JPWO2008150001A1 - adipocluster - Google Patents

Abstract

In preparing a neural stem cell preparation, it is one of the problems to examine whether clonal requirements are necessary, and providing a method for easily preparing neural stem cells is also one of the problems. The present invention is a method for producing Musashi-positive adipose tissue-derived cell-containing cells, comprising a step of providing adipose tissue-derived cells; and a step of subjecting the adipose tissue-derived cells to suspension culture for a period sufficient to cause aggregation. The above problems have been solved by providing a method.

Description

  The present invention relates to stem cells. More specifically, the present invention relates to a stem cell having various uses applicable to a regeneration technique and a production method thereof.

  Regenerative medicine, centered on the use of stem cells, has undergone considerable development in recent years. Conventionally, various tissue stem cells, which were thought to be absent, have been discovered and identified from various tissues. Thus, disease treatment by regenerative medicine is attracting attention.

  However, regenerative medicine has not yet been routinely applied to many patients with organ or tissue dysfunction. To date, it has only been adapted for such patients with limited use of assistive systems in medical devices in addition to organ transplantation. These therapies have problems such as donor shortage, rejection, infection, and service life. In particular, the shortage of donors is a serious problem.

  A fertilized egg is divided into three germ layers of endoderm, mesoderm and ectoderm after gastrulation, and cells derived from ectoderm mainly exist in the brain, and include neural stem cells and the like. Cells derived from mesoderm are mainly present in bone marrow, and include vascular stem cells, hematopoietic stem cells, mesenchymal stem cells, and the like. Endoderm-derived cells are mainly present in the pharynx, lungs, liver, pancreas, intestine, and the like, and include pancreatic stem cells, liver stem cells, and the like.

  It has been found that fat also has stem cells. Adipose-derived stem cells were originally reported as a subtype of mesenchymal stem cells (MSCs) isolated from lipoaspirates that differentiate into mesenchymal tissues such as bone, cartilage and adipose tissue (Non-Patent Document 1). Currently, adipose-derived stem cells are considered as one of the most promising adult stem cells for regenerative medicine (Non-Patent Documents 2 to 3). This is because fat-derived stromal cells can be safely recovered by liposuction and a good yield can be expected.

  As stem cell research has progressed, new concepts of cell differentiation across germ layer boundaries have been discovered. MSCs and adipose-derived stem cells are originally mesodermal, but can differentiate into nervous system (ie, ectoderm) derivatives (Non-Patent Documents 4 and 5). Recently, it has been reported that stem cells having nervous system characteristics can be isolated from mesoderm tissue (eg, dermis and heart) (Non-Patent Documents 6 to 8). In these reports, stem cells with nervous system characteristics have been recovered by the neurosphere method. The neurosphere method was developed as a method for culturing isolated spheres of embryonic and human brain-derived neural stem cells.

  Although it has long been thought that the central nervous system of adult mammals does not regenerate, it has been reported that neural stem cells are also present in the adult central nervous system (Non-patent Document 9). However, the number is small, and a great deal of labor is required for isolation, and it is difficult to actually use in regenerative medicine such as nervous system diseases. Therefore, it is not practical to obtain pluripotent cells of the nervous system from the nervous system. Then, the differentiation of the nervous system using fat has been studied.

The group of Kang, KS et al. Has used adipose tissue stromal cells derived from primates (in Non-patent Documents 10 and 12, acacaesal is used. In Non-patent Document 11, the animals used were “non-human” primates. It was attempted to form neurospheres by culturing in Neurobasal medium ^™ medium developed for the maintenance of nerve cells (Non-patent Documents 10 to 12). . In the report of Kang KS et al., When an adipose-derived stem cell is subjected to adhesion culture in MEM for a long period of time for about one week, a cell mass is generated from the monolayer surface of the cultured cell and released into the culture medium. This is referred to as the above-mentioned Neurobasal medium. The cell mass obtained by transferring to a neurosphere medium containing sucrose and continuing the culture is regarded as neurosphere. This method is completely different from the method of the present invention, and is also quite special when compared with the general neurosphere culture method of neural stem cells. However, Kang KS et al. Referred to the cell mass obtained by this method as neurosphere, and the actually obtained cell mass expressed a neural stem cell marker such as nestin, and also induced neuronal differentiation such as NeuN, MAP2, and NF160 by differentiation induction experiments. Since the marker is expressed, the cell mass reported by Kang KS is considered to have almost the same properties as neurosphere in the conventional sense. That is, it should be regarded as a cell mass produced by selectively proliferating a subpopulation having properties of neural stem cells from a population of adipose-derived stem cells over a period of one week or more. Therefore, in the report of Kang KS et al., It is entirely assumed that adipose-derived stem cells themselves can be directly induced and converted into Musashi-positive or nestin-positive neural stem cells (or progenitor cells) within a short period of 1-2 days. It has not been described or suggested about the method (for example, a method of aggregating cells in a short period of time).

  With regard to this, it can be said that there are evidences in many documents such as Patent Documents 1 to 6 and Non-Patent Documents 4, 5, and 13-22. These documents describe that adipose-derived stem cells appear to have the ability to differentiate into nerves. In these documents, whether or not it has the ability to directly differentiate from adipose-derived stem cells into nerves, or whether or not subpopulation having the properties of neural stem cells can be selectively amplified over a culture period of 1 week or more has been studied. Yes. However, these documents do not describe at all whether cells can be aggregated from fat and can be made Musashi positive or nestin positive in a short period of, for example, 1-2 days. It can be said that fat-derived cells could not be directly induced / converted into neural stem cells (or neural progenitor cells) by aggregating the cells.

  In this field, in spinal cord injury, the timing of cell transplantation is said to be between one week and two weeks after injury (Patent Document 7, Non-Patent Document 14. In Patent Document 7, “Method for creating spinal cord injury monkey model and In the Examples, there is a description of the date of transplantation for “use thereof.” Non-patent document 14 includes an example of a rat (transplantation on the 9th day). It is speculated that the effect will be weak if it is not within a window of about 2 weeks when scar formation starts about 1 week after the end of strong inflammation. In order to prepare transplanted cells in this short period, it is necessary to have a large number of starting cells and to obtain cells for transplantation efficiently. However, a method for preparing cells under such conditions has not yet been established. Absent.

  Since fat, especially adipose-derived stem cells are abundant in supply, if pluripotent cells of the nervous system can be produced using fat-derived, particularly adipose-derived stem cells, nervous system diseases, disorders, etc. It can be said that this will bring about a revolutionary change in the treatment of cancer, and it can be said that the demand for such a method is increasing.

  Conventionally, suspension culture in a neurosphere medium has been recognized as a method for efficiently isolating and proliferating so-called neural stem cells. Originally, clonal cell growth from a single cell is known. The principle was to be a lump. However, the neurosphere that occurs even in the culture under the conventional Clonal condition according to a report of Singec et al. In October 2006 (Non-patent Document 13 = Singec-I et al., Nature Method 3: 801-806, 2006) It has been found that there are many cases in which aggregation is not necessarily clonality (aggregation = aggregation), and it is necessary to re-verify the necessity of clonality. In Non-Patent Document 13, there is no description in the neurosphere of forebrain-derived neural stem cells of newborn mice that predicts matters relating to adipose-derived cells rather than adipocytes.

In addition, since neural stem cells are non-adherent cells, it is only necessary to collect floating cells. Therefore, culture in a serum-free medium is only performed. Even in experiments in which neural crest cells are collected from the skin, heart, etc., only floating cells that are repeatedly cultured in a serum-free medium are collected.
International Publication 2003/008592 Pamphlet Japanese translation of PCT publication No. 2005-502352 (WO03 / 022988) Japanese translation of PCT publication No. 2002-537849 (WO00 / 53795) US Patent Application Publication No. 2001/0033834 Japanese translation of PCT publication No. 2003-523767 (WO01 / 062901) Japanese translation of PCT publication No. 2005-502712 (WO2003 / 024215) International Publication 2003/045137 Pamphlet Zuk PA, Zhu M, Mizuno H, et al. Tissue Eng. 2001; 7: 211-228. Zuk PA, Zhu M, Ashjian P, et al. Mol. Biol. Cell 2002; 13: 4279-4295 Yoshimura K, Shigeura T, Matsumoto D, et al. J. et al. Cell. Physiol. 2006; 208: 64-76 Ashjian PH, Elbarbury AS, Edmonds B, et al. Plast. Reconstr. Surg. 2003; 111: 1922-1931 Kokai LE, Rubin JP, Marra KG. Plast. Reconstr. Surg. 2005; 116: 1453-1460 Toma JG, Akhavan M, Fernandes KJ, et al. Nat. Cell. Biol. 2001; 3: 778-784. Fernandez KJ, McKenzie IA, Mill P, et al. Nat. Cell. Biol. 2004; 6: 1082-1109. Tomita Y, Matsumura K, Wakamatsu Y, et al. J. et al. Cell. Biol. 2005; 170: 1135-1146. Ekayuki Okano, Experimental Medicine, Vol. 20, No. 9, 2002; 1276-1279 Kang SK, Putnam LA, Ylostalo J, et al. J. et al. Cell. Sci. 2004; Aug 15; 117 (Pt 18): 4289-99. Kang SK, Putnam L, Dufour J, et al. Stem Cells 2004; 22: 1356-1372 Bunnell BA, Ylostalo J, Kang SK. Biochem. Biophys. Res. Commun. 2006; May 12; 343 (3): 762-71 Singec-I et al. , Nature Method 3: 801-806, 2006. Watanabe et al. Dev Neurosci 2004; 26: 275-287

  In non-patent document 13, it has been found that even in the culture under the condition of the conventional Clonal, the resulting neurosphere is not necessarily clonal but often aggregating, and it is necessary to re-verify the necessity of clonalness. It is in. It is one of the problems to examine whether or not this clonality requirement is necessary, and to provide a method for easily preparing neural stem cells.

  As described above, in the art, cell spinal cord injury is said to be performed for 1 to 2 weeks after injury. It is speculated that the effect will be weak if it is not within a window of about 2 weeks when scar formation starts about 1 week after the end of strong inflammation. In order to prepare transplanted cells in this short period, it is necessary to have a large number of starting cells and to obtain cells for transplantation efficiently. However, a method for preparing cells under such conditions has not yet been established. Absent. Therefore, establishment of a method capable of processing cells within several days to one week is desired.

Under this background, the present inventors suspended a high-density adipose tissue-derived cell on a specially coated non-adhesive plate in a neurosphere medium, and the neurosphere-like cell mass obtained in 1-3 days was nestin, Musashi. It was found to be positive for neural stem cell markers such as -1. In the prior art, the formation of neurospheres from such tissue stem cells often takes one week or more, and this cell mass was considered to be rather aggregation. That is, there is a possibility that neural stem cells have not been sorted and proliferated, but adipose-derived cells have properties as neural stem cells by stimulating the aggregation itself.
In order to further verify this point, when the same aggregation was made with normal DMEM; 10% FBS instead of the neurosphere medium, surprisingly, this also enhanced the expression of nestin and Musashi-1.
-Therefore, fat-derived aggregation produced by suspension culture at a high concentration on a non-adhesive special coated plate has a completely different meaning from the conventional neurosphere (by the effect of aggregation itself), and further Since this cell mass is considered to have a possibility of being used for other tissue regeneration purposes, this cell mass was particularly called an adipocluster, and the formation method thereof was completed.

  Since neural stem cells are non-adherent cells, it is only necessary to collect floating cells, so that they are only cultured in a serum-free medium. Even in experiments in which neural crest cells are collected from the skin, heart, etc., only the cells that have been repeatedly cultured in a serum-free medium are collected. In a preferred embodiment, the present invention is non-adherent. It is characterized by culturing neural stem cells of cells in a serum-containing medium. Although it is not desired to be bound by theory, conventionally, a treatment for forcibly cultivating was not performed in a non-adhesive or non-adhesive treatment plate, and the present invention employs such a method. Therefore, it should be said that the feature is that the mass of neural stem cells can be efficiently produced. In addition, as non-adhesion treatment, a technique of coating with agarose, mucin, and various other polymers has been known, but it is unexpected that such treatment can efficiently produce neural stem cells. Should be.

  Since the present invention can process cells within a few days to a week, it will be less effective if it is not within a window of about two weeks when scar formation starts about one week after the end of strong inflammation. The transplanted cells can be prepared in a short period of time, satisfying the condition that the number of starting cells is large and the cells for transplantation are efficiently obtained.

  It can be said that the method of the present invention exhibiting such an effect is absolutely effective in practical use compared with other candidate cells (ES cell, aborted fetal neural stem cell, iPS cell, etc.). That is, in terms of practical use, the present invention should be recognized for its usefulness and remarkableness in the sense that “autologous cells” can be obtained “at an appropriate timing”.

Accordingly, the present invention provides the following.
(1) Musashi or nestin positive adipose tissue-derived cells.
(2) The cell according to the above item, wherein the cell exhibits an aggregation state.
(3) The cell according to the above item, wherein the cell derived from adipose tissue is a cell derived from fat in a subcutaneous or inguinal region or an abdominal cavity.
(4) The cell according to the above item, wherein the adipose tissue-derived cell is a pluripotent cell.
(5) The adipose tissue-derived cells are Stromal-vascular-fraction cells collected from the adipose tissue and subjected to collagenase treatment and then collected as pellets, or waste-derived adipose-derived stem cells. A cell according to the above item.
(6) The cell according to the above item, further expressing a marker selected from the group consisting of nestin and CD133.
(7) The cell according to the above item, which expresses an undifferentiated cell marker, a neural stem cell marker, and a neural crest cell marker, but has a low expression of a neural differentiated cell marker.
(8) The cell according to the above item, wherein the undifferentiated cell marker includes Oct3 / 4.
(9) The cell according to the above item, wherein the neural stem cell marker further contains Musashi or nestin.
(10) The cell according to the above item, wherein the neural crest cell marker includes p75 and S100b.
(11) The cell according to the above item, wherein the neuronal differentiation cell marker includes b-III tubulin and Neurofilament.
(12) A composition for nerve regeneration comprising Musashi or nestin positive adipose tissue-derived cells.
(13) The composition described in the above item, wherein the composition is for treating spinal cord injury.
(14) The composition according to item 12, wherein the adipose tissue-derived cell is a cell derived from subcutaneous, inguinal or abdominal fat.
(15) The composition according to the above item, wherein the adipose tissue-derived cell is a pluripotent cell.
(16) The adipose tissue-derived cells are Stromal-vascular-fraction cells collected from the adipose tissue and subjected to collagenase treatment and then collected as pellets, or waste-derived adipose-derived stem cells. A composition according to the above item.
(17) The composition according to the above item, further expressing a marker selected from the group consisting of Musashi or nestin-1 and CD133.
(18) The composition according to the above item, wherein an undifferentiated cell marker, a neural stem cell marker, and a neural crest cell marker are expressed, but the neural differentiated cell marker is low expressed.
(19) The composition according to the above item, wherein the undifferentiated cell marker comprises Oct3 / 4.
(20) The composition according to the above item, wherein the neural stem cell marker further contains Musashi or nestin.
(21) The composition according to the above item, wherein the neural crest cell marker includes p75 and S100b.
(22) The composition according to the above item, wherein the neuronal differentiation cell marker comprises b-III tubulin and Neurofilament.
(23) A method for producing a cell-containing cell derived from Musashi or nestin-positive adipose tissue, the method comprising:
A) providing adipose tissue-derived cells; and B) suspension-culturing the adipose tissue-derived cells for a period sufficient to cause aggregation.
(24) The step of obtaining the adipose tissue-derived cells by collecting adipose tissue or aspirated fat waste liquid before the step A), performing a collagenase treatment, and then collecting it as a pellet by centrifugation. The method described in the above item.
(25) The method according to the above item, comprising the step of A ′) adhering the adipose tissue-derived cell after the step A).
(26) After the step A), A ′) including the step of adhering the adipose tissue-derived cells and then subculturing one or more times to obtain the adipose tissue-derived cells as adipose-derived stem cells (ASC). The method described in the above item.
(27) The suspension culture is performed in M199 medium, DMEM + F12 1: 1 medium or neurosphere medium supplemented with 10% fetal bovine serum, heparin and acidic fibroblast growth factor (aFGF), , DMEM + F12 1: 1, 2% B27 Supplement, 20 ng / μl basic fibroblast growth factor (bFGF), 20 ng / μl epidermal growth factor (EGF).
(28) The method according to the above item, wherein the suspension culture is performed in DMEM supplemented with 10% fetal bovine serum.
(29) The method according to the above item, wherein the container used in the suspension culture is non-adhesive or is coated so as to be non-adhesive.
(30) The method according to the above item, wherein the non-adhesive coating is a coating with an agarose gel.
(31) The method according to the above item, wherein the non-adhesive coating is a coating with 1% agarose gel.
(32) The method according to the above item, wherein the non-adhesive coating is a coating with a Type VII agarose gel.
(33) The method according to the above item, wherein the suspension culture is a medium containing serum and is coated so that a container to be used is non-adhesive or non-adhesive.
(34) The method according to the above item, comprising a step of expressing an undifferentiated cell marker, a neural stem cell marker and a neural crest cell marker, and confirming that the neural differentiated cell marker is lowly expressed.
(35) The method according to the above item, wherein the undifferentiated cell marker comprises Oct3 / 4.
(36) The method according to the above item, wherein the neural stem cell marker further contains Musashi or nestin.
(37) The said neural crest cell marker is the method as described in said item containing p75 and S100b.
(38) The method according to the above item, wherein the neuronal differentiation cell marker comprises b-III tubulin and Neurofilament.
(39) Use of Dulbecco's minimal basal medium (DMEM) or neurosphere medium for production of Musashi or nestin positive adipose tissue-derived cells.
(40) A culture vessel with a non-adhesive coating for production of cells containing Musashi or nestin-positive adipose tissue-derived cells.
(41) A medicament for preventing or treating a nervous system condition, disorder or disease, the medicament comprising Musashi or nestin-positive adipose tissue-derived cell-containing cells.
(42) The medicament according to the above item, wherein the nervous system state, disorder or disease includes spinal cord injury.
(43) Use of Musashi- or nestin-positive adipose tissue-derived cell-containing cells in the manufacture of a medicament for preventing or treating a nervous system condition, disorder or disease.
(44) The use according to the above item, wherein the nervous system state, disorder or disease includes spinal cord injury.
(45) A method for preventing or treating a nervous system condition, disorder or disease, which comprises administering a Musashi- or nestin-positive adipose tissue-derived cell-containing cell to a subject in need of the prevention or treatment A method comprising the steps of:
(46) The method according to the above item, wherein the nervous system state, disorder or disease includes spinal cord injury.

  Accordingly, these and other advantages of the present invention will be apparent upon reading the following detailed description with reference to the accompanying drawings.

  According to the present invention, an aggregation having functions of adipose-derived neural stem cells could be provided. This aggregation can be used for regenerative treatment. In the present invention, further, cells having functions of neural stem cells can be prepared by collecting progenitor cells from fat and subjecting the progenitor cells to aggregation. Furthermore, the present invention also facilitates the treatment of nervous system diseases, disorders or conditions by transplanting the aggregation. These treatments provide a simple and efficient treatment method in regenerative medicine because few side effects are expected and their sources are abundant. According to the present invention, an aggregation having such a special function can be provided at a remarkably high speed. Since fat can be used as a raw material, an effect that a large amount of a mixture having a function of a neural stem cell can be provided is also provided.

  Since the present invention can process cells within a few days to a week, it is presumed that the effect will be weak unless it is within a window of about 2 weeks after scar formation starts about 1 week after the end of strong inflammation. Transplanted cells can be prepared in a short period of time, satisfying the condition that the number of starting cells is large and cells for transplantation are efficiently obtained.

  The method of the present invention that exerts such effects is more practical than other candidate cells (such as ES cells, aborted fetal neural stem cells, iPS cells, etc.). It can be said that it is absolutely effective in the sense that it can be obtained at the timing.

FIG. 1 shows adipocluster obtained by the method of Example 1. Shown in 2 days after method (1). Large ones in the 12-well plate were visible with the naked eye. FIG. 2 shows adipocluster derived from Nestin-EGFPtransgenic rat subcutaneous fat and intraperitoneal fat. Although it is the one day after method (1), EGFP signal is already positive and it is considered that nestin expression is increased. FIG. 3 shows the results of Nestin and Musashi-1 expression (RT-PCR) on day 1 and day 2 of adipocluster culture. FIG. 4 shows a comparison of adipoclusters formed with neurosphere medium (left) and DMEM + 10% FBS (right). FIG. 5 shows marker expression of adipocluster cultured in neurosphere medium and DMEM + FBS. FIG. 6 shows the results of Example 5. From left, M199 + fetal bovine serum (FBS) + fibroblast growth factor (FGF), DMEM / F12, and DMEM / F12 + B27 + epidermal growth factor (EGF) + FGF The adipocluster that was made is shown. In both cases, formation of adipocluster was observed. FIG. 7 shows that in Example 6, adipocluster after 8 days of culture was collected, and the cluster that passed through a 40 μm filter was treated with Trypsin-EDTA. The dispersed cells were suspended in PBS to obtain transplanted cells. The result of having transplanted a cell 9 days after spinal cord injury and analyzing the cell transplantation effect from a BBB score is shown. SCI indicates the time of resection (preparation of spinal cord injury model), and Injection indicates the time of injection. The bold line and the black circle or black triangle curve show the experiment of Adipocluster injection of the present invention. PBS and thin lines and open squares represent transplanted phosphate buffered saline. FIG. 8 shows the result of transplanting dispersed Adipocluster into C57BL / 6 female mice that were crush-injured with 70 kDynes in the 10th thoracic vertebra 9 days after the injury. The number of transplanted cells is Experiment 1: 7.5 × 10 ³ cells / mouse, Experiment 2: 7.5 × 10 ³ cells / mouse. In the mice of the control group injected with PBS containing no cells, there was little recovery thereafter, but in the mice transplanted with Adipocluster, recovery of lower limb function was observed. FIG. 9 shows the relative expression level (fold) of Adipocluster with respect to ASC in planar culture. From the left, GFP mice and wild-type mice are shown in this order, and among these groups, n = 3 and the average is shown. On the left, the total average is shown. When RNA expression was compared, Nestin and p75NTR expression was significantly higher in Adipocluster (*: P <0.05, §: P <0.01).

  SEQ ID NO: 1 is a Nestin forward primer: CTTAGTCTGGAGGTGGCTACATACA.

  SEQ ID NO: 2 is a Nestin reverse primer: GAGGATAGAGAAGAACTAGGCACT.

  SEQ ID NO: 3 is the Musashi-1 forward primer: GGCTTCGTCACTTTCATGGGACCAGGCG.

  SEQ ID NO: 4 is a Musashi-1 reverse primer: GGGAACTGGTAGGGTAAC.

  SEQ ID NO: 5 is an 18S rRNA forward primer: GCCGCTAGAGGTGAAATTCTTG.

  SEQ ID NO: 6 is an 18S rRNA Reverse primer: CATTCTTGGCAAATGCTTTCG.

  SEQ ID NO: 7 is a GAPDH Forward primer: CCTGCACCACCAACTGCCTTA.

  SEQ ID NO: 8 is a GAPDH Reverse primer: GGCCATCCACAGTCTTCTGG.

  SEQ ID NO: 9 is an Oct3 / 4 Forward primer: GCCAAGCTCCCTGAAGCAGAA.

  SEQ ID NO: 10 is an Oct3 / 4 Reverse primer: CAGATGGTCGTTTGGCTGAA.

  SEQ ID NO: 11 is a Nestin Forward primer: TGGCTCCAAGACTTCCCCA.

  SEQ ID NO: 12 is a Nestin Reverse primer: AGGGAAGTTGGGCTCAGGAC.

  SEQ ID NO: 13 is the Musashi1 Forward primer: GGTGGAGGACGGTGAAGCAAT.

  SEQ ID NO: 14 is a Musashi1 Reverse primer: AAACGGTGACAAACCCCGAACC.

  SEQ ID NO: 15 is a p75 Forward primer: TATTCCGACGGAGCCAACC.

  SEQ ID NO: 16 is a p75 Reverse primer: GTGGACCGTGTATATCCAACG.

  SEQ ID NO: 17 is a TUBB (beta III tubulin) Forward primer: GGGGCCTTTGGACATCTTTTT.

  SEQ ID NO: 18 is a TUBB (beta III tubulin) Reverse primer: ACACTCCCTTCGCACCACCACAT.

  SEQ ID NO: 19 is a Neurofilament Forward primer: CTGCAGTCCCGAGGAGTGGTT.

  SEQ ID NO: 20 is a Neurofilament Reverse primer: GCTGACGCCGGTACTCAGTT.

  SEQ ID NO: 21 is a GFAP Forward primer: TTGAGTCGCTGGAGGAGGAG.

  SEQ ID NO: 22 is a GFAP Reverse primer: GCTCCACATGGACCTGCTGT.

The present invention will be described below. Throughout this specification, singular articles (eg, “a”, “an”, “the”, etc. in the English language) are understood to include the concept of the plural unless specifically stated otherwise. Should be. In addition, it is to be understood that the terms used in the present specification are used in the meaning normally used in the art unless otherwise specified. In case of conflict, the present specification (including definitions) will prevail (definition of terms)
Listed below are definitions of terms particularly used in the present specification.

  As used herein, the term “cell” is defined as the broadest meaning used in the art, and is a structural unit of a tissue of a multicellular organism that is enclosed in a membrane structure that isolates the living body from the outside world, Refers to a living organism having self-regenerative ability and having genetic information and its expression mechanism. Any cell can be targeted in the method of the present invention. The number of “cells” used in the present invention can be counted through an optical microscope. When counting through an optical microscope, counting is performed by counting the number of nuclei. The tissue is sliced into tissue slices, and hematoxylin-eosin (HE) staining is performed to separate the extracellular matrix (eg, elastin or collagen) and cell-derived nuclei. This tissue section can be examined with an optical microscope, and the number of nuclei per specific area (for example, 200 μm × 200 μm) can be estimated and counted. The cell used herein may be a naturally occurring cell or an artificially modified cell (for example, a fused cell, a genetically modified cell, etc.). The source of cells can be, for example, a single cell culture, or a normally grown transgenic animal embryo, blood, or body tissue (eg, adipose tissue), or a normally grown cell line Examples include, but are not limited to, cell mixtures such as derived cells. Moreover, such a supply source can also be used as a cell as it is.

  The adipocytes (fat cells or adipocytes) used in the present invention and their counterparts can be any organism (for example, eel eels, lampreys, cartilaginous fish, teleosts) as long as the following organisms have adipocytes or their counterparts. , Amphibians, reptiles, birds, mammals, etc.). Preferably, mammals (e.g., single pores, marsupials, rodents, wings, wings, carnivores, carnivores, long noses, odd-hoofed animals, even-hoofed animals, rodents, Scales, sea cattle, cetaceans, primates, rodents, rabbits, etc.). In one embodiment, cells derived from primates (eg, chimpanzees, Japanese monkeys, humans), particularly cells derived from humans, are used, but are not limited thereto.

  As used herein, the term “stem cell” refers to a precursor cell (precursor or progenitor) of a differentiated cell, which is unipotency, multipotency, totipotency ( topopotency). As used herein, “stem cell” can be used interchangeably with “progenitor cell”. Therefore, it is understood that ASC of this specification is also contained in a stem cell. Stem cells can be differentiated in response to specific stimuli. Stem cells are usually able to regenerate the tissue when the tissue is damaged. Stem cells as used herein can be, but are not limited to, embryonic stem (ES) cells or tissue stem cells (also referred to as tissue stem cells, tissue-specific stem cells or somatic stem cells) or other progenitor cells. In addition, as long as it has the above-mentioned ability, an artificially produced cell (for example, a fusion cell or a reprogrammed cell used in the present specification) can also be a stem cell. Embryonic stem cells are pluripotent stem cells derived from early embryos. Embryonic stem cells were first established in 1981, and have been applied since 1989 to the production of knockout mice. In 1998, human embryonic stem cells were established and are being used in regenerative medicine. Unlike embryonic stem cells, tissue stem cells are cells that have a relatively limited degree of differentiation, exist in the tissue, and have an undifferentiated intracellular structure. Tissue stem cells have a high nucleus / cytoplasm ratio and poor intracellular organelles. Tissue stem cells generally have pluripotency, have a slow cell cycle, and remain proliferative for the life of the individual. As used herein, stem cells may preferably be embryonic stem cells, although tissue stem cells can also be used depending on the circumstances.

  As used herein, the term “stem cell” may refer to a tissue containing at least a certain amount of stem cells or progenitor cells. Therefore, stem cells can be used stem cells collected from adipose tissue after collagenase treatment (for example, adipose-derived stem cells used in the following Examples), but are not limited thereto.

  When classified according to the site from which the cells are derived, tissue stem cells are classified into, for example, the skin system, digestive system, myeloid system, nervous system, and the like. Examples of skin tissue stem cells include epidermal stem cells and hair follicle stem cells. Examples of digestive tissue stem cells include pancreatic (common) stem cells and liver stem cells. Examples of myeloid tissue stem cells include hematopoietic stem cells and mesenchymal stem cells. Examples of nervous system tissue stem cells include neural stem cells and retinal stem cells.

  As used herein, the term “mesenchymal stem cell” refers to a stem cell found in the mesenchyme. The term “mesenchymal stem cell” may be abbreviated herein as “MSC”. Here, the mesenchyme is formed by a population of free cells with stellate or irregular projections that fill the gaps between epithelial tissues, which are observed at each stage of development of multicellular animals, and the accompanying cytoplasm An organization. Mesenchymal stem cells have the ability to proliferate and differentiate into bone cells, chondrocytes, muscle cells, stromal cells, tendon cells, and adipocytes. Mesenchymal stem cells are used to culture or proliferate bone marrow cells collected from patients and differentiate them into chondrocytes or osteoblasts. For example, bones such as alveolar bone, arthropathy, cartilage, joints, etc. It is used as a reconstruction material, and its demand is great. In addition, since mesenchymal stem cells can differentiate into blood cells and lymphoid cells, the demand for them is increasing.

  As used herein, the term “adipose-derived stem cell” refers to a stem cell obtained by liposuction and also other progenitor cells (eg, peripheral blood or vascular stromal cells ( Stem cells derived from preadipocytes). Adipose-derived stem cells refer to a population of any pluripotent precursor cells or monopotent precursor cells derived from adipose tissue or obtained by a liposuction procedure . These include adipose-derived vascular stromal cells (adipose precursor cells, adipose-derived interstitial cells or adipose-derived stromal cells), adipose-derived stem cells, adipose-derived precursor cells, adipose stem cells, endothelial cells Examples include progenitor cells and hematopoietic stem cells. Some of such stem cell separation methods are known, and are described in, for example, Non-Patent Document 1, Patent Documents 1 and 2. The matters described in these documents are incorporated herein by reference in a particularly related place. As used herein, the term “adipose-derived stem cells” refers to all adipose tissue-derived stem cells, including adipose tissue-derived stem cells obtained by these known separation methods. As used herein, the term “progenitor cell” includes not only pluripotent undifferentiated cells but also unipotent undifferentiated cells. As used herein, the term “stem cell” includes progenitor cells.

  As used herein, the term “adipose tissue-derived cell” refers to any cell derived from adipose tissue, including, for example, cells derived from lipoaspirate. Typically, it includes, but is not limited to, any cell derived from adipose tissue including “adipose-derived stem cells”. The typical fat markers are shown below.

  In addition, it can be identified by confirming GLUT4 (accession number M20747 (human)) and PPARγ (accession number L40904 (human)) as a fat differentiation marker, or positive for oil red O Can be confirmed. The confirmation method is as follows: cultured cells are fixed with 4% paraformaldehyde for 10 minutes and stained with 0.18% oil red O staining solution for 15 minutes.

  The aspirate collected by liposuction is separated into two layers in a suction bottle. The upper layer of the aspirate is composed of a floating fat portion (lipoaspirate), and the lower layer is composed of a liquid portion (liquid-aspirate or liposuction-aspirate fluid). As used herein, the term “PLA (processed lipoaspirate cell)” refers to a progenitor cell obtained from the aspirated fat of the aspirate by liposuction. As used herein, the term “LAF cells (liquid-aspirate cells or liposuction-aspirate fluid cells) refers to progenitor cells derived from the liquid portion of the aspirate from liposuction. The derived stem cells include PLA cells and LAF cells.

  As used herein, the term “somatic cell” refers to all cells that are cells other than germ cells, such as eggs and sperm, and that do not deliver the DNA to the next generation. Somatic cells usually have limited or disappeared pluripotency. Somatic cells used herein may be naturally occurring or genetically modified as long as the intended treatment can be achieved.

  As used herein, “neural stem cell” refers to a cell that can differentiate into the nervous system and also has pluripotency. Neural stem cells can be identified by confirming cell stem markers and pluripotency of neural stem cells.

  As used herein, preferably, a stem cell may have self-replicating ability, but is not limited thereto, and even a cell that does not have self-replicating ability has pluripotency. It is understood that it is within the range of stem cells. Self-replicating ability means the ability to repeat division and generate the same cell population as self). The “self-renewal ability” of a neural stem cell can be confirmed by, for example, the neurosphere method. The neurosphere method is the method originally reported by Reynolds et al., J Neurosci 1992; 12: 4565-4574 and Science 1992; 255: 1707-1710. The neurosphere method is one of the most frequently used methods for isolating neural stem cells from the embryonic or adult central nervous system. As an example of the neurosphere method, neural stem cells are cultured in a floating state in the presence of epidermal growth factor (EGF) and basic fibroblast growth factor (basic-FGF, b-FGF) as growth factors. A step of forming a neurosphere composed of cells, a step of dissociating the formed neurosphere, seeding the dissociated cell in a new medium, and a step of confirming whether or not the dissociated cell forms a neurosphere again There is a method that includes: In this method, when a dissociated cell forms a neurosphere again, it is determined as a neural stem cell.

  As used herein, for neural cells, “pluripotent” or “multipotent” refers to a plurality of cells of the nervous system such as nerve cells and glial cells (astrocytes, oligodendrocytes, etc.). The ability to differentiate into. The pluripotency of neural stem cells differentiated into neuronal systems such as neuronal cells and glial cells (astrocytes, oligodendrocytes, etc.) when neurospheres were placed under differentiation conditions into neural cells. If the cell is determined to have pluripotency. Preferably, pluripotency refers to having the ability to differentiate into cells of multiple nervous systems, but is not limited thereto. As differentiation conditions for cells of the nervous system, for example, differentiation medium to the nervous system (for example, DMEM / F12: 49 ml in nerve induction medium (50 ml), nerve inducer (for example, B27 (GIBCO)): 1 ml, 1 week of culture (which may include antibiotics), but is not limited to this, culturing while changing half of the medium every 2 days. As differentiation conditions for glial cells, for example, a glial induction medium (in 50 ml of medium, DMEM / F12: 45 ml, FBS: 5 ml, may contain antibiotics) for 1 week (half volume of medium every 2 days) But is not limited to these. The neurotrophic factor that can be used herein may be any as long as it has an action of assisting or promoting nerve induction. In one embodiment, the neural inducer is biotin, L-carnitine, corticosterone, ethanolamine, D (+)-galactose, glutathione (reduced), linoleic acid, linolenic acid, progesterone, retinyl acetate, selenium. , Triiodothyronine (T3), DL-α-tocopherol, DL-α-tocopherol acetate, albumin (bovine), catalase, insulin, superoxide dismutase, transferrin. Examples of neural pluripotent cells include neural stem cells, neural crest cells, neural progenitor cells, and the like.

  Neural stem cells can also be identified using only neural stem cell markers.

  As used herein, “neural stem cell marker” refers to a neural stem cell whose localization or expression assists in identifying neural stem cells. Preferably, its localization or expression (eg, Nestin (NM006617 (human)), Musashi-1 (NM002442 (human)), CD133 (NM0006017 (human)), notch1 (NM0176617 (human)), Hes1 (NM005524 (human) )), Mash1 (NM004316 (human)), Neurogenin (NM006161 (human)), Pax6 (NM001604 (human)), CD15 (NM002033 (human)), PDGFR (NM002609 (human) localization or expression) Thus, as cell markers of neural stem cells, for example, Nestin (NM006617 (human)), Musashi-1 (NM002442 (human)), CD133 (NM 006017 (human)), notch1 (NM0176617 (human)), Hes1 (NM005524 (human)), Mash1 (NM004316 (human)), Neurogenin (NM006161 (human)), Pax6 (NM001604 (human)), CD15 (NM002033 ( Human)), PDGFR (NM002609 (human) and the like, but are not limited thereto.

  As used herein, a “neural crest cell (NCC)” is a cell having at least one characteristic selected from the group consisting of unique migration ability and expression of a cell marker of at least one neural crest cell. Say. Preferably, neural crest cells are identified by confirming both the unique migratory ability and the expression of cell markers of at least one neural crest cell. This unique migratory ability can be confirmed by transplanting into the head region of the embryo and then observing that it migrates to the frontal nasal protuberance, maxillary protuberance, and intercostal mesenchyme. As cell markers for neural crest cells, for example, CRABP1 (NM004378 (human)), AP2 (NM002097 (human)), Slug (NM003068 (human)), Sox10 (NM006941 (human)), Snail (NM005985 (human)) , Twist (NM000474 (human)), Pax3 (NM000438 (human)), Pax7 (NM002584 (human)), HNK1 (NM004854 (human)), p75 or p75NTR (NM002507 (human)), TRP2 (NM006267 (human)) , Wnt1 (NM005430 (human)), P0 (NM002723 (human)), tPA (NM000930 (human)), and S100 (NM006272), but are not limited thereto. No. This neural crest cell can also be confirmed by observing that at least one neural stem cell marker is expressed. For example, neural stem cell markers are Nestin (NM006617 (human)), Musashi-1 (NM002442 (human)), CD133 (NM0006017 (human)), notch1 (NM0176617 (human)), Hes1 (NM005524 (human)), Mash1. (NM004316 (human)), Neurogenin (NM006161 (human)), Pax6 (NM001604 (human)), CD15 (NM002033 (human)), PDGFR (NM002609 (human)), and the like, but are not limited thereto.

  Neural crest cells were identified as a group of cells (fourth germ layer) that originates from the margin of the neural tube (nerve crest) in the early embryonic stage and differentiates into an extremely wide and specific repertoire while widely migrating within the embryo. . Neural crest cells can differentiate into, for example, dorsal root ganglion cells, autonomic ganglion cells, adrenal medulla chromaffin cells, Schwann cells, and outer pigment cells. Neural crest cells are also referred to as neural crest cells. Neural crest cells have self-renewal and pluripotency and are very similar to neural stem cells.

  As used herein, “neural crest cell marker” refers to a neural crest cell whose localization or expression assists in identifying neural crest cells. Preferably, its localization or expression (eg CRABP1 (NM004378 (human)), AP2 (NM002097 (human)), Slug (NM003068 (human)), Sox10 (NM006941 (human)), Snail (NM005985 (human)) , Twist (NM000474 (human)), Pax3 (NM000438 (human)), Pax7 (NM002584 (human)), HNK1 (NM004854 (human)), p75 or p75NTR (NM002507 (human)), TRP2 (NM006267 (human)) , Wnt1 (NM005430 (human)), P0 (NM002723 (human)), tPA (NM000930 (human)), S100 (NM006272) can be identified as neural crest cells. Thus, as cell markers of neural crest cells, for example, CRABP1 (NM004378 (human)), AP2 (NM002097 (human)), Slug (NM003068 (human)), Sox10 (NM006941 (human)), Snail ( NM005985 (human)), Twist (NM000474 (human)), Pax3 (NM000438 (human)), Pax7 (NM002584 (human)), HNK1 (NM004854 (human)), p75NTR (NM002507 (human)), TRP2 (NM006267 ( Human)), Wnt1 (NM005430 (human)), P0 (NM002723 (human)), tPA (NM000930 (human)), and the like, but are not limited thereto.

  Note that p75 and S100 (neural crest cell marker) are also Schwann cell markers for peripheral glia. Schwann cells are known not to emerge from centrally derived neural stem cells (eg aborted fetal brain-derived neural stem cells).

  In the case of spinal cord injury, it is also said that the scar formed by glial cells (from the center) inhibits nerve regeneration. However, since the regeneration axis does not transmit nerves without myelin formation by glial cells, there is an idea that it is effective to use peripheral Schwann cells that do not scar. Since Adipocluster has the characteristics of neural crest cells in addition to neural stem cells, Schwann cells that differentiate from neural crest cells are expected to appear. From the above, the adipocluster of the present invention can be used as a raw material for Schwann cells.

  Determination with these neural stem cell markers can be performed using methods known in the art (for example, RT-PCR, Northern blot, Western blot, immunostaining, FACS, etc.). Here, whether it is expressed or not can be appropriately selected by RT-PCR, Northern blot, Western blot, immunostaining, FACS and the like.

In this specification, when a cell is identified by a cell marker, it can be identified by the intensity of its expression. In this specification, it can evaluate in four steps.
++ = strong expression ++ = moderate expression + = low expression— = no expression.

The intensity of expression is evaluated at each stage when the following ranges of values are taken, as measured by the following measurement methods. In addition, the evaluation criteria for the folds are expressed as how many times the expression was changed when the suspension culture was carried out in the same medium with the expression during adhesion culture being 1. <Measurement method>
<Measured value>
++++ Strong expression = 10 times or more
++ = moderate expression = 5 to 10 times + = low expression = 2 to 5 times − = no change in expression = 1 to 2 times.

As used herein, “aggregation” refers to a state exhibited by so-called aggregated cells that are aggregates of cells. Whether it is in the aggregation state or not can be determined by observing the aggregation state by the following test (assay method). Whether or not the state is the aggregation state can be confirmed by performing the following method in consideration of Non-Patent Document 13.
(1) It is argued that a cell cluster of a size that normally takes several days if it grows from a single cell was aggregated because it took only 1-2 days.
(2) Two types of cells (for example, derived from GFP rat and b-gal rat) are mixed and cultured, and the resulting cell mass is shown to be chimeric.
(3) In observation of time-lapse, record an image in which cells aggregate over time.

  I don't want to be bound by theory, but in the above, it seems to be strong evidence in the order of 1 → 3.

  As used herein, “embryo” or “embryonic cell” refers to the state of an early era of development in a multicellular organism. As used herein, the “head region” of an embryo refers to the region that migrates to the hindbrain, in particular, the second arch, that is, the periphery of the rombomeres 3 and 4.

  As used herein, the term “differentiated cells” refers to cells with specialized functions and morphology (eg, muscle cells, nerve cells, etc.), and unlike stem cells, pluripotency is There is little or no. Examples of differentiated cells include epidermal cells, pancreatic parenchymal cells, pancreatic duct cells, hepatocytes, blood cells, cardiomyocytes, skeletal muscle cells, osteoblasts, skeletal myoblasts, neurons, vascular endothelial cells, pigment cells, Examples include smooth muscle cells, fat cells, bone cells, chondrocytes. As used in the present invention, the differentiated cells may be in the form of a population or tissue.

  The origin of stem cells can be classified into ectoderm, mesoderm and endoderm. Stem cells derived from ectoderm are mainly present in the brain and include neural stem cells. Stem cells derived from mesoderm are mainly present in bone marrow, and include vascular stem cells and their differentiated cells, hematopoietic stem cells and their differentiated cells, mesenchymal stem cells and their differentiated cells, and the like. Endoderm-derived stem cells are mainly present in organs, and include liver stem cells and their differentiated cells, pancreatic stem cells and their differentiated cells, and the like. As used herein, somatic cells may be derived from any germ layer. Preferably, a mesenchymal cell can be used as the somatic cell.

  As used herein, the term “adipocyte” includes a large amount of fat that is interspersed between tissues or forms adipose tissue as a population along a capillary run as one of the loose connective tissues. A cell. The fat cells include yellow fat cells and brown fat cells, and any of them can be used equivalently in the present specification. Intracellular fat can be easily detected by Sudan III or osmium tetroxide.

  As used herein, the term “desired site” refers to any site in a subject that is desired to be treated. In the present invention, it is understood that such a desired site can be selected from any organ or tissue in the subject.

  As used herein, the term “tissue” refers to a population of cells having substantially the same function and / or morphology in a multicellular organism. A “tissue” is usually a cell population having the same origin, but even cell populations having different origins may have the same function and / or morphology. Therefore, when a tissue is regenerated using the stem cells of the present invention, a cell population having two or more different origins can constitute one tissue. Usually, tissue constitutes part of an organ. Animal tissues are classified into epithelial tissues, connective tissues, muscle tissues, nerve tissues, etc. based on morphological, functional or developmental basis. Plant tissues are classified into meristems and permanent tissues according to the stage of development of the cells constituting the tissue, and are classified into single tissues and complex tissues according to the types of constituent cells. As used herein, any tissue can be intended as a subject to be treated.

  In the present specification, “adipose tissue” refers to a loose connective tissue having a lot of adipocytes, each adipocyte being surrounded by lattice fibers, and capillaries are densely distributed between the cells. Also called fat body. Typically refers to subcutaneous adipose tissue. Bulky or tufted adipose tissue that is almost constant independently of other tissues. In vertebrates, it exists in the abdominal cavity in contact with the kidneys and gonads. It turns white, yellow, and sometimes orange. The subcutaneous fat tissue is present in the subcutaneous tissue and stores fat (subcutaneous fat panniculusadiposus, cushion of fat) to form a subcutaneous adipose tissue.

  In the present invention, when an organ is a target, such an organ may be any organ, and the tissue or cell targeted by the present invention may be derived from any organ or organ of an organism. As used herein, the term “organ” refers to a structure in which a function of a living individual is localized and operated in a specific part of the individual, and that part is morphologically independent. . In multicellular organisms (eg animals, plants), an organ consists of several tissues with a specific spatial arrangement, and each tissue consists of a number of cells. Examples of such organs include organs related to the vascular system. In one embodiment, organs targeted by the present invention include skin, blood vessels, cornea, kidney, heart, liver, umbilical cord, intestine, nerve, lung, placenta, pancreas, brain, peripheral limbs, retina and the like. It is not limited to them. In the present specification, when an organ is used as a target, any organ may be used, but preferably a mesenchymal tissue (for example, fat, bone, ligament, etc.) may be used as a target. It is not limited to it.

  As used herein, the term “in suspension culture for a period sufficient for aggregation to occur” refers to the time, medium, temperature, humidity, or combinations thereof such that adipose tissue-derived cells form an aggregation. . In the present invention, it has been found for the first time that agglutination is caused from an adipose tissue-derived cell and includes a neural stem cell. It is understood that appropriate conditions can be determined as appropriate. Therefore, such conditions can be changed as appropriate. Also, once such preferred conditions are set, such conditions can subsequently be used to form aggregating adipose tissue-derived cells as well. In the present invention, sufficient conditions for forming aggregation of such adipose tissue-derived cells can be used in vitro, in vivo, or ex vivo. In vivo, the conditions in the transplanted body part may be applied as is, or modifications may be made. Autotransplantation can also be called ex vivo transplantation. This is the reason why Musashi-positive or nestin-positive cells were produced by suspension culture of adipose tissue-derived cells for a period of time sufficient to cause aggregation, thereby efficiently generating cells that can function as neural stem cells. This is the first effect found in the invention.

  In the present specification, “conditions for suspension culture of adipose tissue-derived cells for a period sufficient for aggregation to occur” include those having the following conditions in addition to the conditions described in the Examples. For example, the centrifuged pellet can be cultured as it is; the bottom surface of the well can be made U-shaped to make it easier to gather. Examples of such conditions include Mori H et al. JNeurosci Res. 2006 Dec; 84 (8): 1682-91.

  As used herein, the term “in vivo” refers to the interior of an organism. In a particular context, “in vivo” refers to the location (eg, the desired site referred to herein) where the tissue or organ of interest is to be placed.

  As used herein, the term “in vitro” refers to the state in which a portion of a living organism has been removed or released “in vitro” (eg, in a test tube) for various research purposes. Say. A term that contrasts with in vivo.

  As used herein, the term “ex vivo” refers to the extraction of a target cell for gene transfer from a subject, the introduction of a therapeutic gene into the cell in vitro, and then to the same subject again. When returning, a series of operations is called ex vivo.

  In this specification, the term “autograft (tissue, cell, organ, etc.)” refers to a graft (tissue, cell, organ, etc.) from another genetically identical individual (eg, monozygotic twin) in a broad sense. May also be included. As used herein, such expression with self is used interchangeably when derived from a subject. Thus, as used herein, the expression not derived from a subject has the same meaning as not being self (ie, non-self).

In the present specification, conditions for isolating neural stem cells that can be obtained from cells containing Musashi-positive or nestin-positive adipose tissue-derived cells are independently about 1 × 10 ⁴ cells / ml to about 1 × 10 ⁶ cells. / Ml. Density (eg about 1 × 10 ⁵ cells / ml), addition of growth factors (eg EGF, bFGF), neural inducer (eg biotin, L-carnitine, corticosterone, ethanolamine, D (+) -Galactose, glutathione (reduced form), linoleic acid, linolenic acid, progesterone, retinyl acetate, selenium, triiodothyronine (T3), DL-α-tocopherol, DL-α-tocopherol acetate, albumin (bovine), catalase , Insulin, superoxide dismutase, transferrin), penicillin and streptomycin, penicillin, streptomycin, medium selection (BME, MEM, DMEM or HAMF12 medium, or a mixed medium thereof (eg, DMEM / HAMF12 (1: 1)), medium change once every 2-6 days (eg 4-5 days), passage once every 6-10 days (eg 8 days), 20-40 ° C. Selected from temperature (eg, 37 ° C.), carbon dioxide 5%, humidity above 80% (eg, 100%), and the use of an uncoated dish, by way of example, a density of 1 × 10 ⁵ cells / ml , EGF addition, bFGF addition, neurotrophic factor (eg B27 supplement (GIBCO)) addition, penicillin and streptomycin addition, use of DMEM / HAMF12 (1: 1), medium once every 4-5 days The conditions are: change, passaging once every 8 days, 37 ° C., carbon dioxide gas 5%, humidity of 80% or higher, culture using uncoated dish. The neurotrophic factor may be any as long as it has an action of assisting or promoting nerve induction, hi one embodiment, the neuroinductive factor is biotin, L-carnitine, corticostero , Ethanolamine, D (+)-galactose, glutathione (reduced form), linoleic acid, linolenic acid, progesterone, retinyl acetate, selenium, triiodothyronine (T3), DL-α-tocopherol, DL-α- Including tocopherol acetate, albumin (bovine), catalase, insulin, superoxide dismutase, transferrin In one embodiment, the neural inducer can be B27 supplement (GIBCO).

  The above conditions can be employed to maintain neural stem cells and the like, but are not limited thereto.

  As used herein, the term `` Musashi-positive (or nestin-positive) adipose tissue-derived cell-containing cell '' is a cell containing adipose tissue-derived cells, at least a portion of which is Musashi positive (or nestin positive) Means something. As long as it contains Musashi-positive (or nestin-positive) cells and adipose-derived cells and is in an aggregation state, it may be in any form. The mixture of the present invention may further comprise neural stem cells. Whether Musashi or nestin is adopted as a more preferable index varies in the cells used as a raw material, and when expression of one of the cell markers is originally observed, it is preferable to make a determination based on the other marker. In the present invention, since the expression of nestin was found in the cells used as the raw material, it is understood that Musashi is preferable but not limited thereto.

  As used herein, the term “transplant” refers to the transfer of the cells, mixtures, compositions, medicaments, etc. of the present invention into the body alone or in combination with other therapeutic agents. In the present invention, the following introduction method, introduction form, and introduction amount to the treatment site (for example, bone etc.) can be used: The pharmaceutical of the present invention is directly injected into the lesion site, sutured after insertion, and inserted. And the like. The combination of adipose-derived stem cells of the invention and differentiated cells can be administered, for example, either simultaneously as a mixture, separately but simultaneously or in parallel; or sequentially. This includes presentation where the combined agents are administered together as a therapeutic mixture, and also includes a procedure where the combined agents are administered separately but simultaneously (eg, differentiation promoting factors, etc.). “Combination” administration further includes the separate administration of one of the compounds or agents given first, followed by the second.

  As used herein, the term “self” or “self” refers to an individual or a part thereof (eg, a cell, tissue, organ, etc.) derived from that individual. As used herein, the term “self” or “self” may broadly include grafts from other genetically identical individuals (eg, identical twins).

  As used herein, the term “homologous” (homologous) refers to an individual or a portion thereof (eg, cell, tissue, organ) that is transplanted from another individual that is allogeneic but genetically different. Etc.). Since allogeneic individuals are genetically different, allogeneic ones can elicit an immune response in the transplanted individual (recipient). Examples of such cells include, but are not limited to, parent-derived cells.

  As used herein, the term “heterologous” refers to something that is transplanted from a heterologous individual. Thus, for example, when a human is a recipient, a transplant from a pig is referred to as a xenograft.

  As used herein, the term “recipient” (recipient) refers to an individual that receives the cells to be transplanted, etc., and is also referred to as a “host”. In contrast, an individual that provides cells to be transplanted is called a “donor” (donor). The recipient and donor may be the same or different.

  The cells used in the present invention may be derived from the same line (derived from the self (self)), derived from the same lineage (derived from other individuals (other houses)), or derived from different species. Self-derived cells are preferred because rejection is considered, but when rejection is not a problem, allogeneic cells may be used.

  As used herein, “neurological disease, disorder or condition” refers to any disease, disorder or abnormal condition involving cells of the nervous system.

  As used herein, the term “diagnostic, prophylactic, therapeutic or prognostically effective amount” refers to the extent that it is recognized as being medically effective in diagnosis, prophylaxis, treatment (or therapy) or prognosis, respectively. The amount of. Such amounts can be determined by one skilled in the art using techniques well known in the art, taking into account various parameters.

  When the present invention is used as a medicament, such medicament may further comprise a pharmaceutically acceptable carrier and the like. Any pharmaceutically acceptable carrier known in the art can be used in the medicament of the present invention.

  Suitable formulation materials or pharmaceutically acceptable carriers include antioxidants, preservatives, colorants, flavors, diluents, emulsifiers, suspending agents, solvents, fillers, bulking agents, buffers, delivery vehicles And / or include, but are not limited to, pharmaceutical adjuvants. Typically, the medicament of the present invention is administered in the form of a composition comprising the cells of the present invention and other active ingredients together with at least one physiologically acceptable carrier, excipient or diluent. For example, a suitable vehicle can be an injection solution, a physiological solution, or an artificial cerebrospinal fluid, which can be supplemented with other substances commonly used in compositions for parenteral delivery. Is possible.

  Acceptable carriers, excipients or stabilizers used herein are preferably non-toxic to recipients and preferably inert at the dosages and concentrations used. Preferably, for example, phosphate, citrate, or other organic acid; ascorbic acid, α-tocopherol; low molecular weight polypeptide; protein (eg, serum albumin, gelatin or immunoglobulin); hydrophilic polymer (eg, Amino acids (eg, glycine, glutamine, asparagine, arginine or lysine); monosaccharides, disaccharides and other carbohydrates (glucose, mannose, or dextrin); chelating agents (eg, EDTA); sugar alcohols (eg, EDTA); Mannitol or sorbitol ); Salt-forming counterions (such as sodium); and / or non-ionic surface-active agents (e.g., Tween, Pluronic (pluronic) or polyethylene glycol (PEG)), and the like.

  Exemplary suitable carriers include neutral buffered saline or saline mixed with serum albumin. Preferably, the product is formulated as a lyophilizer using a suitable excipient (eg, sucrose). Other standard carriers, diluents and excipients may be included as desired. Other exemplary compositions include a Tris buffer with a pH of about 7.0-8.5 or an acetate buffer with a pH of about 4.0-5.5, which further includes sorbitol or a suitable replacement thereof. Can contain things.

  The general preparation method of the pharmaceutical composition of this invention is shown below. It should be noted that veterinary drug compositions, quasi-drugs, marine drug compositions, food compositions, cosmetic compositions and the like can also be produced by known preparation methods.

  The cells of the present invention can be blended with a pharmaceutically acceptable carrier as necessary, and can be administered parenterally, for example, as liquid preparations such as injections, suspensions, solutions and sprays. . Examples of pharmaceutically acceptable carriers include excipients, lubricants, binders, disintegrants, disintegration inhibitors, absorption enhancers, absorbents, wetting agents, solvents, solubilizers, suspending agents, Examples include isotonic agents, buffering agents, soothing agents and the like. In addition, formulation additives such as preservatives, antioxidants, colorants, sweeteners and the like can be used as necessary. Moreover, it is also possible to mix | blend substances other than the polynucleotide of this invention, polypeptide, etc. with the composition of this invention. Examples of parenteral administration routes include, but are not limited to, intravenous, intramuscular, subcutaneous administration, intradermal administration, mucosal administration, rectal administration, intravaginal administration, topical administration, and dermal administration. When administered systemically, the medicament used in the present invention may be in the form of a pharmaceutically acceptable aqueous solution free of pyrogens. It is within the skill of the artisan to consider pH, isotonicity, stability, etc. for the preparation of such pharmaceutically acceptable compositions.

  Preferable examples of the solvent in the liquid preparation include injection solutions, alcohol, propylene glycol, macrogol, sesame oil, corn oil and the like as long as they meet the purpose.

  Suitable examples of solubilizers in liquid preparations include polyethylene glycol, propylene glycol, D-mannitol, benzyl benzoate, ethanol, trisaminomethane, cholesterol, triethanolamine, sodium carbonate and citric acid as long as the purpose is met. Although sodium etc. are mentioned, it is not limited to them.

  Suitable examples of the suspending agent in the liquid preparation include, for example, stearyltriethanolamine, sodium lauryl sulfate, laurylaminopropionic acid, lecithin, benzalkonium chloride, benzethonium chloride, and glyceryl monostearate as long as the purpose is met. And other surfactants such as hydrophilic polymers such as polyvinyl alcohol, polyvinyl pyrrolidone, sodium carboxymethylcellulose, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, and the like.

  Suitable examples of isotonic agents in liquid preparations include, but are not limited to, sodium chloride, glycerin, D-mannitol and the like as long as they meet the purpose.

  Suitable examples of the buffer in the liquid preparation include, but are not limited to, phosphates, acetates, carbonates, citrates and the like as long as they meet the purpose.

  Preferable examples of the soothing agent in the liquid preparation include, but are not limited to, benzyl alcohol, benzalkonium chloride, procaine hydrochloride and the like as long as they meet the purpose.

  Suitable examples of the preservative in the liquid preparation include, but are not limited to, paraoxybenzoic acid esters, chlorobutanol, benzyl alcohol, 2-phenylethyl alcohol, dehydroacetic acid, sorbic acid and the like as long as they meet the purpose. .

  Preferable examples of the antioxidant in the liquid preparation include, but are not limited to, sulfite, ascorbic acid, α-tocopherol, cysteine and the like as long as they meet the purpose.

  When prepared as injections, solutions and suspensions are preferably sterilized and isotonic with solvents in the injection site for blood or other purposes. Usually, these are sterilized by filtration using a bacteria retention filter or the like, blending with a bactericide, or irradiation. Furthermore, after these treatments, solidify by freeze-drying or other methods, and add sterile water or sterile diluent for injection (lidocaine hydrochloride aqueous solution, physiological saline, aqueous glucose solution, ethanol, or a mixed solution thereof) just before use. May be.

  Furthermore, the pharmaceutical composition of the present invention may contain coloring agents, preservatives, fragrances, flavoring agents, sweeteners and the like, as well as other agents, as long as they meet the purpose.

  The amount of the composition used in the treatment method of the present invention takes into consideration the purpose of use, the target disease (type, severity, etc.), the patient's age, weight, sex, medical history, cell morphology or type, etc. Can be easily determined by those skilled in the art. The frequency with which the treatment method of the present invention is applied to the subject (or patient) also depends on the purpose of use, target disease (type, severity, etc.), patient age, weight, sex, medical history, treatment course, etc. In view of this, it can be easily determined by those skilled in the art. Examples of the frequency include administration every day to once every several months (for example, once a week to once a month). It is preferable to administer once a week to once a month while observing the course. The amount to be administered can be determined by estimating the amount required by the site to be treated.

  As used herein, the term “instruction” refers to a method of administering or diagnosing the pharmaceutical of the present invention, a person who administers the pharmaceutical of the present invention, a person who is administered, diagnosis It is described for a person who performs or is diagnosed (for example, a doctor, a patient, etc.). This instruction describes a word indicating an appropriate method for administering the diagnostic agent or medicine of the present invention. This instruction is prepared in accordance with the format prescribed by the national supervisory authority (for example, the Ministry of Health, Labor and Welfare in Japan and the Food and Drug Administration (FDA) in the United States, etc. in the US) in which the present invention is implemented, and is approved by the regulatory authority It is clearly stated that it has been received. The instruction sheet is a so-called package insert, and is usually provided as a paper medium, but is not limited thereto. For example, an electronic medium (for example, a homepage (web site) provided on the Internet, an e-mail, etc.) ) Can also be provided.

  The end of treatment according to the method of the present invention may be determined by standard clinical test results using commercially available assays or instrumentation or diseases associated with the intended treatment (eg, bone disease, heart disease, neurological disease, etc. ) That is characteristic of the disappearance of clinical symptoms or recovery of the cosmetic state (for example, visual recovery). Treatment can be resumed by a recurrence of a disease (eg, a neurological disease) associated with a defect in differentiated cells or a cosmetic state injury.

  The present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more ingredients of the pharmaceutical composition. A notice of the form prescribed by a government agency that regulates the manufacture, use or sale of a pharmaceutical or biological product may optionally be attached to such containers, which may be made, used or sold for administration to humans. Represents approval by government agencies. The kit can include an infusion device.

  Toxicity studies such as cells of the present invention can be performed using models. For example, toxicity studies can be performed in appropriate animal models as follows: (1) Cell compositions or compounds are administered to mice (untreated control mice should also be used); (2) Blood samples are periodically obtained from one mouse in each treatment group via the tail vein; and (3) The samples are analyzed for nervous system cells and the like. Comparison of the results for each dosing regimen with controls shows whether there is toxicity.

  Further studies can be performed by sacrificing the animals at the end of each toxicology study (preferably, the American Veterinary Medical Guidelines Report of the American Veterinary Medical Assoc. Vet.Med.Assoc.202: 229-249). A representative animal from each treatment group can then be tested by global examination for direct evidence of metastasis, abnormal illness or toxicity. Overall abnormalities in the tissue are described and the tissue is examined histologically. Drugs that cause abnormalities in the nervous system or cause weight loss or blood component loss are not preferred, as are compounds that have adverse effects on major organs. In general, the greater the adverse effect, the less preferred the compound.

(Application of adipocluster)
The Musashi-positive (or nestin-positive) adipose tissue-derived cell-containing cell or “adipocluster” of the present invention can be used in various applications, for example, treatment of the nervous system. Examples include, but are not limited to, treatment of any disease, disorder or abnormal condition involving cells of the nervous system.

  Adipocluster applications include, for example, central nervous system damage such as spinal cord injury and stroke; damage to the peripheral nervous system such as trauma, facial palsy, brachial plexus palsy, etc .; perhaps the cluster can be processed into various forms (eg It is considered difficult to use conventional cell masses to create and process long string-like objects, which is one of the advantages achieved by the present invention.

(Description of Preferred Embodiment)
Hereinafter, preferred embodiments of the present invention will be described. The embodiments provided below are provided for a better understanding of the present invention, and the scope of the present invention should not be limited to the following description. Therefore, it is obvious that those skilled in the art can make appropriate modifications within the scope of the present invention with reference to the description in the present specification.

(Adipocluster)
In one aspect, the present invention provides Musashi-positive (or nestin-positive) adipose tissue-derived cell-containing cells. In the present invention, it has been clarified that an adipocluster includes Musashi-positive (or nestin-positive) adipose tissue-derived cells. Therefore, an aggregated cluster-like composition containing cells containing Musashi-positive (or nestin-positive) adipose tissue-derived cells can be called an adipocluster.

  Therefore, in one embodiment, the cells of the present invention exhibit an aggregation state.

  In one embodiment, the adipose tissue fine cell of the present invention is a cell derived from fat in the groin or the abdominal cavity, but is not limited thereto. These groin or intraperitoneal fat is preferable because it is relatively easy to collect and subsequent processing is relatively easy, but other tissues can collect fat tissue. Can be used.

  In one embodiment, the adipose tissue-derived cell of the present invention may be a cell having pluripotency. Adipose tissue-derived cells are known to contain a large amount of stem cells, and cells having such pluripotency can be used as the adipose tissue-derived cells used in the present invention. Without wishing to be bound by theory, it is easier to induce Musashi positive (or nestin positive) cells, known as markers of neural stem cells, by using pluripotent cells The advantage of being able to do so can also be considered.

  In one embodiment, the adipose tissue-derived cell of the present invention may be an ASC cell or a Stromal-vascular-fraction cell that is collected as a pellet by collecting the adipose tissue and performing a collagenase treatment and then centrifuging it. Alternatively, it may be a fat-derived stem cell derived from a waste liquid.

  In one embodiment, the Musashi-positive (or nestin-positive) adipose tissue-derived cell-containing cell of the present invention further expresses nestin, Nestin, Musashi-1, CD133, as well as the markers described in Table 2 herein. You may do.

(Adipocluster composition)
In one aspect, the present invention provides a composition for nerve regeneration, comprising a Musashi positive (or nestin positive) adipose tissue-derived cell-containing cell. It has not been found so far that nerve regeneration can be performed using cells containing Musashi-positive (or nestin-positive) adipose tissue-derived cells, and in particular, by using a composition containing those in an aggregated state, The point of finding that it can be regenerated is important in the sense that it does not require clonality.

  In one embodiment, the adipose tissue-derived cell used in the present invention may be a cell derived from fat in the groin or the abdominal cavity.

  In one embodiment, the adipose tissue-derived cell used in the present invention may be a pluripotent cell. Adipose tissue-derived cells are known to contain a large amount of stem cells, and cells having such pluripotency can be used as the adipose tissue-derived cells used in the present invention. Without wishing to be bound by theory, it is easier to induce Musashi positive (or nestin positive) cells, known as markers of neural stem cells, by using pluripotent cells The advantage of being able to do so can also be considered. In particular, the point that it has been found that nerve regeneration can be achieved by using a composition containing an aggregated state is important in the sense that clonality is unnecessary.

  In one embodiment, the adipose tissue-derived cells used in the present invention are Stromal-vascular-fraction cells collected from adipose tissue and subjected to collagenase treatment, and then collected as a pellet, or It may be a fat-derived stem cell derived from a waste liquid.

  In one embodiment, the Musashi positive (or nestin positive) adipose tissue-derived cell-containing cell used in the present invention further expresses nestin, Musashi-1, CD133, as well as other markers described herein. Can be used. By using cells that have been confirmed to have other markers capable of discriminating such neural stem cells, favorable results can be obtained in that cells suitable for nerve regeneration can be selected. Is understood.

  In another aspect, the present invention provides a composition for cell transplantation for the treatment of a nervous system disease, disorder or condition comprising adipocluster. The nervous system disease, disorder or condition can be, but is not limited to, a disease, disorder or condition resulting from, for example, a loss of differentiated cells of the nervous system. The composition can be used for any purpose as long as it treats or prevents a nervous system disease, disorder or condition. The adipocluster in the composition used may be in any form as described herein in “adipocluster” and “Method for preparing adipocluster”.

  Here, the composition containing cells containing Musashi-positive (or nestin-positive) adipose tissue-derived cells, or adipocluster, can be independently xenogeneic, allogeneic or syngeneic with respect to the host to be transplanted. Preferably, they are allogeneic or syngeneic, more preferably syngeneic, but not limited thereto. Although it is not bound by theory, it is because immune rejection can be suppressed if it is the same strain. However, when rejection is predicted, a step of avoiding rejection may be further included. Procedures for avoiding rejection are well known in the art. For example, the New Surgery System, Vol. 12, heart transplantation / lung transplantation, from technical and ethical maintenance to revision (3rd revised edition), Nakayama Shoten checking ... Examples of such methods include, but are not limited to, methods such as the use of immunosuppressants and steroids. Immunosuppressants that prevent rejection are currently, for example, “cyclosporine” (Sandimune / Neoral), “tacrolimus” (Prograf), “Azathioprine” (Imran), “steroid hormones” (predonin, methylpredonin), and There is a “T cell antibody” (OKT3, ATG, etc.), and a method practiced in many facilities around the world as a preventive immunosuppressive therapy is a combined use of “cyclosporin, azathioprine and steroid hormone”. The immunosuppressive agent is desirably administered at the same time as the agent of the present invention, but it is not necessary. Therefore, as long as the immunosuppressive effect is achieved, the immunosuppressive agent can be administered before or after the regeneration therapy / treatment of the present invention.

  Such a composition can be provided as a medicament. Such medicaments are used to treat or prevent a nervous system disease, disorder or condition (eg, a disease, disorder or condition resulting from a loss of differentiated cells of the nervous system). In addition to such a composition, the pharmaceutical of the present invention may contain a pharmaceutically acceptable carrier. As such a carrier, any carrier described in the present specification can be selected and used by a person skilled in the art depending on its use.

(Method for preparing adipocluster)
In one aspect, the present invention provides a method for preparing an adipocluster. By this method, adipocluster can be provided in a certain amount or more. The method includes the steps of A) obtaining cells from fat; and B) subjecting the cells to conditions that induce adipocluster.

  In another aspect, the present invention provides a method for producing Musashi-positive (or nestin-positive) adipose tissue-derived cells. This method includes the steps of A) providing adipose tissue-derived cells; and B) culturing the adipose tissue-derived cells in suspension for a period sufficient for aggregation to occur.

Here, fat-derived cells are disclosed in WO 00/53795, 03/022988, 01/62901, Zuk, P. et al. A. Et al., Tissue Engineering, Vol. 7, 211-228, 2001, and Zuk, P .; A. Et al., Molecular Biology of the Cell Vol. , 13, 4279-4295, 2002, etc., or modifications thereof, can be separated from the fat portion of the aspirate (lipospirate) by liposuction. Specifically, for example, (1) the suctioned fat is sufficiently washed with physiological saline using a 1-liter separatory funnel; (2) the suction fat is in the upper layer and the physiological saline is in the lower layer. Make sure it is well separated and discard the lower layer. Repeat this until the saline is almost clear by the naked eye; (3) Add the same amount of 0.075% collagenase / PBS as the aspirated fat and incubate for 30 minutes at 37 ° C with good agitation; (4 ) Add an equal volume of 10% serum-added DMEM to the above sample; (5) Centrifuge the sample at 1200 g for 10 minutes; (6) Add 0.16M NH ₄ Cl / PBS to the resulting pellet. Suspend and incubate at room temperature for 10 minutes; (7) Suction filter the above sample using a 100 μm mesh mesh; and (8) Separate the resulting filtrate by centrifugation at 1200 g for 5 minutes. Can do. Here, it is within the technical scope of those skilled in the art to scale up or scale down the above protocol according to the preparation amount.

On the other hand, when it is preferable to use adipose-derived stem cells, such adipose-derived stem cells can be isolated from, for example, a liquid part (liquid aspirate) of aspirate by liposuction as follows: (1) Liposuction A liquid part of the aspirate is prepared; (2) This liquid part is centrifuged to obtain a cell fraction; (3) This cell fraction is subjected to density gradient centrifugation and the cells Separation is performed on the basis of specific gravity; and (4) cells are recovered from a cell layer that has a lower specific gravity than red blood cells. The liquid portion of the aspirate can be prepared using saline or Ringer's infusion. Centrifugation can be performed at a speed of about 800 × g or less, or about 400 × g or more. Density gradient centrifugation is performed at a speed of about 370 × g to 1,100 × g. Density gradient centrifugation is performed using a solvent having a specific gravity (20 ° C.) of about 1.076 g / ml to 1.078 g / ml. The solvent used in density gradient centrifugation can be Ficoll ^™ , Percoll ^™ or sucrose. The specific gravity of the recovered cell layer can range from about 1.050 to 1.075. The cell layer can be collected using a pipette.

  The adipose-derived stem cells used in the present invention are at least one selected from the group consisting of CD13, CD29, CD34, CD36, CD44, CD49d, CD54, CD58, CD71, CD73, CD90, CD105, CD106, CD151, and SH3. One (preferably two, three,... N) proteins can be expressed. More preferably, the adipose-derived stem cells used in the present invention can express all of CD13, CD29, CD34, CD36, CD44, CD49d, CD54, CD58, CD71, CD73, CD90, CD105, CD106, CD151, and SH3. Is.

  These CD antigens can be determined using a method known in the art (for example, an immunological technique using an antibody). Here, whether it is expressed or not can be appropriately selected by an immunological method or the like.

  Preferably, the adipose-derived stem cell used in the present invention is at least one of CD3, CD4, CD14, CD15, CD16, CD19, CD33, CD38, CD56, CD61, CD62e, CD62p, CD69, CD104, CD135, and CD144 ( In particular, CD56) is not expressed. Such a CD antigen is a marker for differentiated cells, and since it can be an indicator of stem cells that it is not expressed, it is not limited thereto. Therefore, in a preferred embodiment, the adipose-derived stem cells used in the present invention are CD3, CD4, CD14, CD15, CD16, CD19, CD33, CD38, CD56, CD61, CD62e, CD62p, CD69, CD104, CD135, and CD144. It may be advantageous that the cell does not express any of the above.

  In another embodiment, cells expressing CD49d and not expressing CD56 may be selected as the adipose-derived stem cells for convenience.

  The adipose-derived stem cells used in the present invention can be derived from aspirated fat. Conventionally, aspirated fat has been discarded, but in the present invention, adipocluster can be prepared from fat-derived stem cells. Thus, it has become clear that it can be used as a source of stem cells that can actually be used to treat neurological diseases, disorders or conditions. Thus, such aspirated fat may be, for example, a liquid part or a fat part of the aspirate from liposuction.

  The adipose-derived stem cells used in the present invention may be isolated, or partially purified or completely purified.

  In one embodiment, the adipose stem cells used in the present invention are fat cells from a portion of fat that is not needed by modern humans (for example, fat in the abdomen, chest, buttocks, thigh, upper arm, face, etc.). Since it can be prepared more, its industrial applicability is noted. The abdomen, buttocks, groin, or abdominal cavity is a site where fat easily accumulates, and it is often desired to remove the fat. Therefore, cells may be obtained from such a part.

  In one embodiment, the method of the present invention is a method for collecting fat tissue or aspirated fat waste liquid before the step A) of the present invention, performing collagenase treatment, and then collecting it as a pellet by centrifugation. A step of obtaining a tissue-derived cell can further be included. While not wishing to be bound by theory, it is believed that including this step is preferred, but not limited to, removing mature adipocytes and collecting more concentrated progenitor cells.

  In one embodiment, the method of the present invention may further include a step of attaching A ′) adipose tissue-derived cells after the step A) of the present invention. Although not wishing to be bound by theory, it is preferable to include this step because it is possible to remove floating foreign cells such as blood cells, but is not limited thereto.

  In one embodiment, in the method of the present invention, after the step A) in the present invention, A ′) adipose tissue-derived cells are adhered, and then the adipose tissue-derived cells are passaged one or more times to obtain the adipose tissue-derived cells. The step of obtaining as (ASC) can be further included. Although not wishing to be bound by theory, it is preferable to include this step in order to increase the number of cells, but is not limited thereto.

  In one embodiment, in the method of the invention, the suspension culture is performed in Dulbecco's minimal basal medium (DMEM) or neurosphere medium, wherein the neurosphere medium is DMEM + F12 1: 1, 2% B27 Supplement, 20 ng / It can be μl bFGF, 20 ng / μl EGF. Although not wishing to be bound by theory, B27 Supplement does not use B27 supplement in the sense that it does not use such an unknown additive and forms a cluster in a short time because the content is unknown. However, F12 without B27 is considered preferable.

  In one embodiment, suspension culture in the present invention can be performed in DMEM supplemented with serum (eg, 10% fetal bovine serum). While not wishing to be bound by theory, it is advantageous to add serum to supplement nutrients and growth factors. However, in the case of clinical use, bovine-derived ones are not so preferable because it is assumed that conditions are applied in the pharmaceutical application. Rather, if autologous serum can be used, it is considered preferable. Although not wishing to be bound by theory, the use of autologous serum has the following advantages. That is, autoserum has a short culture period and does not require a large amount of autoserum.

  In one embodiment, in the method of the present invention, a container used in suspension culture is coated so as to be non-adhesive. Although not wishing to be bound by theory, the non-adhesive coating is advantageous because it is overwhelmingly easier to form an aggregation.

  In one embodiment, the non-adhesive coating can be an agarose gel coating. Although not wishing to be bound by theory, agarose is preferred because the known ingredients have been found to be less toxic.

  In one embodiment, the adhesive coating can be a coating with 1% or more agarose gel. The concentration is not a problem as long as it has a certain strength of 1% or more.

  In one embodiment, the non-adhesive coating can be a coating with a Type VII agarose gel. Although not wishing to be bound by theory, Type VII agarose gel is preferred because it is commercially available and widely used for cell culture (such as three-dimensional culture), but is not limited thereto.

In one embodiment, a step of subjecting the composition obtained according to the present invention to conditions for differentiating into the nervous system may be added to the method of the present invention. Such conditions include, independently, a density of about 1 × 10 ⁴ cells / ml to about 1 × 10 ⁶ cells / ml (eg, about 1 × 10 ⁵ cells / ml), a growth factor (eg, EGF) , BFGF), nerve inducer (for example, biotin, L-carnitine, corticosterone, ethanolamine, D (+)-galactose, glutathione (reduced form), linoleic acid, linolenic acid, progesterone, retinyl acetate, Selected from the group consisting of selenium, triiodothyronine (T3), DL-α-tocopherol, DL-α-tocopherol acetate, albumin (bovine), catalase, insulin, superoxide dismutase, transferrin), penicillin and streptomycin At least one addition, medium selection (BME, M EM, DMEM or HAMF12 medium, or a mixed medium thereof (for example, DMEM / HAMF12 (1: 1)), medium change every 2 to 6 days (for example, 4 to 5 days), 6 to 10 days (for example, , 8 days), passage at 20 ° C to 40 ° C (eg 37 ° C), carbon dioxide 5%, humidity above 80% (eg 100%) and use of uncoated dish As an example, density of 1 × 10 ⁵ cells / ml, addition of EGF, addition of bFGF, addition of neurotrophic factor (eg B27 supplement (GIBCO)), addition of penicillin and streptomycin, DMEM / HAMF12 (1: 1) use, medium change once every 4-5 days, passage once every 8 days, 37 ° C, carbon dioxide gas 5%, humidity above 80%, The neurotrophic factor that can be used in this specification is not limited as long as it has an effect of assisting or promoting nerve induction. May be.

  In one embodiment, the neural inducer is biotin, L-carnitine, corticosterone, ethanolamine, D (+)-galactose, glutathione (reduced), linoleic acid, linolenic acid, progesterone, retinyl acetate, selenium. , Triiodothyronine (T3), DL-α-tocopherol, DL-α-tocopherol acetate, albumin (bovine), catalase, insulin, superoxide dismutase, transferrin. In one embodiment, the neural inducer can be B27 supplement (GIBCO).

  The above conditions can be employed to maintain neural stem cells, but are not limited thereto.

  In another embodiment, the method may further comprise the step of confirming the level at which the stem cells express the adipocyte marker. The adipocyte marker used in this method may be any as long as it can determine adipocytes, but preferably, Leptin (NM000230 (human)) can be used, but is not limited thereto. Not. Thus, confirmation of the level of adipocyte marker can be confirmed by a decrease in Leptin (NM000230 (human)).

  In another embodiment, the method can further comprise the step of confirming whether the stem cell expresses a neural stem cell marker and the step of confirming the level of expression of the adipocyte marker by the stem cell. Preferably, for example, the neural stem cell marker is Nestin (NM006617 (human)), Musashi-1 (NM002442 (human)), CD133 (NM0006017 (human)), notch1 (NM0176617 (human)), Hes1 (NM005524 (human)). ), Mash1 (NM004316 (human)), Neurogenin (NM006161 (human)), Pax6 (NM001604 (human)), CD15 (NM002033 (human)), PDGFR (NM002609 (human)), and the like. . Preferably, neural stem cell markers include Nestin and Musashi-1.

  Determination with these neural stem cell markers or adipocyte markers can be performed using methods known in the art (for example, RT-PCR, Northern blot, Western blot, immunostaining, FACS, etc.). Here, whether it is expressed or not can be appropriately selected by RT-PCR, Northern blot, Western blot, immunostaining, FACS and the like.

(Methods of cell transplantation for the treatment of nervous system diseases, disorders or conditions)
In another aspect, the present invention provides a method for cell transplantation for the treatment of a nervous system disease, disorder or condition (eg, a disease, disorder or condition resulting from a loss of differentiated cells of the nervous system). This method comprises administering adipocluster. Here, the adipocluster used for transplantation may be in any form as described herein in “adipocluster”, “adipocluster composition” and “method for preparing adipocluster”.

  This adipocluster can be administered by any method known in the art. For example, the adipocluster can be injected using, but not limited to, a syringe, catheter, tube, and the like. Preferably, exemplary dosage forms include, but are not limited to, local injection (subcutaneous injection, intramuscular or intramuscular injection), intravenous injection, intraarterial injection, tissue administration, and the like. Advantages of this method of treatment or prevention by transplantation of the present invention, for example, compared to the prior art, for example, are: (1) no need to create regenerative tissue ex vivo (ex vivo production); from (2) It is possible to reliably regenerate a large tissue; (3) It can be produced by a simple and short-time treatment; (4) A cell and a tissue can be obtained by puncturing a needle without requiring an operation for incising an organ such as skin. Can be administered (transplanted), but is not limited thereto.

(use)
In another aspect, the present invention provides the use of adipocluster for the preparation of a medicament for treating or preventing a nervous system disease, disorder or condition. Here, neural crest cells used for the preparation of a medicament may be in any form as described herein in “adipocluster” and “method for preparing adipocluster”.

  In one embodiment, the present invention provides the use of Dulbecco's minimal basal medium (DMEM) or neurosphere medium for the production of Musashi positive (or nestin positive) adipose tissue-derived cell-containing cells.

  In one embodiment, the present invention provides a non-adhesive coated culture vessel for the production of Musashi positive (or nestin positive) adipose tissue derived cell-containing cells.

  The present invention will be described below based on examples, but the following examples are provided for illustrative purposes only. Accordingly, the scope of the present invention is not limited to the above-described embodiment and the following examples, but is limited only by the appended claims.

  The reagents used in the following examples were obtained from Wako Pure Chemicals and Sigma unless otherwise specified. Animal breeding, National Society for Medical Research have created "Principles of Laboratory Animal Care" and the Institute of Laboratory Animal Resource is created, National Institute of Health has published "Guide for the Care and Use of Laboratory Animals" (NIH Publication , No. 86-23, 1985, revised) in accordance with the spirit of animal welfare. In the case of targeting humans, the experiment was conducted after obtaining prior consent (informed consent).

(Preparation Example 1: Preparation of adipose-derived cells using collagenase)
In this preparation example, adipose tissue-derived cells were first prepared from aspirated fat from a person who gave consent to this experiment. Specifically, the aspirated fat was thoroughly washed with physiological saline using a 1-liter separatory funnel. After confirming that the aspirated fat was sufficiently separated in the upper layer and the physiological saline was sufficiently separated in the lower layer, the lower layer was discarded, and this was repeated until the physiological saline became almost transparent as viewed with the naked eye. In this preparation example, it was carried out 5 times.

  0.075% collagenase / PBS in the same amount as 10 ml of aspirated fat was added and incubated for 30 minutes at 37 ° C. with good agitation. To this sample, the same amount of 10% serum-added DMEM was added and centrifuged at 1200 × g for 10 minutes.

The pellet obtained by centrifugation was suspended by adding 0.16M NH ₄ Cl / PBS, and incubated at room temperature for 10 minutes. The sample was subjected to suction filtration using a mesh (Whatman) having a diameter of 100 μm. The obtained filtrate was centrifuged at 1200 × g for 5 minutes. This cell preparation is also called PLA. Stem cells are confirmed using cell markers (eg, CD4, CD13, CD34, CD36, CD49d, CD71, CD90, CD105, CD117, CD151, etc.).

(Preparation Example 2: Preparation of cell suspension from the liquid part of the aspirate by liposuction)
A stem cell suspension was prepared by treating the liquid part of the aspirate by liposuction using either of the following two methods. Either of the following two methods is different from the conventional method in that no treatment using an enzyme such as collagenase is required, and therefore no enzyme such as collagenase is mixed.

(I) Preparation method 1
1) The liquid part (usually about 2-4 liters) of the aspirate by liposuction was centrifuged at 400 × g for 10 minutes.
2) The supernatant was discarded. However, since the precipitated cells tend to float, they were carefully aspirated using an aspirator so as not to damage the cells.
3) The precipitated cells (mostly red blood cells) were transferred to several 50 ml polypropylene tubes and centrifuged (400 × g, 5 minutes).
4) The supernatant was aspirated and the precipitated cells were collected so that the total volume was 15-20 ml. When many matrix components were contained, the matrix components were filtered and removed with a 100 μm filter. Thereafter, centrifugation was performed as necessary.
5) 15 ml of Ficoll (registered trademark) was put in a 50 ml tube, and 15-20 ml of cell solution was slowly added as much as possible to form a layer thereon.
6) The tube was centrifuged at 400 × g for 30 minutes. (18-20 ° C)
7) After centrifugation, the cell solution was separated into 4 layers. From the top (A layer) cell-free layer (transparent), (B layer) mononuclear cell layer (light red), (C layer) Ficoll layer (transparent), (D layer) red blood cell layer (dark red), stem cells The adherent cell group to be contained was contained in the B layer and the C layer. After aspiration of the A layer, the B layer and about 3 ml of the C layer were collected as a cell suspension and transferred to a 50 ml tube.
8) Add serum-added PBS (PBS containing 10% FBS or 10% human serum) to the collected cell suspension to make 50 ml, mix by pipetting, and then centrifuge (400 × g, 5 minutes) did.
9) The supernatant was aspirated, and serum-added PBS was added again to make 50 ml. After mixing by pipetting, centrifugation (400 × g, 5 minutes) was performed.
10) The supernatant was aspirated and a cell group containing the precipitated stem cells was collected.

(II) Preparation method 2
1) In a clean bench, the liquid part of the aspirate by liposuction was sucked using a suction tube, and the filtrate was sealed in a closed separation bag through a reservoir with a filter (pore size: 120 μm).
2) The cell separator (blood component separator ASTEC204, Amco Corporation, Tokyo, Japan) is processed three times by centrifugation and the lightest specific platelet component, high specific gravity red blood cell, and granulocyte component are possible. Removed.
3) A fraction (approximately 30 to 40 ml) containing stem cells at a high concentration was collected. The specific gravity of the isolated cells ranged from 1.050 to 1.075.

The specific gravity of the rough cells formulated Percoll ^TM, the density gradient centrifugation medium such as ready Grad ^TM sodium chloride solution or sucrose solution, added collected cells and Den City marker beads (density marker beads) in a mixture It is possible to check by checking which layer has the cells among the 5-10 layers separated by the beads (the layer containing the cells indicates the specific gravity of the cells).

(Preparation Example 3: Characterization of recovered stem cells)
The stem cells collected in Preparation Example 2 were characterized using FACS according to the following procedure.

Approximately 5 ml of cell suspension was washed twice with staining medium (SM; PBS containing 0.5% bovine serum albumin and 0.05% NaN ₃ ). Cells were counted as needed.

For a cell suspension of about 1 to 10 × 10 ⁶ cells / ml, a labeled antibody having a final concentration of 0.001 to 0.1 μg / ml (for labeling, phycoerythrin (PE), allophycocyanin (APC) And / or fluorescein isothiocyanate (FITC) was used).

After incubating the mixture for about 30 minutes on ice, the cells were washed, and the concentration of the cell suspension was adjusted to about 5 × 10 ⁵ cells / ml using SM.

  A FACS Vantage (Becton Dickinson) was used. Using the antibody label as an indicator, the expression of various CD proteins in the isolated stem cells was analyzed. As a result, it was found that stem cells derived from the liquid portion of the aspirate by liposuction express CD90 and CD49d as shown in Table 3.

  Isolated stem cells were subcultured twice in DMEM medium. Passaging was performed at 80% confluence. The cells after subculture were analyzed by FACS in the same procedure as described above. The results are shown in Table 3 below.

(Table 3: Expression of various CDs in stem cells after two passages)
CD expression level
3-
4-
11c −
13 ++
14-
15-
16-
19 −
29 ++
31 +
33-
34 +
36 ++
38 −
44 +
45 +
49d ++
54 +
56-
58 +
61 −
62E −
62P −
69-
71 ++
73 ++
90 ++
104 −
105 ++
106 −
117 +
135 −
144-
146 +
151 ++
235a −
SH3 +
STRO-1 +
“−” = Expression not detected,
“+” = Detected in 20% or less of cells “++” = detected in 20% or more of the cells From the above results, the stem cells prepared from the liquid portion of the aspirate by liposuction were mesenchymal. Although stem cells were included, CD31 and 34 positive cells were included, unlike the adipose-derived stem cell group prepared by the conventional method. Therefore, it can be understood that the stem cells prepared by the method of the present invention are a group of cells that can be easily differentiated into vascular endothelium (angiogenesis) with high efficiency. Furthermore, since the CD expression used as an index in the present specification has been confirmed after being subcultured twice, the stem cell of the present invention changes its phenotype almost even after about two subcultures. It is understood that not. This cell can be used in the following examples.

(Example 1: Culture of adipose tissue-derived cells (1))
(material)
Rats used are adult SD rats (about 8-12 weeks) and males and females. Nestin-EGFP transgenic rats (Sawamoto et al. 2001) are used with some data.

  Neurosphere medium: DMEM / F12 (1: 1) (Gibco # 11330, Lot # 1382854), 2% B-27 supplement (Gibco # 17504-044, LOT 1378016), human recombinant EGF 20ng / ml (R & D systems) # 236-EG, LOT # HLM166041) and human recombinant basic-FGF 20ng / ml (R & D systems # 233-FB, LOT # HKW29).

  DMEM + 10% fetal bovine serum (FBS): DMEM (Gibco # 11885 LOT # 1362582) was prepared by adding inactivated 10% FBS (EQUITECH-BIO LOT # SFB30-1696).

(Preparation of ASC)
Rat groin and intraperitoneal fat are collected, subjected to collagenase treatment, centrifuged, and so-called stromal-vascular fraction cells collected as pellets are collected in DMEM + 10% FBS using a normal 10 cm petri dish. Adipose-derived stromal cells (ASC), which had been subjected to adhesion culture and passed at least once at least, were used.

(Formation of adipocluster)
A 12-hole plate is prepared in which the bottom surface is coated with 1% agarose gel (Sigma: Agarose type VII # A9045) in advance so as to be non-adhered. ASC was injected into a neurosphere formation medium (DMEM + F12 1: 1, 2% B27 supplement, 20 ng / ml bFGF, 20 ng / ml EGF) at a density of 0.5-1 × 10 ⁵ cells / ml, 2 ml per well, and 5% The cells were cultured in a CO ₂ incubator.

  The adipocluster was already formed at the next day. However, the reason is unknown, but cell viability seemed to drop when culturing further in an agarose-coated dish. At this point, a 12-well plate of non-tissue culture treated (non-treatment) Moved to.

  Thereafter, the culture was continued until the next day or the next day (2-3 days in total) while pipetting appropriately 1-2 times / day so as not to adhere, and then adipocluster was recovered.

(RT-PCR)
RNA was collected from the cells using Qiagen RNeasy mini kit (Qiagen; Germany). The collected samples were subjected to RT-PCR using TaKaRa PrimeScript (registered trademark) One Step RT-PCR Kit (TaKaRa; Japan). The primer designs used are as follows.
Nestin
FORWARD: CTTAGTCTGGAGGTGGCTACATACA (SEQ ID NO: 1)
REVERSE: GAGGATAGCAGAAGAACTAGGCACT (SEQ ID NO: 2)
Musashi-1
FORWARD: GGCTCTCTCACTTTCATGGACCAGGGCG (SEQ ID NO: 3)
REVERSE: GGGAACTGGTAGGGTGTAAC (SEQ ID NO: 4)
18S rRNA
FORWARD: GCCGCTAGAGGTGAAATTCTTG (SEQ ID NO: 5)
REVERSE: CATTCTTGGCAAATGCTTTCG (SEQ ID NO: 6)
(result)
The formed adipocluster is shown in FIG. The result after 2 days by the method (1) above is shown. Large ones in the 12-well plate could be confirmed with the naked eye.

  FIG. 2 shows adipocluster derived from subcutaneous fat and intraperitoneal fat of Nestin-EGFP transgenic rats. Although it is a thing after one day by the method of said (1), it is thought that it is already an EGFP signal positive and an increase in nestin expression.

The results of Nestin and Musashi-1 expression (RT-PCR) on day 1 and day 2 of adipoclaster culture are shown in FIG. Strictly speaking, it is 0.2-0.5 × 10 ⁵ / ml, which is slightly thinner than the above conditions and is formed from a non-treatment plate that is not agarose-coated. It is considered that the property is almost the same as that of adipocluster by the method. Expression is enhanced during 1-2 days.

  FIG. 4 shows a comparison of adipoclusters formed with neurosphere medium (left) and DMEM + 10% fetal bovine serum (FBS) (right). Both are similar adipoclusters. All indicate one day later.

  FIG. 5 shows marker expression of neurosphere medium and adipocluster cultured in DMEM + FBS. The culture is started and the neurosphere medium is collected after 3 days, and DMEM + FBS is collected after 2 days. Nestin and Musashi-1 are expressed in the same manner. NSC indicates neural stem cells derived from control 15-day rat embryo striatum.

(Discussion)
Conventionally, the suspension culture method in a neurosphere medium has been recognized as a method for efficiently isolating and proliferating so-called neural stem cells, and is essentially a clonic cell growth mass from a single cell. It was. However, Singec et al. Reported that the neurospheres produced are often not clonal but often aggregated even in culture under the conventional clonal conditions, and it is necessary to re-examine the necessity of clonal properties. There was a situation.

  Under this background, the present inventors suspended a high-density adipose tissue-derived cell in a neurosphere medium on a specially coated non-adhesive plate, and the sphere-like cell mass obtained in 1-3 days was found to be nestin, Musashi- 1 and other neural stem cell markers were found to be positive. In literature, the formation of neurospheres from such tissue stem cells often takes over one week, and this cell mass was considered to be in an aggregated state. That is, neural stem cells are not sorted and proliferated, but as demonstrated in the present invention, it is considered that adipose-derived cells have properties as neural stem cells by stimulating the aggregation itself.

  Therefore, fat-derived aggregation produced by suspension culture at high concentration on a non-adhesive special coated plate has a completely different meaning from that of conventional neurospheres (by the effect of aggregation itself), and for other purposes. It is considered that it can be used for the purpose of tissue regeneration. In the present invention, this cell mass is also called an adipocluster.

(Example 2: Cultivation of adipose tissue-derived cells (2))
In order to further verify that it is considered that the adipose-derived cells have properties as neural stem cells by stimulating the aggregation itself, in order to verify the normal DMEM; 10% FBS instead of the neurosphere medium Created an aggregation. That is, in this example, another condition was used for the purpose of verifying whether an adipocluster is formed under another condition.

  The neurosphere formation medium used in the above method (1) was changed to normal DMEM + 10% FBS. All other points were the same as in (1) above.

(result)
In this example, when the aggregation was similarly made with normal DMEM; 10% FBS instead of the neurosphere medium, surprisingly, this also enhanced the expression of nestin and Musashi-1.

  Therefore, as concluded in Example 1, fat-derived aggregation produced by suspension culture at a high concentration on a non-adhesive special coated plate has a completely different meaning from the conventional neurosphere (aggregation itself). It is considered that it has the potential to be used for nerve regeneration purposes and thus for other tissue regeneration purposes. Under various conditions, it was confirmed that a cell mass that can also be called an adipocluster was produced.

(Example 3: Confirmation of nerve regeneration ability)
An experiment for confirming the nerve regeneration ability of the adipocluster produced in the above example is performed in this example. A spinal cord injury model in rats was created with good reproducibility using a dedicated impactor (Ikegami et al. Eur J Neurosci. 2005 Dec; 22 (12): 3036-46.). Two weeks later, adipocluster derived from a GFP animal was transplanted into the site of the injured spinal cord using a micromanipulator. After 6 weeks, the rat was sacrificed, the spinal cord at the injured site was removed, fixed with 4% paraformaldehyde, and then frozen sections were prepared to confirm whether GFP-positive transplanted cells had been engrafted. Furthermore, immunostaining with neuronal markers (such as NF) and glial markers (such as GFAP and CNPase) was performed, and the differentiation fate of the transplanted cells was examined.

(result)
It was clearly observed that GFP positive transplanted cells were engrafted in the injured spinal cord. Immunostaining confirmed that the transplanted cells were co-positive for neuronal and glial markers. As a result, it was found that the transplanted adipocluster can differentiate into nerve constituent cells, that is, has a nerve regeneration ability.

(Example 4: Confirmation of medium in cell culture of neurosphere)
Instead of using DMEM / HAMF12 (1: 1) as a medium used for neurosphere culture, BME, MEM, DMEM, or HAMF12 medium is used to examine the influence of the medium on neurosphere cell culture. The other materials and methods are the same as those in Example 5.

(result)
From the above results, it was confirmed that even when using neurospheres cultured in any of BME, MEM, DMEM or HAMF12 medium, the same results as in the case of using DMEM / HAMF12 (1: 1) medium are shown. it can.

(Example 5 adipoclucter formation using human adipose-derived stem cells)
Next, it was confirmed whether adipoclucter was realized using human adipose-derived stem cells.

(Materials and methods)
(Separation of human adipose-derived stem cells)
The fat portion of human aspirated fat was treated with 0.075% collagenase at 37 ° C. for 30 minutes, and the cells were collected. The collected cells were passed through a 100 μm filter and maintained in M199 medium (details below).

ASC subculture medium (per 500ml)
・ M199 (GIBCO # 11150) 500ml
・ FBS (biowest # S1820) 10%
・ AcidicFGF (Peprotech # 100-17A) 2 ng / ml (final concentration)
・ Heparin + (SIGMA # H4784) 5μg / ml (final concentration)
・ Penicillin / streptomycin (GIBCO # 15070-063) 1%
(Adipocluster formation)
ASC recovered by treatment with 0.25% Trypsin-EDTA for 5 minutes was resuspended in a culture medium ((1) ASC subculture medium, (2) no DMEM / F12 medium additive, (3) neurosphere medium) They were seeded in 96-well dishes for 2% agarose coating ^{(1~2.5x10 4 / 200μl / well)} . Incubated for 1, 2 or 7 days to form clusters.

Neurosphere medium (per 50ml)
・ DMEM / F12 (GIBCO # 11330-032) 49ml
・ BFGF (GIBCO # 13256-029) 20 ng / ml (final concentration)
・ EGF (GIBCO # 13247-051) 20 ng / ml (final concentration)
・ B27supplement (GIBCO # 17504-044) 1ml
・ 200mML-Glutamine (GIBCO # 25030-081) 500μl
・ Penicillin / streptomycin (GIBCO # 15070-063) 500μl
(result)
The results are shown in FIG. As shown, clusters were formed in any of (1) ASC subculture medium, (2) no DMEM / F12 medium additive, and (3) neurosphere medium.

  Therefore, in the present invention, it was shown that the selection of the medium is not essential.

(Example 6) Gene expression of human adipocluster Next, in order to investigate the state of the cell marker of human adipocluster, the gene expression was investigated. The procedure and results are shown below.

(Materials and methods)
(Real-time PCR)
RNA from cultured cells was extracted using RNAeasy plus mini kit (# 741334) manufactured by QIAGEN, and RT reaction was performed using High capacity cDNA RT-kit (# 4374966) manufactured by Applied Biosystem. Real-time RT-PCR was performed using Applied Biosystem's Step one plus and PowerSYBR Green PCR Master Mix (# 4367659). The PCR conditions and primer base sequences are shown below.

  (Primer base sequence used)

(result)
Table 4 shows the expression level of the cell marker expressed as an average value and standard error. Display with adherent culture (labeled control) as 1.

  In the table, the upper row in the first row shows the marker, the lower row shows M199 (1) ASC subculture medium, DM / F12 (2) no DMEM / F12 medium additive, and BEF, respectively. (3) shows a neurosphere medium.

<Measured value> based on the following criteria
++++ Strong expression = 10 times or more
++ = moderate expression = 5 to 10 times + = low expression = 2 to 5 times − = no change in expression = 1 to 2 times.
When classifying Table 4, from the left,
Oct3 / 4 Nestin Musashi p75 TUBB NFH
+++ +++ ++ /-+ / + +++ + / + + + /---/-+-
It can be expressed as

  In addition, since the Nestin was expressed at the time of ASC as the original cell, the relative value appeared to be low in this example. However, a significant amount is expressed as an absolute amount, and it can be said that it is positive as a marker when compared with other cells. S100 is also expected to be positive.

  Increases in undifferentiated markers, neural stem cells, and neural crest cell markers were observed. Compared with these, the increase in the neural differentiation marker was suppressed. It was found that Adipocluster can induce the expression of the nervous system or undifferentiated markers not only in the commonly used neurosphere medium but also in the cluster formation in the basal medium without addition. In this example, expression promotion was higher in Musashi than in Nestin. This is because Nestin is expressed with a small amount at the time of ASC, which is the original cell, and in the case of relative evaluation, the numerical value after fluctuation is expressed relatively low. In absolute terms, it can be said that the amount of the neural stem cell marker is normally expressed.

(Example 7 Transplantation experiment of mouse adipocluster to spinal cord injury model mouse)
(Materials and methods)
ASC separation and adipocluster formation were carried out as described in the specification. The spinal cord injury model is created in the same manner as the rat described in the specification.

(Recovery / dispersion of Adipocluster)
The adipocluster after 8 days of culture was recovered, and the cluster that passed through the 40 μm filter was treated with Trypsin-EDTA. The dispersed cells were suspended in PBS to obtain transplanted cells. Cells were transplanted 9 days after the spinal cord injury, and the cell transplantation effect was analyzed from the BBB score.

  C57BL / 6 female mice with crush injury with 70 kDynes in the 10th thoracic vertebra were transplanted with dispersed Adipocluster 9 days after the injury.

The number of transplanted cells was 7.5 × 10 ^{3 in} both experiments 1 and 2. In the mice of the control group injected with PBS containing no cells, there was little recovery thereafter, but in the mice transplanted with Adipocluster, recovery of lower limb function was observed. Details of the BBB score are shown in the table below. The table below shows the cell engineering Vol24. No. 5 2005 Evolving disease algae model animal Created based on the spinal cord injury model creation method and functional evaluation.
[Table 5]
BBB score judgment list 0 points 1 point with no movement of the hind limbs 2 points of small movements of the 1 and 2 joints of the hind limb 1 point of large movements of the 1 joint of the hind limb and 3 points of small movement of the other joint 4 points of large movement of the 2 hind limbs 5 small movements of the 3 hind limbs 6 small movements of the 2 hind limbs and 6 large movements of the remaining 1 joint 7 large movements of the 2 hind limb joints and 7 small movements of the 1 remaining joint 8 large movements of the 3 hind limb joints Point Sweeping using the whole hind limb without load
9 points Loaded with the soles on the ground at rest 10 points No forelimb hindlimb coordination 11 Occasional load walking 11 points Forelimb hindlimb coordination no high frequency or continuous load walking 12 Point Foreground and hindlimb coordination occasionally, high-frequency or continuous load walking 13 points Forelimb hindlimb coordination is frequent, high-frequency or continuous load walking 14 points Forelimb hindlimb cooperative load walking However, it is a 15-point forelimb hindlimb cooperative load walking almost always with the position of the hindlimb in the external rotation position. This is a coordinated walking with 16 points of forelimbs and hind limbs in which the direction of the hind limbs is parallel to the trunk when touching the hind limbs, but almost no movement of kicking the ground with toes when leaving the floor (Toe Clearance) is hardly observed. When the hind limb touches down, the direction of the hind limb is parallel to the trunk, and the toes forcefully kick the ground with the toes when leaving the floor, but the toes rotate outwardly when leaving the floor.
17 points This is a load walking with forelimb hindlimb coordination. The action of kicking the ground with the toes when leaving the floor is frequently observed, and the direction of the toes is parallel to the trunk when touching the ground and when leaving the floor.
18 points This is a coordinated load walking of the forelimbs and hindlimbs. The action of kicking the ground with the toes is always recognized, and the direction of the toes is parallel to the trunk when touching and leaving the floor.
19 points 18 points in addition to seeing the tail, 20 points that the tail occasionally rises during load walking 18 points in addition to 18 points to see the state of the tail, the tail is always up during load walking, but trunk mobility is observed Be
21 points In addition to 20 points, there is no trunk mobility (Results)
The results are shown in FIG. As described in the table, in this evaluation method, there is a critical boundary line between 8 points and 9 points, and the difference in function is explained. In the example in which the ASC cells of the present invention are transplanted, There was a marked improvement in function, whereas in the untreated group no such improvement was seen.

(Transplantation effect of Adipocluster in spinal cord injury mice)
A photograph of the transplantation effect is shown in FIG. The spinal cord of the mouse in the target group (lower) injected with PBS that does not contain cells is narrower (left lower) or deeply depressed (lower right), but the spinal cord of the mouse transplanted with Adipo-cluster (upper lower) ) Was almost normal thickness and shape.

  Although it seems to be a subtle difference in BBB score, a critical difference of 8 points or less or 9 points or more was observed. In this test, it is said that it is critical that it is 8 points or less or 9 points or more because the ability to walk with load is the most important point. This is consistent with the fact that the actual movement of the mouse clearly showed a recovery effect. Therefore, it is understood that the functional improvement is caused by transplantation of Adipocluster.

(Example 8 Comparison of gene expression between mouse adipocluster and mouse ASC)
(Materials and methods)
Mouse ASCs were cultured in an agarose-coated incubator for 1 week to prepare Adipocluster. The subject was mouse ASC that had been cultured in plane, and DMEM + 10% FBS was used as the culture medium. The same was done with ASC of GFP transgenic (GFP) and Wild type (WT) mice, and each was repeated three times.

  RNA was extracted from Adipocluster and planar cultured cells, and the expression levels of Nestin and p75 were measured by real-time PCR. Commercially available TaqMan probes were used as the primers (MouseNestin: Mm03053244_s1, Mouse p75NTR (Ngfr): Mm00446294_m1).

(result)
The results are shown in the following table and FIG.

  In FIG. 9, a graph shows the relative expression level (times) of Adipocluster with respect to ASC of planar culture. When RNA expression was compared, Nestin and p75NTR expression was significantly higher in Adipocluster (*: P <0.05, §: P <0.01). Therefore, it is shown that functional neuronal differentiation cells increase when Adipocluster is transplanted.

  As mentioned above, although this invention has been illustrated using preferable embodiment of this invention, it is understood that the scope of this invention should be construed only by the claims. The patents, patent applications, and literature cited herein are to be incorporated by reference in their entirety, as if the contents themselves were specifically described herein.

  The present invention has proved that adipocluster, which is an aggregate having a stem cell function, can be obtained from cells of adipose tissue by a simple method. Thus, the industrial use of the present invention is found in the pharmaceutical industry.

Claims (46)

  Musashi positive adipose tissue-derived cells. The cell according to claim 1, wherein the cell exhibits an aggregation state. The cell according to claim 1, wherein the adipose tissue-derived cell is a cell derived from subcutaneous, inguinal, or intraperitoneal fat. The cell according to claim 1, wherein the adipose tissue-derived cell is a cell having pluripotency. The adipose tissue-derived cell is a stromal-vascular-fraction cell collected from a fat tissue and subjected to collagenase treatment and then collected as a pellet, or a fat-derived stem cell derived from a waste solution. Item 2. The cell according to Item 1. Furthermore, the cell of Claim 1 which expresses the marker selected from the group which consists of nestin and CD133. The cell according to claim 1, which expresses an undifferentiated cell marker, a neural stem cell marker, and a neural crest cell marker, but has a low expression of a neural differentiated cell marker. The cell according to claim 7, wherein the undifferentiated cell marker comprises Oct3 / 4. The cell according to claim 7, wherein the neural stem cell marker includes Musashi in addition to Nestin. The cell according to claim 7, wherein the neural crest cell marker includes p75 and S100b. The cell according to claim 7, wherein the neuronal differentiation cell marker includes b-III tubulin and Neurofilament. A composition for nerve regeneration, comprising a Musashi-positive adipose tissue-derived cell-containing cell. 13. The composition of claim 12, wherein the composition is for treating spinal cord injury. The composition according to claim 12, wherein the adipose tissue-derived cells are cells derived from fat in the subcutaneous or inguinal region or the abdominal cavity. The composition according to claim 12, wherein the adipose tissue-derived cell is a pluripotent cell. The adipose tissue-derived cell is a stromal-vascular-fraction cell collected from a fat tissue and subjected to collagenase treatment and then collected as a pellet, or a fat-derived stem cell derived from a waste solution. Item 13. The composition according to Item 12. Furthermore, the composition of Claim 12 which expresses the marker selected from the group which consists of Musashi-1 and CD133. The composition according to claim 12, which expresses an undifferentiated cell marker, a neural stem cell marker, and a neural crest cell marker, but has a low expression of a neural differentiated cell marker. The composition of claim 18, wherein the undifferentiated cell marker comprises Oct3 / 4. The composition according to claim 18, wherein the neural stem cell marker includes Musashi in addition to Nestin. 19. The composition of claim 18, wherein the neural crest cell marker comprises p75 and S100b. 19. The composition of claim 18, wherein the neuronal differentiation cell marker comprises b-III tubulin and Neurofilament. A method for producing Musashi-positive adipose tissue-derived cell-containing cells, the method comprising:
A) providing adipose tissue-derived cells; and B) suspension-culturing the adipose tissue-derived cells for a period sufficient to cause aggregation. 24. A step of obtaining the adipose tissue-derived cells by collecting adipose tissue or aspirated fat waste liquid before the step A), performing a collagenase treatment, and then collecting it by centrifugation and collecting it as a pellet. The method described in 1. The method according to claim 23, comprising the step of A ') adhering the adipose tissue-derived cells after the step A). 24. A step including, after the step A), A ′) adhering the adipose tissue-derived cells and then subculturing one or more times to obtain the adipose tissue-derived cells as adipose-derived stem cells (ASC). The method described in 1. The suspension culture is performed in M199 medium, DMEM + F12 1: 1 medium or neurosphere medium supplemented with 10% fetal bovine serum, heparin and acidic fibroblast growth factor (aFGF), and the neurosphere medium is DMEM + F12 1. 24. The method of claim 23, wherein: 1, 2% B27 Supplement, 20 ng / μl basic fibroblast growth factor (bFGF), 20 ng / μl epidermal growth factor (EGF). 24. The method of claim 23, wherein the suspension culture is performed in DMEM supplemented with 10% fetal bovine serum. 24. The method according to claim 23, wherein the container used in the suspension culture is non-adhesive or is coated so as to be non-adhesive. 30. The method of claim 29, wherein the non-adhesive coating is a coating with an agarose gel. 30. The method of claim 29, wherein the non-adhesive coating is a 1% agarose gel coating. 30. The method of claim 29, wherein the non-adhesive coating is a coating with a Type VII agarose gel. The method according to claim 23, wherein the suspension culture is a medium containing serum and is coated so that a container to be used is non-adhesive or non-adhesive. 24. The method according to claim 23, comprising expressing an undifferentiated cell marker, a neural stem cell marker, and a neural crest cell marker, and confirming that the neural differentiated cell marker is lowly expressed. 36. The method of claim 35, wherein the undifferentiated cell marker comprises Oct3 / 4. 36. The method of claim 35, wherein the neural stem cell marker comprises Musashi in addition to Nestin. 36. The method of claim 35, wherein the neural crest cell marker comprises p75 and S100b. 36. The method of claim 35, wherein the neuronal differentiation cell marker comprises b-III tubulin and Neurofilament. Use of Dulbecco's minimal basal medium (DMEM) or neurosphere medium for the production of Musashi positive adipose tissue-derived cells. A non-adhesive coating culture vessel for the production of Musashi-positive adipose tissue-derived cells. A medicament for preventing or treating a nervous system condition, disorder or disease, the medicament comprising Musashi-positive adipose tissue-derived cell-containing cells. 42. The medicament of claim 41, wherein the nervous system condition, disorder or disease includes spinal cord injury. Use of Musashi-positive adipose tissue-derived cells-containing cells in the manufacture of a medicament for preventing or treating a nervous system condition, disorder or disease. 44. Use according to claim 43, wherein the nervous system condition, disorder or disease comprises spinal cord injury. A method for preventing or treating a nervous system condition, disorder or disease comprising administering Musashi-positive adipose tissue-derived cell-containing cells to a subject in need of such prevention or treatment. ,Method. 46. The method of claim 45, wherein the nervous system condition, disorder or disease includes spinal cord injury.