernatant) of the stem cell culture medium, and storing the culture supernatant to-20 ℃ for later use.

3. Passage of culture

3.1, observing under a microscope, and carrying out passage when the confluence rate of the umbilical cord mesenchymal stem cells reaches 80%;

3.2 taking out the T-175 culture bottle from the carbon dioxide incubator and placing the T-175 culture bottle in a biological safety cabinet;

3.3 absorbing and discarding the culture medium in the T-175 culture flask, centrifuging to obtain a stem cell culture supernatant, and washing the surface of the culture flask by using 10ml of PBS;

3.4 discard PBS, add 5ml pancreatin to digest for 2min30 s;

3.5 observing cell rounding under microscope, adding 35ml growth culture medium, terminating digestion;

3.6 mixing well, sucking 20ml of culture medium into a new T-175 culture bottle;

3.7 adding 20ml of growth culture medium into each of 2T-175 culture bottles, uniformly mixing, and placing in a carbon dioxide incubator for continuous culture;

3.8 the discarded and centrifuged stem cell culture supernatant (UCMSC supernatant) is stored to-20 ℃ for later use.

4. Liquid changing device

4.1, under a microscope, the liquid is changed every other day before the cell confluence rate reaches 80 percent;

4.2 taking out two bottles of T-175 bottles from the carbon dioxide incubator and placing the bottles in a biological safety cabinet;

4.3, respectively removing 20ml of original culture medium by suction, and centrifuging the removed original culture medium to obtain a stem cell culture supernatant;

4.4 adding 20ml of fresh growth medium respectively;

4.5 shaking up, putting the mixture back to a carbon dioxide incubator for continuous culture;

4.6 the obtained culture supernatant of stem cells (UCMSC supernatant) was stored at-20 ℃ for later use.

EXAMPLE 2 fibroblast culture

1. Resuscitating fibroblasts into T-75 culture flask

1.2 taking out the cryopreserved fibroblast tube from the liquid nitrogen storage tank, and unfreezing and recovering the cryopreserved fibroblast tube in a constant-temperature water bath kettle at 37 ℃;

1.4 the liquid in the frozen tube is sucked into a 15ml centrifuge tube, 10ml PBS is added and mixed evenly, 200ul of liquid is sucked for counting, and the rest centrifugation is carried out, wherein the centrifugation parameters are as follows: centrifuging at 1000RPM and 4 deg.C for 10 min;

1.5 taking out a 15ml centrifuge tube after the centrifugation is finished;

1.6 sterilizing the centrifugal tube by a physical method and transferring the centrifugal tube into a biological safety cabinet;

1.7 removing supernatant in the centrifuge tube;

1.8 resuspension of cells using growth medium prepared in step 1.1 above, at 5X 10 cells per flask⁵Cells were inoculated into 4T-75 flasks;

1.9 labeling 4 flasks were: 0% UCMSC supernatant, 25% UCMSC supernatant, 50% UCMSC supernatant, 75% UCMSC supernatant, and supplemented with medium:

1.10 Each of the above groups was placed in a carbon dioxide incubator for cultivation.

2. Liquid changing device

2.1 observing the growth condition of fibroblasts under a microscope, and changing the liquid every other day before the confluence rate reaches 90%;

2.2 gently shake T-75 flasks up and down, removing about 6ml of medium from each flask;

2.3 supplement of the Medium

2.4 shaking the T-75 culture flask lightly and mixing the culture medium uniformly;

2.5 placing the culture bottle in a carbon dioxide incubator for culture.

3. Passage of culture

3.1 observing the growth condition of the cells under a microscope, wherein the confluency reaches 90 percent and then is transmitted to 4T-175 from 4T-75;

3.2 gently shaking the T-75 culture bottle up and down, and removing all the culture medium in the T-75 culture bottle;

3.3 sucking 10ml PBS to a T-75 culture bottle, and washing the culture bottle by lightly shaking for 2 minutes;

3.4 removing the washing solution, sucking 10ml PBS to a T-75 culture flask, and washing by slightly shaking the culture flask for 2 minutes;

3.5 remove all PBS;

3.6 aspirating 2ml of trypsin solution into the above T-75 flask;

3.7 gently shaking the T-75 culture bottles to ensure that the trypsin solution infiltrates into the growth surfaces of all the culture bottles as much as possible;

3.8 placing in a 37.0 carbon dioxide incubator for digestion for 4 minutes;

3.9 observing the cells under a microscope, and when 80-90% of the cells are gathered and become round, lightly beating the wall of the culture bottle to ensure that the fibroblasts completely fall off the T-75 culture bottle;

3.10 Add 10ml growth medium to stop digestion;

3.11 transfer the above solution to a new T-175 flask; supplementing the growth medium and UCMSC supernatant to 40ml according to the proportion;

3.12 gently shake the T-175 flask and mix the medium;

3.13 placing the culture bottle in a carbon dioxide incubator for culture.

4. Liquid changing device

4.1 observing the growth condition of the fibroblasts under a microscope, and changing the liquid every other day before the confluence rate reaches 90 percent;

4.2 gently shake the T-175 flask up and down, remove about 20ml of medium;

4.3 supplement Medium

4.4 shaking the T-175 culture flask gently, and mixing the culture medium uniformly;

4.5 placing the culture bottle in a carbon dioxide incubator for culture.

In the culture of each component of fibroblast, the growth states of each group of fibroblast are not greatly different in morphology through microscope observation, but the growth speed of the fibroblast cultured by adding UCMSC supernatant is higher, when the growth confluency of the fibroblast in 0% UCMSC supernatant group reaches 60%, the growth confluency of the fibroblast added with UCMSC supernatant in the experiment component can reach more than 80%, and the growth confluency of the fibroblast is earlier reached more than 80% along with the increase of the addition amount of UCMSC supernatant, and the growth speed of the fibroblast and the addition amount of the UCMSC supernatant present a dose-dependent relationship.

Example 3 fibroblast culture broth collagen assay

1. Collecting the T-75 liquid during fibroblast culture, discarding supernatant, transferring T-75 to T-175, discarding supernatant of T-175, and detecting collagen in each supernatant

1.1 taking 4 Centricon Pl-70 ultrafiltration devices, and respectively marking and sampling corresponding to a 0% UCMSC supernatant group, a 25% UCMSC supernatant group, a 50% UCMSC supernatant group and a 75% UCMSC supernatant group;

1.2 adding a sample to be concentrated into each filter cup, and covering a cup cover;

1.3 centrifuging 4 filter devices, setting centrifugal parameters: centrifugal force 3500x g, acceleration and deceleration 8, time 35 minutes;

1.4 after the centrifugation is finished, taking out the filtering device, removing all the culture solution in the filtrate collecting cup, placing the cup cover of the filtering cup aside, turning the filtering cup upside down, and placing the filtering cup back in the retentate cup;

1.5 put 4 filter units back into centrifuge, centrifuge parameters set: centrifugal force 1000x g, acceleration and deceleration 8, time 2 minutes;

1.6, taking out 4 filtering devices after the centrifugation is finished;

1.7 remove the retentate cup from the filtration apparatus and take 1ml of each filtrate for collagen detection.

2. Detecting collagen content (unit: ug/ml)

Grouping	0% UCMSC supernatant	25% UCMSC supernatant	50% UCMSC supernatant	75% UCMSC supernatant
					T-75 liquid changing	1337.101	1851.794	1794.749	1844.354
T-75T-175	1560.860	1942.561	1911.569	2026.013
					T-175 liquid changing	1518.114	2001.857	1976.034	1972.928

Example 4 fibroblast telomere detection

The experimental method comprises the following steps: real-time fluorescent quantitative PCR

Sample preparation: the methods of the present application employ fibroblasts cultured with and without UCMSC supernatant, as described in example 2 and example 3, respectively.

DNA extraction: extraction of DNA from fibroblasts was performed according to a method conventional in the art.

And (3) telomere detection: the buffer TE pH8.0 diluted the genomic DNA sample to 35ng/ul, 95 ℃ for 5min, ice bath for 5min, 730g for brief centrifugation. The PCR sample is divided into two parts, the first part is used for detecting the PCR amplification Ct value of the telomere length of the sample, and the second part is used for detecting the PCR amplification Ct value of the internal reference single copy gene. With each reaction containing a standard curve. Preparing 3 multiple wells of standard and sample genomic DNA, wherein the sample comprises the genomic DNA sample to be detected and the control group 36B4 genomic DNA, and the PCR reaction system is as follows: 2 × SYBR Premix Ex Taq, ROX benchmark staining, gene DNA35ng, telomere length amplification primer: tel 1, 90 nM; tel 2, 300 nM; the final concentrations of the control genes 36B4u and 36B4d primer were both 150 nM.

The primers were designed as follows:

Tel 1：GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT：

Tel 2：TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA：

36B4u：CAGCAAGTGGGAAGGTGTAATCC；

36B4d：CCCATTCTATCATCAACGGGTACAA；

the telomere length fluorescence real-time quantitative PCR detection adopts a Prism 7000 sequence detection system, and the PCR conditions are as follows: 10S at 95 ℃, 5S at 95 ℃, 30S at 54 ℃, 31S at 72 ℃, 40 cycles, 7000SDS Software on ABIP, 2^-△CtDetermining telomere/single copy (T/S) ratio, △ Ct ═ C_t ^telomere-C_t ^β2-globinRelative T/S ratio of 2^{-(△Ct1-△Ct2)}＝2^-△△Ct△ Ct 1-denotes the T/S ratio of each sample, △ Ct 2-denotes the T/S ratio of the reference DNA.

Grouping	0% UCMSC supernatant	25% UCMSC supernatant	50% UCMSC supernatant	75% UCMSC supernatant
					Relative T/S ratio	1.06	1.68	2.06	4.44

The research related to aging indicates that the telomere length is gradually shortened along with the increase of the growth time, the functional status of tissues and organs is influenced by acting on cells, the telomere length is inversely proportional to the age, and the telomere is shortened to the terminal replication disorder, so that the aging of the organism and the occurrence of diseases are caused. According to the telomere length measurement, the telomere length of the fibroblasts cultured by the method is longer than that of the fibroblasts cultured without UCMSC supernatant, namely, the fibroblast cultured by the method is indicated to be slow in aging and maintain the physiological function of an organism for a longer time.

EXAMPLE 5 clinical anti-aging and wrinkle-removing

In the clinical experiment center, 6 women of 40-55 years old who are anti-aging and have facial wrinkles removed are selected, wherein 3 people use the fibroblasts obtained by the culture method without adding UCMSC supernatant, 3 people use the fibroblasts obtained by the culture method with adding UCMSC supernatant, the injection is continuously performed for 3 times, the interval time between 2 adjacent treatments on the face is 3 weeks, and the injection parts are facial cheek wrinkles and mouth corner wrinkles. The anti-aging and wrinkle-removing effects of 6 women were observed and recorded every month for 6 months.

Claims

1. A cell culture medium, comprising: the culture medium comprises the following culture medium components: growth medium and culture supernatant of stem cell medium.

2. The cell culture medium of claim 1, wherein: the growth culture medium takes high glucose DMEM as a basic culture medium, and 0.5-15% (V/V) fetal calf serum and 0.05-1% antibiotic with the concentration of 1% are added; the ratio of culture supernatants of the growth medium and the stem cell medium in the cell culture medium is 0.1-100: 0.1-30.

3. The cell culture medium of claim 1, wherein: the culture supernatant of the stem cell culture medium refers to a culture medium used for culturing stem cells, and a culture solution of the cultured stem cells discarded by suction during stem cell replacement or passage in the stem cell culture process.

4. A cell culture medium according to any one of claims 1 and 3, wherein: the stem cells can be totipotent stem cells, pluripotent stem cells, multipotent stem cells or specific stem cells which are divided according to functions; or various stem cells classified according to the development process, such as embryonic stem cells, adult stem cells and the like.

5. The cell culture medium according to claim 4, wherein: the stem cell is preferably Umbilical Cord Mesenchymal Stem Cell (UCMSC).

6. Use of a cell culture medium according to any of claims 1-5, characterized in that: used for culturing cells of various tissues or organs of the human body.

7. Use of a cell culture medium according to claim 6, characterized in that: used for culturing human fibroblasts.

8. A method for culturing fibroblasts, comprising: the culture method comprises the following steps:

c. the above cell culture medium was used for each passage.

9. A fibroblast cell, comprising: culturing the obtained fibroblast using the culture medium of any one of claims 1 to 5 or the method for culturing fibroblast according to claim 8.

10. The application of the waste culture medium for changing the culture solution in the stem cell culture is characterized in that: the waste culture medium of the changed liquid in the stem cell culture is used as a nutrient raw material for cell culture.