CN111074004B

CN111074004B - Human immunodeficiency virus type 1 drug-resistant genotype detection method and kit

Info

Publication number: CN111074004B
Application number: CN202010049859.7A
Authority: CN
Inventors: 周素娟
Original assignee: Fudan University
Current assignee: Fudan University
Priority date: 2020-01-17
Filing date: 2020-01-17
Publication date: 2023-02-10
Anticipated expiration: 2040-01-17
Also published as: CN111074004A

Abstract

The invention relates to a detection method and a kit for drug resistance genotype of human immunodeficiency virus type 1, belonging to the technical field of molecular biology. Specifically, the invention provides a primer set for detecting the drug resistance genotype of human immunodeficiency virus type 1 (HIV-1), which is used for amplifying a PR region (region A) and an RT region (region B + region C) of a POL gene region and comprises a primer of RT-PCR, a primer of nested PCR round 2 and a sequencing primer. Also provides a three-segment RT-PCR method and a kit for efficiently detecting the drug-resistant genotype of HIV-1. Compared with the prior art, the method is greatly improved on the basis of the conventional in-house one-section method amplification, redesigns the primer and changes the corresponding amplification reaction system and reaction conditions, is easy to master, has strong specificity and greatly improves the sensitivity. The method can efficiently amplify the POL gene sequence for drug resistance analysis, and provides more complete important data for more comprehensive drug resistance analysis and the like.

Description

Human immunodeficiency virus 1 type drug-resistant genotype detection method and kit

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a primer group for detecting drug-resistant mutation of human immunodeficiency virus type 1 (HIV-1) PR and RT regions, a detection method (three-section PCR-sequencing method) for detecting drug-resistant genotype of human immunodeficiency virus type 1 (HIV-1) and a kit.

Background

Human Immunodeficiency Virus (HIV) infected persons cause Acquired immunodeficiency Syndrome (AIDS), i.e., AIDS. Highly effective antiretroviral therapy (HAART), also called cocktail therapy, is a combination therapy of HIV-infected patients with three or more drugs, which are classified into Nucleoside Reverse Transcriptase Inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs), protease Inhibitors (PIs), fusion Inhibitors (FIs), co-receptor inhibitors (co-receptor inhibitors) and integrase inhibitors (integrase inhibitors) according to their action principles. The combined use of the medicines effectively reduces the morbidity and mortality of diseases related to HIV infection and prolongs the life of HIV infected people, but the problem of strain resistance generated in the treatment becomes the most main reason of antiviral treatment failure. Because of the high-speed replication of the AIDS virus and the lack of self-checking function in the replication process, the gene mutation is easy to occur to generate drug resistance. Meanwhile, under the selective pressure action of the long-term antiviral therapeutic drug, the drug resistance mutation probability of the AIDS virus is greatly increased. Both Acquired (ADR) and Transmitted Drug Resistance (TDR) increase the risk of treatment failure, progression of the hiv disease, and require more expensive second and third line treatment regimens. Through the result of the genotype drug resistance analysis of the strains in the body of the patient, doctors can help the patient to select a more proper treatment scheme.

RT-PCR-sequencing is the most commonly used method for genotype drug resistance analysis. And (2) amplifying amino acid sites of aa1-aa99 and aa 20-aa 230 of a PR (Protease) gene region and an RT region (Reverse Transcriptase) of the HIV-1 by RT-PCR, sequencing successfully amplified gene fragments, and submitting the sequences to an HIV drug resistance database (http:// highdb. And (3) the drug resistance is judged to be drug resistance according to the drug resistance rating score of ≧ 1 drug resistance score of ≧ 15 in 12 monitoring drugs recommended by the WHO drug resistance monitoring guidance in 2014.

Therefore, the success of PCR amplification of gene sequences is a prerequisite for drug resistance analysis. If the viral load of a patient is low or the sample is collected dispersedly and detected intensively in actual operation, the quality of HIV-1 nucleic acid in the sample is reduced, amplification failure often occurs, and the drug resistance of a strain in the body of the patient cannot be obtained.

Although some commercial detection kits appear in markets at home and abroad, HIV-1 has large variation and complex gene subtypes, and finally only covers a plurality of strain subtypes which are mainly prevalent in China, and some recombinant types or unique recombinant subtypes or new subtypes cannot be detected.

The in-house genotype drug resistance detection in China can cover strains of various subtypes. Typically, the nested PCR method amplifies a fragment of more than 1000bp of the POL gene region where resistance to the drug occurs. In case of successful amplification, the drug resistance of the strain can be completely analyzed. However, because the amplification fragment is long and the HIV-1 variation is large, the amplification success rate of the actual operation sample is generally more than 80%, and the amplification success rate of the sample in antiviral treatment is lower. And due to large HIV-1 variation, CRFs newly discovered in HIV-1 database every year are updated, while the conventional primers in the in-house method are not updated by referring to the information of the new CRFs, which finally causes that the primers are difficult to be combined on partial samples, so that amplification fails and the conclusion of genotype drug resistance analysis cannot be obtained. For a large sample investigation, the drug resistance of the strain in many patients cannot be known. The lack of data on drug resistance tests of individuals prior to antiviral treatment will result in an inability to guide clinicians to develop accurate antiviral treatment regimens.

Disclosure of Invention

One of the purposes of the invention is to provide a primer group for detecting gene mutation and genotype resistance analysis of PR region and RT region of HIV-1 gene, namely a primer group for efficiently detecting the drug resistance genotype of human immunodeficiency virus type 1 (HIV-1).

The second purpose of the invention is to provide a three-stage RT-PCR method for efficiently detecting the drug-resistant genotype of human immunodeficiency virus type 1 (HIV-1).

The invention also aims to provide a kit for efficiently detecting the drug-resistant genotype of the human immunodeficiency virus type 1 (HIV-1), namely a three-stage HIV (human immunodeficiency virus) genotype drug-resistant detection kit.

The invention can improve the success rate (sensitivity) of gene amplification on the basis of the original RT-PCR-sequencing method and can also cover various subtype strains. The invention is based on a generation sequencing platform and has the advantages of multiple mutation sites, high accuracy, easy sample acquisition and the like.

The purpose of the invention can be realized by the following technical scheme:

the present invention provides a primer set for detecting drug-resistant genotype of human immunodeficiency virus type 1 (HIV-1), which is used for amplifying PR region (region A) and RT region (region B + region C) of POL gene region. Comprises a primer of RT-PCR, a primer of a nested PCR 2 nd round and a sequencing primer; the primers are A1, A2, A3, A4, B1, B2, B3, B4, C1, C2, C3 and C4 respectively.

The nucleotide sequence of A1 is shown as SEQ ID NO. 1;

the nucleotide sequence of A2 is shown as SEQ ID NO. 2;

the nucleotide sequence of A3 is shown as SEQ ID NO. 3;

the nucleotide sequence of A4 is shown as SEQ ID NO. 4;

the nucleotide sequence of B1 is shown as SEQ ID NO. 5;

the nucleotide sequence of B2 is shown as SEQ ID NO. 6;

the nucleotide sequence of B3 is shown as SEQ ID NO. 7;

the nucleotide sequence of B4 is shown as SEQ ID NO. 8;

the nucleotide sequence of C1 is shown in SEQ ID NO. 9;

the nucleotide sequence of C2 is shown as SEQ ID NO. 10;

the nucleotide sequence of C3 is shown as SEQ ID NO. 11;

the nucleotide sequence of C4 is shown as SEQ ID NO. 12;

specifically, the sequences of A1, A2, A3, A4, B1, B2, B3, B4, C1, C2, C3 and C4 are respectively as follows:

A1：5’-TGAAAGAYTGYACTGARAGRCAGGCBAAT-3’；

A2：5’-CTTCTGTCAATGGYCAYTGB-3’；

A3：5’-TTAACYTCCCTCARATCACT-3’；

A4：5’-TTTTACTGGTACAGTTTYAATRGG-3’；

B1：5’-AGTCCYATTGAAACTGTRCCAG-3’；

B2：5’-ATTGCTGGTGATCCYTTCCA-3’；

B3：5’-ACAATGGCCATTGACARARG-3’；

B4：5’-CTAGGTATGGTGAAKGCAG-3’；

C1：5’-AGGAATACCACACCCNGCRG-3’；

C2：5’-ATCCCTGCRTAAATYTGACTTGC-3’；

C3：5’-TGTGGGNGATGCATWYTTYT-3’；

C4：5’-CTTCTGTATGTCATTGACRGTCC-3’。

in the nucleotide sequences shown in SEQ ID NO. 1-12, R is A/G, Y is C/T, B is G/T/C, K is G/T, W is A/T, and N represents A/T/C/G.

The invention designs primers among 1084bp of the pol gene amplification region 2243-3326 of the commonly used in-house genotype drug resistance detection to divide the region A, the region B and the region C into three sections for amplification. Specifically, the A region (2245-2583nt, HXB 2), the B region (2615-2951nt, HXB 2), the C region (2880-3326nt, HXB 2), each region corresponding to a set of primers. Each group of primers comprises a1 st round of upstream specific sequence and a downstream specific sequence of the nested PCR, and a2 nd round of upstream specific sequence and a downstream specific sequence.

The primer group corresponding to the gene amplification of the A region has the base sequences of the ordered lists SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO. 4; the primer group corresponding to the B region gene amplification has base sequences of SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8 in an ordered list; the primer group corresponding to the C region gene amplification has base sequences of SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12 in an ordered list.

The sequencing primer of the A area has a base sequence of a sequence table SEQ ID NO.3 and a sequence table SEQ ID NO. 4; the sequencing primer of the B region has a base sequence of a sequence table SEQ ID NO.7 and a sequence table SEQ ID NO. 8; the sequencing primer of the C region has a base sequence of a sequence table SEQ ID NO.11 and a sequence table SEQ ID NO. 12.

Finally, PR region (A region) and RT region (B region + C region sequence spliced into RT region) of the drug resistance analysis reach the same drug resistance genotype analysis region as that of the first-stage method.

The invention aims to solve the technical problem that when HIV POL regions (PR region and RT region) are subjected to drug resistance analysis, a sample which fails to be amplified by a one-section method PCR method cannot obtain the drug resistance condition, 3 groups of primer groups with strong specificity are designed in the POL regions to amplify 3 small segments of an A region, a B region and a C region, and then the analysis results of the PR region (A region) and the RT region (B region + C region are spliced) are combined to reach the same analysis conclusion as that of the 1084bp one-section method, so that the sensitivity and the success rate of amplification are improved.

Further, the HIV-1 subtypes that the primer set can detect include but are not limited to: CRF01_ AE, CRF07_ BC, CRF08_ BC, CRF _5501B, CRF _57BC, CRF _62_BC, CRF _65cpx, CRF79_0107, CRF _85_BC, CRF86_ BC, CRF80_0107, CRF100_01C, and CRF101_01B.

The primer group provided by the invention refers to main subtypes CRF01_ AE and CRF07_ BC which are popular in China, previous and latest CRFs which are uploaded and found in China in HIV database and more than 2000 HIV pol region gene sequences which are not uploaded and disclosed by the subject group in which the inventor is located. The invention carries out multiple sequence comparison on the sequences of the HIV virus subtypes to find out conserved regions of different subtypes. The primers are designed in the conserved region, so that different HIV subtypes can be amplified.

The HIV-1 has large variability, and the invention introduces degenerate bases (mixed bases) to ensure that different subtypes can be well combined with a template when base mutation occurs in a primer region. Excessive addition of degenerate bases will eventually lead to a decrease in effective primer concentration. According to the design principle of the primer, amplification is started from the 3' end, the base at the 3' end cannot be mismatched, the 3' end and the degenerate base close to the 3' end are reserved, and the degenerate base at the 5' end is abandoned, so that the specific binding of the primer is ensured, and the effective concentration of the primer is also ensured.

The invention also provides application of the primer group, wherein the primer group is used in nested PCR three-stage amplification for drug resistance detection of HIV POL (human immunodeficiency Virus) regions, or the primer group is used in an HIV-1 drug resistance detection kit.

When HIV POL region is amplified by drug resistance detection, the primers are adopted to carry out nested PCR amplification.

The invention also provides a three-segment RT-PCR method for efficiently detecting the drug-resistant genotype of the human immunodeficiency virus type 1 (HIV-1), which comprises the following steps:

a1. extracting viral RNA from a plasma or serum sample;

a2. respectively carrying out nested PCR amplification on the A region, the B region and the C region of POL drug resistance detection by using the primers;

a3. and (3) carrying out electrophoresis on the result of the nested PCR amplification, sequencing the sample at the position of the target band of the electrophoresis result, and uploading and analyzing the spliced sequence.

Preferably, the viral RNA extracted from the plasma or serum sample in step a1 can be extracted by using a commercial automatic extractor or an artificial column extraction method.

Preferably, the nested PCR first round of the A, B and C regions in step a2 is as follows:

the PCR preparation room was performed in a safety cabinet, taking care that the preparation process should be performed on ice. One Step RNA PCR Kit (AMV) (Dagan, takara Co., ltd.) was recommended, and the primer was used at a concentration of 40. Mu.M in a total reaction volume of 25. Mu.l. And a region A: 10 × buffer 2.5ul, mgCl ₂ 5ul, dNTP 2.5ul, primer A1.5 ul, primer A2.5 ul, RT enzyme 0.5ul, taq enzyme 0.5ul, RNase Inhibitor 0.5ul, ddH ₂ O7.5 ul, 5ul of RNA template generated in step a 1; and a B region: 10 × buffer 2.5ul, mgCl ₂ 5ul, dNTP 2.5ul, B1.5ul, B2.5 ul, RT enzyme 0.5ul, taq enzyme 0.5ul, RNase Inhibitor 0.5ul, ddH ₂ O7.5 ul, 5ul of RNA template generated in step a 1; and a C region: 10 × buffer 2.5ul, mgCl ₂ 5ul, dNTP 2.5ul, C1.5ul, C2.5ul, RT enzyme 0.5ul, taq enzyme 0.5ul, RNase Inhibitor 0.5ul, ddH ₂ O7.5 ul, 5ul of RNA template generated in step a1.

Preferably, the first round of nested PCR amplification procedures for regions a, B and C are the same as: 50 minutes at 48 ℃; 2 minutes at 94 ℃;94 ℃ for 15 seconds, 50 ℃ for 20 seconds, 72 ℃ for 1 minute, 40cycles; 10 minutes at 72 ℃ and incubation at 4 ℃.

Preferably, the nested PCR second round of regions A, B and C in step a2 is as follows: the template for the second round is the PCR product of the first round. Perfectshot (TM) Ex Taq Mix (Dada, takara) was recommended, the primer used was 40. Mu.M, and the total volume of the reaction was 50. Mu.l. And a region A: 2 PCR mix 25ul, A3 1ul, A4 1ul, ddH ₂ O18 ul, template (first round PCR product of region A) 5ul. And a B region: 2 PCR mix 25ul, B3 1ul, B4 1ul, ddH ₂ O18 ul, template (first round PCR product in B region) 5ul. And a C region: 2 PCR mix 25ul, C3 1ul, C4 1ul, ddH ₂ O18 ul, template (first round PCR product in zone C) 5ul.

Preferably, the nested PCR second-round amplification procedures of the A region, the B region and the C region in the step a2 are the same. 4 minutes at 94 ℃; 12 seconds at 94 ℃, 20 seconds at 55 ℃, 1 minute at 72 ℃,40cycles; the temperature is 72 ℃ for 10 minutes and the temperature is kept at 4 ℃.

Preferably, the PCR product of step a3 is subjected to electrophoresis.

Preferably, the sequencing primer of the region A in the sequencing primer of the step a3 has a base sequence of a sequence table SEQ ID NO.3 or SEQ ID NO. 4; the sequencing primer of the B region has a base sequence of a sequence table SEQ ID NO.7 and a sequence table SEQ ID NO. 8; the sequencing primer of the C region has a base sequence of a sequence table SEQ ID NO.11 and a sequence table SEQ ID NO. 12. The sequence splicing of PR and RT regions is realized by using a SeqMan program in Lasergene conventionally, the sequence is exported in a Fasta format, and is uploaded to an https:// hivdb. Table 1 lists the clinically identifiable drug-resistant varieties, and Table 2 lists the types of detectable drug-resistant mutations in clinical trials. Tables 1 and 2 are referenced for drug resistance analysis results.

TABLE 1 clinically identifiable drug-resistant varieties

In addition to drug resistance analysis, the website server will also list the occurrence of drug resistance site mutations.

TABLE 2 detectable types of drug-resistant mutations in clinical trials

The invention also provides a kit for efficiently detecting the drug-resistant genotype of the human immunodeficiency virus type 1 (HIV-1), namely a three-stage HIV (human immunodeficiency virus) genotype drug-resistant detection kit. The kit comprises the primer group.

Compared with the prior art, the invention has the following advantages and beneficial effects:

aiming at the condition that the POL region gene sequence cannot be obtained for drug resistance analysis due to the nested PCR amplification failure caused by low virus load or sample degradation and the like in the drug resistance detection, the method for splicing by amplifying 3 small fragments improves the amplification rate. Since the designed primer refers to the sequences of various subtypes of a large number of newly infected people in recent years in China (including more than 2000 sequences which are not uploaded into database by the inventor of the application), the primer region is subjected to base degeneration aiming at base mutation, and can be specifically combined with gene fragments of different subtypes.

The invention is greatly improved on the basis of the amplification of the conventional in-house one-section method, redesigns the primer and changes the corresponding amplification reaction system and reaction conditions, is easy to master, has strong specificity and greatly improves the sensitivity. When the patient has low virus load, the sample is not preserved properly and degraded, and the like, the POL gene sequence for drug resistance analysis can still be efficiently amplified by using the method disclosed by the invention under the condition that the long fragment with more than 1000bp is failed to be amplified by using the common one-segment nested PCR, so that more complete important data are provided for more comprehensive drug resistance analysis and the like.

Drawings

FIG. 8 shows a three-stage PCR amplification of a gel electrophoresis pattern of region A, region B and region C from an HIV-1 positive specimen;

the sequence of the shaded part in FIG. 2 is the position of the primer A1 in the sequence and the comparison result with part of the reference sequence;

the sequence of the shaded part in FIG. 3 is the position of the primer A2 in the sequence and the comparison result with part of the reference sequence;

FIG. 4 shows the sequence of the shaded area of the sequence of primer A3 and the alignment result with part of the reference sequence;

FIG. 5 shows the sequence of the shaded area of the sequence of primer A4 and the alignment result with part of the reference sequence;

FIG. 6 shows the sequence of the shaded area of the sequence of primer B1 at the position and alignment with a part of the reference sequence;

FIG. 7 shows the sequence of the shaded area of the sequence of primer B3 at the position and alignment with a part of the reference sequence;

FIG. 8 shows the sequence of the shaded area of the sequence of primer B2 at the position and alignment with a part of the reference sequence;

FIG. 9 shows the sequence of the shaded area of the sequence of primer B4 and the alignment result with a part of the reference sequence;

FIG. 10 shows the sequence of the shaded area as the position of primer C1 in the sequence and the alignment result with part of the reference sequence;

FIG. 11 shows the sequence of the shaded area of the sequence of primer C2 and the alignment result with a part of the reference sequence;

FIG. 12 shows the sequence of the shaded area of the sequence of primer C3 and the alignment result with a part of the reference sequence;

FIG. 13 shows the sequence of the shaded area of the sequence of primer C4 and the alignment result with a part of the reference sequence;

FIG. 14 results of a drug resistance assay after uploading the region A (PR region) sequence to the HIV drug resistance database at Stanford university;

FIG. 15 shows the results of drug resistance analysis of HIV drug resistance database at Stanford university after uploading the C region + B region spliced RT region sequence of the same sample as the A region.

Detailed Description

The invention is described in detail below with reference to the figures and specific embodiments.

Example 1

This example provides a primer set for detecting the drug-resistant genotype of human immunodeficiency virus type 1 (HIV-1) for amplifying the PR region (region A) and RT region (region B + region C) of the POL gene region. Comprises a primer of RT-PCR, a primer of a nested PCR 2 nd round and a sequencing primer; the primers are A1, A2, A3, A4, B1, B2, B3, B4, C1, C2, C3 and C4 respectively.

The nucleotide sequence of A1 is shown as SEQ ID NO. 1;

the nucleotide sequence of A2 is shown as SEQ ID NO. 2;

the nucleotide sequence of A3 is shown as SEQ ID NO. 3;

the nucleotide sequence of A4 is shown as SEQ ID NO. 4;

the nucleotide sequence of B1 is shown as SEQ ID NO. 5;

the nucleotide sequence of B2 is shown as SEQ ID NO. 6;

the nucleotide sequence of B3 is shown as SEQ ID NO. 7;

the nucleotide sequence of B4 is shown as SEQ ID NO. 8;

the nucleotide sequence of C1 is shown in SEQ ID NO. 9;

the nucleotide sequence of C2 is shown as SEQ ID NO. 10;

the nucleotide sequence of C3 is shown as SEQ ID NO. 11;

the nucleotide sequence of C4 is shown as SEQ ID NO. 12;

A1：5’-TGAAAGAYTGYACTGARAGRCAGGCBAAT-3’；2057-2085；

A2：5’-CTTCTGTCAATGGYCAYTGB-3’；2615–2634；

A3：5’-TTAACYTCCCTCARATCACT-3’；2245-2264；

A4：5’-TTTTACTGGTACAGTTTYAATRGG-3’；2560-2583；

B1：5’-AGTCCYATTGAAACTGTRCCAG-3’；2556-2574；

B2：5’-ATTGCTGGTGATCCYTTCCA-3’；3007-3026；

B3：5’-ACAATGGCCATTGACARARG-3’；2615-2634；

B4：5’-CTAGGTATGGTGAAKGCAG-3’；2933-2951；

C1：5’-AGGAATACCACACCCNGCRG-3’；2826-2845；

C2：5’-ATCCCTGCRTAAATYTGACTTGC-3’；3370-3348；

C3：5’-TGTGGGNGATGCATWYTTYT-3’；2880-2899；

C4：5’-CTTCTGTATGTCATTGACRGTCC-3’3326-3304。

In this example, primers were designed to amplify in three regions, region A, region B and region C, within 1084bp of pol gene amplification region 2243-3326 for in-house genotype resistance detection. Specifically, the A region (2245-2583nt, HXB 2), the B region (2615-2951nt, HXB 2), the C region (2880-3326nt, HXB 2), each region corresponding to a set of primers. Each group of primers comprises an upstream specific sequence and a downstream specific sequence of the 1 st round of nested PCR, and an upstream specific sequence and a downstream specific sequence of the 2 nd round of nested PCR.

The primer group corresponding to the gene amplification of the A region has the base sequences of the ordered lists SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO. 4; the primer group corresponding to the B region gene amplification has base sequences of SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8 in an ordered list; the primer group corresponding to the C region gene amplification has the base sequences of the ordered lists SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO. 12.

The PR region (region A) and RT region (region B + region C sequence are spliced into RT region) of the final drug-resistant analysis reach the same drug-resistant genotype analysis region as that of the first-stage method.

The primer group provided by the embodiment refers to main subtypes CRF01_ AE and CRF07_ BC which are popular in China, previous and latest CRFs which are uploaded and found in China in HIV database, and more than 2000 HIV pol region gene sequences which are not uploaded and disclosed by the subject group in which the inventor is located. The invention carries out multiple sequence comparison on the sequences of the HIV virus subtypes to find out conserved regions of different subtypes. Primers are designed in conserved regions, so that different HIV subtypes can be amplified.

The HIV-1 has large variability, and the degenerate basic group (mixed basic group) is introduced in the invention to ensure that different subtypes can be well combined with a template when the basic group mutation occurs in a primer region. Due to the addition of too many degenerate bases, the effective primer concentration will eventually decrease. According to the design principle of the primer, amplification is started from the 3' end, the base at the 3' end cannot be mismatched, the 3' end and the degenerate base close to the 3' end are reserved, and the degenerate base at the 5' end is abandoned, so that the specific binding of the primer is ensured, and the effective concentration of the primer is also ensured. FIGS. 2-13 show the position of the primers in the sequence and the alignment with a portion of the reference sequence.

The embodiment also provides a three-segment RT-PCR method for efficiently detecting the drug-resistant genotype of the human immunodeficiency virus type 1 (HIV-1), which comprises the following steps:

a1. extracting viral RNA from a plasma or serum sample;

In this embodiment, the viral RNA extracted from the plasma or serum sample in step a1 can be extracted by a commercial automatic extractor or a manual column extraction method.

In this embodiment, the nested PCR first round for the regions a, B and C in step a2 is as follows:

the PCR preparation room was performed in a safety cabinet, noting that the preparation process should be performed on ice. It is recommended to use One Step RNAPCR Kit (AMV) (Dalian, takara Co., ltd.), the primer used at a concentration of 40. Mu.M, and 25. Mu.l of the total reaction system. And a region A: 10 × buffer 2.5ul, mgCl ₂ 5ul, dNTP 2.5ul, primer A1.5 ul, primer A2.5 ul, RT enzyme 0.5ul, taq enzyme 0.5ul, RNase Inhibitor 0.5ul, ddH ₂ O7.5 ul, 5ul of RNA template generated in step a 1; and a B region: 10 × buffer 2.5ul, mgCl ₂ 5ul, dNTP 2.5ul, B1.5ul, B2.5 ul, RT enzyme 0.5ul, taq enzyme 0.5ul, RNase Inhibitor 0.5ul, ddH ₂ O7.5 ul, 5ul of RNA template generated in step a 1; and a C region: 10 × buffer 2.5ul, mgCl ₂ 5ul, dNTP 2.5ul, C1.5ul, C2.5ul, RT enzyme 0.5ul, taq enzyme 0.5ul, RNase Inhibitor 0.5ul, ddH ₂ O7.5 ul, step5ul of RNA template generated in a1.

In this example, the first round of nested PCR amplification procedure for region a, region B, and region C is the same as: 50 minutes at 48 ℃; 2 minutes at 94 ℃;94 ℃ for 15 seconds, 50 ℃ for 20 seconds, 72 ℃ for 1 minute, 40cycles; the temperature is 72 ℃ for 10 minutes and the temperature is kept at 4 ℃.

In this embodiment, the nested PCR second round of regions a, B and C in step a2 is as follows: the template for the second round is the PCR product of the first round. Perfectshot (TM) Ex Taq Mix (Dada, takara) was recommended, the primer used was 40. Mu.M, and the total volume of the reaction was 50. Mu.l. And a region A: mixture 25ul, A3 1ul, A4 1ul, ddH ₂ O18 ul, template (first round PCR product of region A) 5ul. And a B region: mixture 25ul, B3 1ul, B4 1ul, ddH ₂ O18 ul, template (first round PCR product in region B) 5ul. And a C region: mixture 25ul, C3 1ul, C4 1ul, ddH ₂ O18 ul, template (first round PCR product in zone C) 5ul.

In this embodiment, the nested PCR second round amplification procedures for the regions A, B and C in step a2 are the same. 4 minutes at 94 ℃; 12 seconds at 94 ℃, 20 seconds at 55 ℃, 1 minute at 72 ℃,40cycles; the temperature is 72 ℃ for 10 minutes and the temperature is kept at 4 ℃.

In this example, the PCR product of step a3 was subjected to electrophoresis, and the electrophoresis result is shown in FIG. 1. The fragment lengths of the A region, the B region and the C region are 339bp,337b and 447bp respectively, wherein the A region and the B region are at the position close to 400bp and are the target band position; the C region is between 400bp and 500bp and is the target band position.

Primer verification (1) respectively selecting 8 HIV-1 positive specimens, 8 HIV-1 negative specimens and 8 HCV positive specimens (which are RNA viruses as HIV-1), extracting specimen RNA by adopting a conventional commercial RNA extraction kit or a conventional biological specimen RNA extraction method,

(2) Performing partition nested PCR amplification reaction on the sample RNA according to the primers and the amplification program in the steps a1, a2 and a3, wherein 8 HIV-1 antibody positive samples with the numbers of 1-8 in figure 1 are respectively subjected to amplification on a region A, a region B and a region C, PCR products are detected by using 1.5% agarose gel electrophoresis, electrophoresis bands of the region A, the region B and the region C are in target band positions (the result is shown in figure 1), and the subsequent sequencing result confirms that the amplified fragments are all HIV-1POL gene fragments; and 8 HIV-1 negative samples and 8 HCV positive samples of the control have no amplified bands. The results of the control group demonstrate that the designed PCR primers and amplification techniques of the present invention are highly specific.

In the sequencing primer in the step a3, the sequencing primer in the region A has base sequences of a sequence table SEQ ID NO.3 and a sequence table SEQ ID NO. 4; the sequencing primer of the B region has a base sequence of a sequence table SEQ ID NO.7 and SEQ ID NO. 8; the sequencing primer of the C region has a base sequence of a sequence table SEQ ID NO.11 and a sequence table SEQ ID NO. 12. The sequence splicing of PR and RT regions is realized by using a SeqMan program in Lasergene conventionally, the sequence is exported in a Fasta format, and is uploaded to an https:// hivdb.

The website analysis results are shown in figures 14-15, wherein figure 14 shows the drug resistance and drug resistance mutation site conditions of 8 drugs in PR region (region A), and figure 15 shows the drug resistance and drug resistance mutation site conditions of 12 drugs in RT region (region B + region C).

The sample sequence (region A) of PR region uploaded in FIG. 14 is shown in SEQ ID NO.13, which specifically includes: <xnotran> ACCTCARATCACTCTTTGGCAACGACCCGTTGTCACAGTAAAAATAGAAGGACAGCTGAGGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAGATAAATTTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATAAGTATAGAAATTTGTGGAAAAAAGGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGACGAAATCTGTTGACTCAGCTTGGTTGCACTTTAAATTTTCC. </xnotran>

The sample sequence of the RT region uploaded in FIG. 15 (splicing of the B region and the C region) is shown in SEQ ID NO.14, and specifically includes: <xnotran> AAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGTAAGGAGATGGAAGAGGAAGGAAAAATCTCAAAAATTGGGCCTGAAAACCCATATAATACTCCAGTATTTGCTATAAAGAAAAAGGACAGCACTAAATGGAGAAAATTAGTAGATTTCAGGGAGCTCAATAAAAGAACTCAAGATTTTTGGGAAGTTCAATTAGGAATACCGCATCCAGCAGGTTTAAAAAAGAAAAAATCAGTAACAGTACTAGATGTGGGAGATGCATATTTTTCAGTGCCATTAGATAAAGAATTTAGGAAGTATACTGCATTCACCATACCTAGTACAAACAATGAGACACCAGGAATCAGATATCAGTACAATGTGCTGCCACAAGGATGGAAAGGATCACCAGCAATATTCCAAGCTAGCATGACAAAAATATTAGAGCCTTTTAGAATAAAAAATCCAGAAATAGTTATCTATCAATACATGGATGATTTGTATGTAGGCTCTGATTTAGAAATAGGGCAGCACAGAACAAAAATAGAAGAGCTAAGAGCTCATCTATTGAAATGGGGATTTACTACACCAGACAAAAAGCATCAAAAGGAACCCCCATTCCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTTCAGCCTATAAAACTGCCAGAAAAGGATAGCTGGACTGTCAATG. </xnotran>

Table 1 lists the clinically identifiable drug-resistant varieties, and Table 2 lists the types of detectable drug-resistant mutations in clinical trials. Tables 1 and 2 are referenced for drug resistance analysis results.

TABLE 1 clinically identifiable drug-resistant varieties

TABLE 2 detectable types of drug-resistant mutations in clinical trials

The embodiment also provides a kit for efficiently detecting the drug resistance genotype of the human immunodeficiency virus type 1 (HIV-1), namely a three-stage HIV (human immunodeficiency virus) genotype drug resistance detection kit. The kit comprises the primer set described in the embodiment.

Comparative example 1:

conventional one-stage nested PCR round 1 upstream MAW 26:5' -TTGGAAATGTGGAAAGGAAGGAC-3 (2028-2050, HXB 2), round 1 downstream primer RT21: 5-; round 2 upstream primer PRO-1:5 'CAGAGCCAACAGCCCACCACCA 3' (2147-2166, HXB 2), 2 nd round downstream primer RT20:5 'CTGCCAGTTCTAGCTCTGCTTC-3' (3441-3462, HXB 2) and RT27:5 '-CTTCTgTATATCTgACAGTCCAgCT-3' (3299-3327, HXB 2), and the final amplification length is 1181bp/1316bp (including PR 1-99 and RT 20-230 amino acid sites between 2147-3327/3462). The primer sets MAW 26, RT21, PRO-1, RT20 and RT27 used in the experiment are subjected to nested PCR amplification. The first round of PCR is performed with the upstream primer MAW 26 and the downstream primer RT21; the reaction system is 10 × buffer 2.5ul ₂ 5ul, dNTP 2.5ul, primer MAW 26 0.5ul, primer RT 21.5 ul, RT enzyme 0.5ul, taq enzyme 0.5ul, RNase Inhibitor 0.5ul, ddH ₂ O7.5 ul, RNA template 5ul. The first round of reaction conditions were 48 ℃ for 45 minutes; 2 minutes at 94 ℃;94 ℃ for 15 seconds, 50 ℃ for 20 seconds, 72 ℃ for 2 minutes, 40cycles; 10 minutes at 72 ℃. The 2 nd round upstream primer is PRO-1, the downstream primer is RT20/RT-R2, the reaction system is Mixture 25ul, PRO-1 ul, RT20 1ul, ddH ₂ O18 ul, template (first round PCR product) 5ul. When amplification failed, round 2 amplification was performed using RT-R2 isocontal instead of RT20 to increase the amplification rate. The 2 nd round reaction condition is 94 ℃ for 4 minutes; 15 seconds at 94 ℃, 20 seconds at 55 ℃, 2 minutes at 72 ℃,40cycles; 10 minutes at 72 ℃. The experimental sample comprises 500 new HIV-1 infected patients, and the viral load range is 50-5.7 × 10 below the detection limit ⁷ copies/ml. The success rate of amplification and successful sequencing of the experimental sample by using the primer of the one-section method is 89%, and the diseased load of most samples which fail to be amplified by the one-section method is 102-103 in reference to diseased load. The same 500 samples were amplified by the three-stage method, and the positive rate was 92.4%. The three-stage method of the invention has higher sensitivity than the conventional one-stage method in the experiment aiming at lower virus load in the common in house experiment method.

Comparative example 2:

after the sample is collected in a dispersed time, the sample is stored for a long time for a concentrated experiment. The virus load of the sample is detected again, the virus load has no great change compared with the virus load of the sample collected freshly, but the success rate of amplification by using a one-stage method is less than 10 percent. Since the viral load was directed to smaller fragments around 100bp, it was suggested that the RNA fragments of the samples were incompletely degraded. For 168 samples in which the POL region-resistant gene amplification by the one-stage method (one-stage method described with reference to comparative example 1) failed, gene amplification of A region (128/168, 76.19%), B region (139/168, 82.74%), and C region (96/168, 57.14%) was carried out by the three-stage method of the present invention. All 3 fragments were successfully amplified at 88/168, 52.38%. The three-section PCR technology has higher sensitivity, has higher sensitivity to the sample with incomplete RNA fragments degraded and provides powerful technical support for the integrity of data.

Compared with the existing in-house amplification method, the HIV-1 drug-resistant genotype detection method has higher sensitivity and specificity. And the conventional nested PCR technology is used, so that the method has the advantages of simplicity in operation, short time, wide source of reagent consumables, low cost, strong reagent universality of a PCR system and the like, and has a wide application prospect. Especially, in practical research work, samples are collected in different periods and detected in a centralized way, and the samples which are stored for a long time and lead to incomplete RNA fragments to be degraded have higher value and sensitivity compared with the market kit.

The embodiments described above are described to facilitate an understanding and use of the invention by those skilled in the art. It will be readily apparent to those skilled in the art that various modifications to these embodiments may be made, and the generic principles described herein may be applied to other embodiments without the use of the inventive faculty. Therefore, the present invention is not limited to the above embodiments, and those skilled in the art should make modifications and alterations without departing from the scope of the present invention.

Sequence listing

<110> university of Compound Dan

<120> detection method and kit for drug-resistant genotype of human immunodeficiency virus type 1

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 29

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

tgaaagaytg yactgaragr caggcbaat 29

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

cttctgtcaa tggycaytgb 20

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

ttaacytccc tcaratcact 20

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

ttttactggt acagtttyaa trgg 24

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

agtccyattg aaactgtrcc ag 22

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

attgctggtg atccyttcca 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

acaatggcca ttgacararg 20

<210> 8

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 8

ctaggtatgg tgaakgcag 19

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

aggaatacca cacccngcrg 20

<210> 10

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 10

atccctgcrt aaatytgact tgc 23

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 11

tgtgggngat gcatwyttyt 20

<210> 12

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 12

cttctgtatg tcattgacrg tcc 23

<210> 13

<211> 300

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 13

acctcaratc actctttggc aacgacccgt tgtcacagta aaaatagaag gacagctgag 60

ggaagctcta ttagatacag gagcagatga tacagtatta gaagagataa atttgccagg 120

aaaatggaaa ccaaaaatga tagggggaat tggaggtttt atcaaagtaa gacaatatga 180

tcagataagt atagaaattt gtggaaaaaa ggctataggt acagtattag taggacctac 240

acctgtcaac ataattggac gaaatctgtt gactcagctt ggttgcactt taaattttcc 300

<210> 14

<211> 711

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 14

aaaaggttaa acaatggcca ttgacagaag aaaaaataaa agcattaaca gaaatttgta 60

aggagatgga agaggaagga aaaatctcaa aaattgggcc tgaaaaccca tataatactc 120

cagtatttgc tataaagaaa aaggacagca ctaaatggag aaaattagta gatttcaggg 180

agctcaataa aagaactcaa gatttttggg aagttcaatt aggaataccg catccagcag 240

gtttaaaaaa gaaaaaatca gtaacagtac tagatgtggg agatgcatat ttttcagtgc 300

cattagataa agaatttagg aagtatactg cattcaccat acctagtaca aacaatgaga 360

caccaggaat cagatatcag tacaatgtgc tgccacaagg atggaaagga tcaccagcaa 420

tattccaagc tagcatgaca aaaatattag agccttttag aataaaaaat ccagaaatag 480

ttatctatca atacatggat gatttgtatg taggctctga tttagaaata gggcagcaca 540

gaacaaaaat agaagagcta agagctcatc tattgaaatg gggatttact acaccagaca 600

aaaagcatca aaaggaaccc ccattccttt ggatgggata tgaactccat cctgacaaat 660

ggacagttca gcctataaaa ctgccagaaa aggatagctg gactgtcaat g 711

Claims

1.A primer group for detecting the drug-resistant genotype of the human immunodeficiency virus type 1 is characterized by consisting of primers A1, A2, A3, A4, B1, B2, B3, B4, C1, C2, C3 and C4,

the nucleotide sequence of A1 is shown as SEQ ID NO. 1;

the nucleotide sequence of A2 is shown as SEQ ID NO. 2;

the nucleotide sequence of A3 is shown as SEQ ID NO. 3;

the nucleotide sequence of A4 is shown as SEQ ID NO. 4;

the nucleotide sequence of B1 is shown as SEQ ID NO. 5;

the nucleotide sequence of B2 is shown as SEQ ID NO. 6;

the nucleotide sequence of B3 is shown as SEQ ID NO. 7;

b4 The nucleotide sequence of (A) is shown as SEQ ID NO. 8;

c1 The nucleotide sequence of (A) is shown as SEQ ID NO. 9;

c2 The nucleotide sequence of (A) is shown as SEQ ID NO. 10;

c3 The nucleotide sequence of (A) is shown as SEQ ID NO. 11;

c4 The nucleotide sequence of (A) is shown as SEQ ID NO. 12;

in the nucleotide sequence shown in SEQ ID NO. 1-12, R is A/G, Y is C/T, B is G/T/C, K is G/T, W is A/T, and N is A/T/C/G;

wherein, primers are designed between pol gene amplification regions 2243-3326nt of a common in-house genotype drug resistance detection HXB2 strain to amplify by three sections of an A region, a B region and a C region, the A region is 2245-2583nt, the B region is 2615-2951nt, the C region is 2880-3326nt, the A1 and A2, B1 and B2, and C1 and C2 are respectively the upstream and downstream primers of the 1 st round of nested PCR of the A region, the B region and the C region, the A3 and A4, the B3 and B4, and the C3 and C4 are respectively the upstream and downstream primers of the 2 nd round of nested PCR of the A region, the B region and the C region, and the A3 and A4, the B3 and B4, and the C3 and C4 are respectively sequencing primers of the A region, the B region and the C region.

2. The primer group for detecting the human immunodeficiency virus type 1 drug-resistant genotype, according to claim 1, characterized in that the HIV-1 subtype capable of being detected by the primer group is selected from CRF01_ AE, CRF07_ BC, CRF08_ BC, CRF _5501B, CRF _57BC, CRF _62 \_BC, CRF _65cpx, CRF79_0107, CRF _85_BC, CRF86_ BC, CRF80_0107, CRF100_01C or CRF101_01B.

3. The use of the primer set for detecting the drug-resistant genotype of human immunodeficiency virus type 1 as claimed in claim 1 or 2, characterized by the use of said primer set in the preparation of HIV-1 drug-resistant detection kit.

4. A kit for efficiently detecting the drug-resistant genotype of human immunodeficiency virus type 1, which comprises the primer set for detecting the drug-resistant genotype of human immunodeficiency virus type 1 according to claim 1 or 2.