CN111560480A - Method for detecting HIV-1 drug resistance of pregnant and lying-in women - Google Patents
Method for detecting HIV-1 drug resistance of pregnant and lying-in women Download PDFInfo
- Publication number
- CN111560480A CN111560480A CN202010486487.4A CN202010486487A CN111560480A CN 111560480 A CN111560480 A CN 111560480A CN 202010486487 A CN202010486487 A CN 202010486487A CN 111560480 A CN111560480 A CN 111560480A
- Authority
- CN
- China
- Prior art keywords
- pregnant
- lying
- pcr amplification
- hiv
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/702—Specific hybridization probes for retroviruses
- C12Q1/703—Viruses associated with AIDS
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a method for detecting HIV-1 drug resistance of pregnant and lying-in women, and relates to the technical field of biology. The method comprises the following steps: collecting blood of pregnant and lying-in women HIV patients and separating; for CD4+ T lymphocytes for counting and viral load detection; extracting RNA from a specimen with the virus number more than 1000 copies/ml; taking the RNA in the step as a template, carrying out first PCR amplification on the base sequence at the outer side of the RNA, and then carrying out second PCR amplification on the base sequence at the inner side of the RNA; and (3) determining, splicing and checking the sequence of the positive product of the second PCR amplification, and screening out the mutation site generating the drug resistance. The drug resistance detection of the invention can better supplement the defects existing in the prior art by simply adopting plasma RNA monitoring through drug resistance information detected by combining proviral DNA, improve the sensitivity of the drug resistance detection and optimize a treatment scheme for drug resistance monitoringProvides more detailed and accurate information and provides scientific basis for selecting high-efficiency treatment medicines and researching novel antiviral medicines for pregnant and lying-in women.
Description
Technical Field
The invention relates to the technical field of biological detection, in particular to a detection method of HIV-1 drug resistance of pregnant and lying-in women.
Background
Acquired Immune Deficiency Syndrome (AIDS) is a very harmful infectious disease caused by infection with Human Immunodeficiency Virus (HIV). However, with the continued development and development of antiretroviral therapy (ART), ART has achieved viral suppression and immune reconstitution, thereby extending the life span and improving the quality of life of HIV/AIDS patients. However, with the development of large-scale antiviral therapy, together with the potential for failure of antiviral therapy due to resistance to adverse treatment conditions and viral rebound, the development of HIV-I resistance has become a serious problem in antiviral therapy.
Therefore, the importance of drug resistance monitoring goes deep into every country. In developed countries, the detection of antiviral treatment failure and the occurrence of drug resistance are the criteria for monitoring treatment, and more antiviral drugs are being applied to the treatment of drug-resistant strains. In particular monitoring technology, the Simple Amplification Method (SAMBA) is a new nucleic acid-based care method, which has been used for HIV-1 detection, and mainly adopts isothermal amplification technology, which is suitable for resource-poor areas. The method is characterized in that the target gene sequence of a virus strain in a patient is obtained, and whether specific mutation related to drug resistance exists is detected by the method so as to evaluate the drug resistance of the virus strain in the patient. At the same time, this approach may underestimate drug resistance and fail to detect inferior drug resistance sites present in quasispecies in HIV-infected patients. For example, HIV transmission resistance is underestimated at 8% -16% in north america and european HIV-infected populations. The application of the deep sequencing technology can improve the sensitivity of drug resistance detection and detect the drug resistance sites with lower frequency. The appearance of sites of inferior drug resistance may compromise the efficacy of antiviral therapy, but its clinical significance remains controversial.
In summary, with the development and development of antiretroviral therapy (ART), ART has been able to achieve viral suppression and immune reconstitution, thereby prolonging the life span of HIV/AIDS patients and improving the quality of life. Meanwhile, many results are obtained in the research of HIV patient gene variation and drug resistance, but the following researches still have important defects:
(1) compliance management is difficult
The population of China is huge, the compliance management difficulty is high, the treatment failure rate is high, and the drug resistance risk is higher than that of developed countries.
(2) Has disadvantages in clinical research
ART in China is put into clinical application later, accumulated data is insufficient, and certain difference still exists between the imitation drugs and the original factory drugs, so that new drug adverse reactions can be caused.
(3) The prior art has insufficient detection
In the prior art, the drug resistance detection sensitivity is low in the process of monitoring by only adopting plasma RNA.
(4) Specificity and urgency of HIV drug resistance research of pregnant and lying-in women
One of HIV infection high-incidence areas in China in Yunnan belongs to, after the transmission and dissemination period before 1995, the rapid diffusion and the growth period are entered, and HIV infectors are shifted from high-risk groups to low-risk groups. Some of these groups are facing and about to face fertility problems, and how to safely produce and breed a healthy infant is a matter of social concern. In the process, the use rate of the antiviral drug is an important index in mother-infant blocking. But the reasonability of the medicine is directly related to the safety of pregnant and lying-in women and the result of mother-infant blocking.
With the free use of a large amount of antiviral drugs in China, the scientificity and sustainability of the use of the antiviral drugs as pregnant and lying-in women of special treatment groups are guaranteed, the survival and the life years of the pregnant and lying-in women are maintained and prolonged, and meanwhile, the infection routes of HIV of children are cut off from the source. For this reason, it is necessary to conduct a special investigation of drug resistance in pregnant and lying-in women, and to know and master the prevalence level of drug-resistant strains in the group.
Disclosure of Invention
The invention provides a method for detecting HIV-1 drug resistance of pregnant and lying-in women, and aims to solve the problems in the background technology.
In order to achieve the technical purpose, the invention adopts the following technical scheme:
a detection method for pregnant and lying-in women HIV-1 drug resistance comprises the following steps:
(6) collecting blood of pregnant and lying-in women HIV patients and separating;
(7) for CD4+ T lymphocytes for counting and viral load detection;
(8) extracting RNA from a specimen with the virus number more than 1000 copies/ml;
(9) taking the RNA in the step (3) as a template, carrying out first PCR amplification on the base sequence at the outer side of the RNA, and then carrying out second PCR amplification on the base sequence at the inner side of the RNA;
(10) and (3) determining, splicing and checking the sequence of the positive product of the second PCR amplification, and screening out the mutation site generating the drug resistance.
In the step (1), a patient extracts peripheral venous blood through an aseptic technique, then adds an anticoagulant, fully and uniformly mixes the peripheral venous blood with blood cells, centrifuges the mixture, and takes upper plasma to be subpackaged into a freezing storage tube; meanwhile, the lymphocyte enrichment fluid under the plasma layer is sucked and put into the cryopreservation tubes, and all the cryopreservation tubes are numbered and stored in a refrigerator at the temperature of minus 80 ℃.
In step (2) of the present invention, CD is treated4The method for counting the + T lymphocytes comprises the steps of adding 15-25 mu l of antibody into a TruCount tube, adding 40-60 mu l of fully and uniformly mixed anticoagulated whole blood into the TruCount tube by a reverse sample adding method, carrying out vortex mixing, placing for 10-20min at room temperature in a dark place, adding 450 mu l of 1 × FACS hemolysin, carrying out vortex mixing, placing for 10-20min at room temperature in a dark place, loading on a machine within 24 hours, and obtaining 15000 cells for detection.
In the step (3), RNA is extracted by a magnetic bead method.
Preferably, before the magnetic bead method is used for extracting RNA, pretreatment is carried out, and the method mainly comprises the following steps:
(1) taking out a plasma sample, balancing to room temperature, thawing for later use, and compiling a unique identification number of the sample on a sample tube;
(2) equilibrating the AVE buffer to room temperature;
(3) the pipette and the operation table are cleaned by sequentially disinfecting and wiping with 1% sodium hypochlorite, distilled water and 75% alcohol before and after each experiment, and the table surface is irradiated by an ultraviolet disinfection lamp.
(4) The plasma was mixed by inversion, the volume of the plasma was adjusted to 1mL, and the insoluble material was discarded.
(5) HIV RNA is extracted by a magnetic bead method.
Specifically, the PCR amplification is nested asymmetric RT-PCR.
In the invention, the length of the PCR amplification primer is an oligonucleotide chain of 19-30 bp; the base sequence of the upstream PCR amplification primer is selected from 5'-TTGGAAATGTGCAAAGGAAGGAC-3' at the outer upstream or 5'-CAGAGCCAACAGCCCCACCA-3' at the inner upstream; the downstream PCR amplification primer base sequence is one of 5'-CTGTATTTCTGCTATTAAGTCTTTGATGGG-3' downstream of the base sequence or 5'-CTGCCAGTTCTAGCTCTGCTTC-3' downstream of the base sequence.
In the invention, the reaction system of the first PCR amplification is as follows:
in the invention, the reaction system of the second PCR amplification is as follows:
| reagent | Volume (μ l) |
| 10×Taq buffer | 5 |
| dntp(10Mm) | 1 |
| Inner upstream specific primerSubstance 5' -CAGAGCCAACAGCCCCACCA-3 | 1 |
| Inner downstream specific primer 5'-CTGCCAGTTCTAGCTCTGCTTC-3' | 1 |
| Mgcl2 | 2 |
| Taq | 0.5 |
| H2O | 29.5 |
| Form panel | 10 |
| Total volume | 50 |
Specifically, the cycle conditions of the reaction system for the first PCR amplification are as follows: 30min at 50 ℃, 5min at 94 ℃ and 1 cycle; 94 ℃ 30sec, 55 ℃ 30sec, 72 ℃ 2: 30min, 30 cycles; keeping the temperature at 72 ℃ for 10min and keeping the temperature at 4 ℃; the circulation conditions of the reaction system for the first PCR amplification are as follows: 5min at 94 ℃ for 1 cycle; 94 ℃ 30sec, 63 ℃ 30sec, 72 ℃ 2: 30min, 35 cycles; keeping the temperature at 72 ℃ for 10min and keeping the temperature at 4 ℃.
Compared with the prior art, the invention has the following beneficial effects:
(1) at present, many HIV-1 drug resistance genotypes are generally detected in plasma samples, and the drug resistance detection of the invention can better supplement the defects existing in the prior art of simply adopting plasma RNA monitoring through combining drug resistance information detected by proviral DNA, improve the sensitivity of the drug resistance detection, provide more detailed and accurate information for drug resistance monitoring and the establishment of an optimized treatment scheme, and particularly provide the more detailed and accurate information when the plasma viral load is inhibited below the detection level or the plasma samples are deficient.
(2) The use rate of the antiviral drug is an important index in mother-infant blocking, but along with free mass use of the antiviral drug, the antiviral drug is used as a pregnant and lying-in woman HIV infected person of a special treatment population, and how to ensure the scientificity and sustainability of the use of the antiviral drug.
Detailed Description
The technical solutions of the present invention are further described below by way of specific embodiments, but the present invention is not limited to the scope of the examples.
Examples
First, preparation of experiment
1. Experimental reagent and equipment
Biosafety cabinet (NV-S430-400E, NVAIR USA), PCR amplification instrument (ABI 9700, ABI biotech USA), high speed centrifuge (5415C, Eppendorf, Germany), FACSCalibur flow cytometer (BD USA), virus load instrument (b DNA) (Versant moleculer 440, Siemens Germany), HIV-1 virus load detection sample preparation and analysis system (M2000sp Real Time, Abbott USA), ultra low temperature refrigerator (-86 ℃) (FORMA USA), electrophoresis instrument (Hexagon instrument factory Beijing), BD Falcon flow specimen detection tube (BD USA), 10ul, 20ul, 100ul, 200ul, 1000ul pipettors (Eppendorf, Germany).
2. Primary reagent
Viral load agents, Versant HIV-1RNA 3.0assay (b dna), siemens, germany; HIV-1 nucleic acid extraction reagent, Sample prediction System RNA, U.S. Yapei; PCR amplification reagents, Ta Ka Ra OneTepRNA PCR Kit and Ta Ka Ra Ex Taq, Dalianbao Biometrics Ltd.
3. Test object
The population included in the study was all HIV-1 infected persons who received HIV-1 genotype resistance tests in the third national hospital in Kunming City from 1/2013 to 31/2019 and who met the following test criteria. Patients who initially received the free late second-line antiviral treatment scheme of China, namely TDF/AZT +3TC + LPV/r, were admitted.
(1) Primary drug-resistant patients are selected as the standard: HIV-1 antibody positive detection by ELISA and confirmation by Western Blot method; the subject has not received any anti-HIV and hormonal therapy before this time; voluntarily signing the informed consent of the patient and ensuring to accept follow-up visits; pregnant and lying-in women of age >18 years old.
(2) Secondary drug-resistant patients are selected as the standard: in 2013 of Yunnan province, the antiviral treatment time is more than half a year, HAART fails (after receiving the antiviral treatment, the virus level in the patient body rebounds, and the sensitivity of the antiviral drug to the virus is reduced).
4. Evaluation of therapeutic Effect
According to HIV-1 Viral Load (VL) and CD4+ T lymphocyte counts the antiviral treatment outcome was evaluated. Since some patients successively change the treatment plan to the second-line treatment drug containing the protease inhibitor after 2011, patients can be classified into a first-line plan virus inhibition failure (VF) group and a virus inhibition success (VS) group according to the treatment result of the first-line plan before the second-line treatment plan is changed. The VS group was defined as a decrease in VL that persisted below the limit of detection after 6 months of antiviral treatment.
Second, Experimental methods
1. Collection, separation and preservation of experimental plasma
Adopting aseptic technique to extract 8-9mL of peripheral venous blood of pregnant and lying-in women into an EDTA blood collection tube, slightly inverting and uniformly mixing for 10 times to ensure that the anticoagulant and blood cells are fully and uniformly mixed. Centrifuging at 2200 rpm for 10min, sucking the upper layer plasma with a suction tube, and subpackaging into four freezing tubes, each tube containing about 1.1 mL; meanwhile, 1-1.5mL of lymphocyte enrichment liquid below the plasma layer is sucked and put into 1 freezing storage tube. All specimens were numbered and stored in a-80 ℃ refrigerator.
2、CD4+ T lymphocyte count
(1) Taking TruCount tubes, and numbering in sequence;
(2) adding 20 μ l of antibody into a TruCount tube;
(3) adding 50 mu l of fully and uniformly mixed anticoagulated whole blood into a TruCount tube by a reverse sample adding method;
(4) mixing by vortex, and standing at room temperature (20-25 deg.C) in dark for 15 min;
(5) 450. mu.l of 1 XFACS hemolysin was added;
(6) mixing by vortex, and standing at room temperature (20-25 deg.C) in dark for 15 min;
(7) after loading the cells for 24 hours, 15000 cells were obtained by MultiSET software for detection.
3. Determination of viral load
(1) Preparing virus precipitation, splitting virus and loading;
a. taking out the sample from the refrigerator, thawing the sample with running water for later use, taking out the small kit from-80 ℃, and melting the standard sample with the running water to pre-cool the centrifuge and the rotor to 4 ℃;
b. opening a water bath pot, adjusting to 37 ℃, marking an ID number on a sterilized spiral cap 1.5ml sterilized pointed-bottom centrifuge tube, and directly writing the ID number into a machine number (from A1 to H12);
c. preparing the specimen and the standard substance in a biological safety cabinet;
d. adding 50ul of Bead Suspension into each tube of a 1.5ml centrifuge tube;
e. respectively sucking 1ml of sample or standard liquid into a centrifugal tube filled with Bead sustension by using a sample adding gun, wherein 2 tubes are added into standard AEF;
f. after the addition, the residual standard solution is placed back to a refrigerator at minus 80 ℃ for storage;
g. after sample adding, each centrifugal tube is tightly covered, and the centrifugal tubes are placed at 4 ℃ and centrifuged at 23500g for 60 minutes;
h. carefully transferring the centrifuge tube into a biological safety cabinet, opening a screw cap, and sucking and discarding supernatant liquid by using a disposable straw, wherein 20ul of supernatant liquid is reserved in each tube;
i. immediately storing the precipitate in a refrigerator at-80 deg.C for more than 30min for 4 weeks;
j. taking out the sample from a refrigerator, thawing for 15 minutes, dissolving, fully and uniformly mixing the lump mass in the sample, adding the working solution Lysis working Reagent 120ul, and putting the sample into a water bath at 63 ℃ for 2 hours;
k. changing gloves, taking out the coating strips from the large kit, standing at room temperature for at least 30 minutes, mounting on a plastholder with an o-ring, and replacing the evaporation-proof film;
l, cooling for 10 minutes after cracking, centrifuging for about 10 seconds in a centrifuge, sucking 100ul of sample by using a sample-adding gun, and adding the sample into a coating hole (the sequence of the standard products is AABCDEEFFNLH);
and m, covering with an anti-evaporation film, and sealing the plate and the machine.
(2) Preparation of lysis reagent, Pre-amplification and amplification reagent
a. Cleaning the pipettor and reagent preparation area with 70% alcohol;
b. taking the Lysis Diluent (lysine Diluent) from the large reagent box, placing the Lysis reagent (lysine reagent) at 37 ℃, and placing the Lysis reagent (lysine reagent) at room temperature; capture Probes, Target Probes, Wash A, Wash B are placed at room temperature;
c. placing Lysis Diluent (lysine Diluent) Lysis Reagent (lysine Reagent) into 37 deg.C water bath until visible crystal dissolves, and adjusting to 63 deg.C water bath;
d. preparing a Lysis Working solution (lysine Working Reagent) by using a polypropylene tube with a conical bottom, inverting and uniformly mixing 14.1ml of Lysis Reagent (lysine Reagent)1.8ml of Lysis Diluent (lysine Reagent), uniformly shaking the Lysis reagents and Target Probes, and adding 100ul of Lysis Reagent and Target Reagent respectively;
e. after preparation, covering a cover, reversing and uniformly mixing for 10 times, shaking uniformly for 5 seconds, reversing and uniformly mixing for 10 times, and standing at room temperature to eliminate foams for later use (within 2.5 hours);
f. pre-amplified/amplified dilutions (Pre-Amplifier/Amplifier dilution), Dextran Sulfate (Dextran Sulfate) were taken out of the macro kit in advance and placed in a 37 ℃ water bath for at least 10 minutes;
g. adding 10.5ml of pre-amplified/amplified diluent working solution diluent into each tube by using a 50 ml conical bottom polypropylene tube, adding 3.5ml of thickening agent (paying attention to that the removal and the absorption of the thickening agent are slow), reversing and mixing for 10 times, shaking uniformly for 20 seconds, and reversing and mixing for 10 times;
h. placing the mixture into a water bath at 37 ℃ to eliminate foam for standby.
(3) Preparation of marking reagent and substrate, and operation of instrument
a. Adding the washing liquid A and the washing liquid B into a washing liquid bin, confirming that a waste liquid barrel is empty, selecting automatic on an instrument, selecting HIV RNA3.0assign in test items, selecting the number of orifice plate strips, and clicking Continue to ensure that the waste liquid, the washing liquid and the pipeline are scanned to be qualified;
b. taking out the pre-amplification/amplification diluted working solution half an hour before the water bath at 63 ℃ is finished, discarding 1ml respectively, adding 100ul of pre-amplification/amplification probes respectively, and reversing and uniformly mixing for 10 times for later use;
c. taking out the Label Probe from the small kit, standing at room temperature for melting (after use, putting back to a refrigerator at-80 ℃ for storage and standby);
d. taking the labeled Diluent Label Diluent, Substrate and Substrate enhancing solution Substrate Enhancer from Kit and placing at room temperature;
e. the prepared pre-amplification and pre-amplification are respectively added into a special 35 ml conical bottom polypropylene tube 440
Amplifying the working solution;
f. adding labelled Diluent Label Diluent12 mL into a 440 special 35 mL conical bottom polypropylene tube, and adding Substrate11 mL into one tube;
g. add 100ul Label Probe into 440 dedicated small threads;
h. adding 1mL of Substrate enhancing solution, Substrate Enhancer, to a 440-specific 3mL polypropylene tube;
i. opening the instrument reagent bin, opening the cover of the reagent bin, putting the reagent bin into corresponding positions according to the PA, A, LD, LP, S and SE sequences, and closing the cover of the reagent bin;
g. after confirming that all the reagents, washing liquid and waste liquid on the display are scanned to be qualified (letters are all white), closing the cover of the analyzer, and pressing down the Begin Assay;
k. after each item of the instrument is qualified by self-inspection, the instrument can leave after entering an incubation program;
clicking Data Management on a display in the experimental process, and entering the DMS for patient information entry;
after about 22 hours of incubation, the analyzer automatically reads Data, clicks read in Data Management, inputs relevant information and then reads the Data;
and n, cleaning the instrument according to a cleaning program after the experiment is finished.
4. HIV-1RNA extraction (magnetic bead method for RNA extraction)
(1) Taking out plasma samples, balancing to room temperature, and thawing for later use. The unique identification number of the specimen is compiled on the sample tube.
(2) The AVE buffer was equilibrated to room temperature.
(3) The pipette and the operating table are cleaned and disinfected by using 1 percent of sodium hypochlorite, distilled water and 75 percent of alcohol in sequence before and after each experiment. And the working table is irradiated by an ultraviolet disinfection lamp.
(4) The plasma was mixed by inversion, the volume of the plasma was adjusted to 1mL, and the insoluble material was discarded.
(5) HIV RNA was extracted using the Yapem 2000s system according to the kit protocol (magnetic bead method).
5. RT-PCR amplification of HIV target genes (in-house method)
The amplification primers are as follows
| Primer and method for producing the same | Sequence (5 '-3') | Position (HXB2) | Direction of rotation |
| MAW-26 | TTGGAAATGTGCAAAGGAAGGAC | 2028-2050 | Outside upstream |
| RT-21 | CTGTATTTCTGCTATTAAGTCTTTGATGGG | 3509-3539 | Outside downstream |
| PRO-1 | CAGAGCCAACAGCCCCACCA | 2147-2166 | Inboard upstream |
| RT-20 | CTGCCAGTTCTAGCTCTGCTTC | 3441-3462 | Inside downstream |
(1) The first round of PCR reaction system is as follows
| Reagent | Volume (μ l) |
| 10×buffer | 2.5 |
| Mgcl2 | 5 |
| Outside upstream specific primer MAW-26 | 0.5 |
| Outer downstream specific primer PT-21 | 0.5 |
| Taq | 0.5 |
| Inhibitor | 0.5 |
| RT | 0.5 |
| H2O | 7.5 |
| Form panel | 10 |
| Total volume | 25 |
Add 5. mu.l of nucleic acid into the prepared reaction tube, centrifuge at low speed for several seconds, and run PCR 9700. Opening the event window sets the loop conditions as follows:
30min at 50 ℃, 5min at 94 ℃ and 1 cycle;
94 ℃ 30sec, 55 ℃ 30sec, 72 ℃ 2: 30min, 30 cycles;
keeping the temperature at 72 ℃ for 10min and keeping the temperature at 4 ℃. And saving the file and running.
(2) The second round of PCR reaction system is as follows:
| reagent | Volume (μ l) |
| 10×Taq buffer | 5 |
| dntp(10Mm) | 1 |
| Inner upstream specific primer PRO-1 | 1 |
| Inner downstream specific primer PT-21 | 1 |
| Mgcl2 | 2 |
| Taq | 0.5 |
| H2O | 29.5 |
| Form panel | 10 |
| Total volume | 50 |
Adding 10 mul of nucleic acid into the prepared reaction tube, centrifuging at low speed for several seconds, running PCR 9700, opening an instrument window and setting the circulation conditions as follows:
5min at 94 ℃ for 1 cycle;
94 ℃ 30sec, 63 ℃ 30sec, 72 ℃ 2: 30min, 35 cycles;
keeping the temperature at 72 ℃ for 10min and keeping the temperature at 4 ℃. And saving the file and running.
6. Electrophoresis of amplification products
(1) Weighing 0.25g of agarose for 12-hole gel, weighing 0.5g of agarose for 24-hole gel in a triangular flask, adding TAE solution to prepare 1% gel solution, placing the gel solution in a microwave oven, heating with medium fire until the agarose is completely dissolved, cooling to about 50 ℃, adding geneingfinder solution according to the proportion of 1:10000, and uniformly mixing.
(2) Pouring the sol solution into a gel-making nest plate until the thickness of the gel is about 0.5cm, standing at room temperature for at least 40min to completely solidify the gel, taking out the electrophoresis plate and the gel after the gel is finished, putting the electrophoresis plate and the gel into an electrophoresis tank, and pouring the TAE solution until the liquid level is about 1mm higher than the plane of the gel.
(3) Dropping 1 mul of pre-staining solution on the sample application paper, taking 5 mul of PCR product of the second round, mixing with the pre-staining solution, and slowly adding into the electrophoresis hole.
(4) The voltage of the electrophoresis apparatus is set to be 100v, electrophoresis is carried out at constant voltage, and the result is observed for about 30 min.
(5) And taking the gel after electrophoresis off the gel plate, and placing the gel plate on a gel imager for photographing and storing.
7. Product sequencing
The PCR product positive in agarose gel electrophoresis was assigned to the relevant subject group for sequence determination. The length of the amplification product of the method is about 1200bp, the full length of protease gene (1-99 amino acids) and at least the first 254 amino acids of reverse transcriptase gene are included, and sequencing primers are shown in the table below.
| Primer and method for producing the same | Sequence (5 '-3') | Position (HXB2) | Direction of rotation |
| PRO-1 | CAGAGCCAACAGCCCCACCA | 2147-2166 | Forward sequencing |
| RTA | GTTGACTCAGATTGGTTGCAC | 2519-2539 | Forward sequencing |
| RTB | CCTAGTATAAACAATGAGACAC | 2946-2967 | Forward sequencing |
| ProC1-down | CCCTGCTGGGTGTGGTATTCC | 2826-2846 | Reverse sequencing |
| RT-20 | CTGCCAGTTCTAGCTCTGCTTC | 3441-3462 | Reverse sequencing |
Third, data analysis
1. DNA sequence arrangement and splicing
And splicing, modifying and correcting the gene fragment obtained by sequencing by adopting ContigExpress software.
3.3.3.2 sequences were manually collated using BioEdit software, pol sequences were initially typed using the Los Alamos HIV Database (http:// www.hiv.lanl.gov) online tool HIV BLAST and the American NCBI (http:// www.ncbi.nlm.nih.gov/project/Genotyping/format. cgi) online subtype analysis tool Genotyping, pol genome-related subtype standard sequences were downloaded from Los Alamos HIV Database, aligned with the sequences obtained in this study, and verified by typing using MEGA6.0 software to construct a Neighor-join phylogenetic tree (1000 iterations) [ Tamura K, Peterson D, et al, 201l ]. Primary recombination analysis was performed using Los Alamos HIVDatabase on-line tools RIP and jphMM to locate recombination breakpoints with Simplot software and recombination mosaic patterns were determined by Recombinant HIV-1Drawing Tool.
2. The aligned sequences were submitted to Stanford HIV Drug Resistance mutation site analysis and interpretation of Drug Resistance variation
Five types of drug-resistant mutation judgment standards:
(1) sensitive (0-9 points): there is no evidence of reduced susceptibility of the sample virus to the drug;
(2) potential drug resistance (10-14 points): the virus carries mutations that do not themselves cause drug resistance, but the presence of these mutations indicates that there may have been drug selection pressure previously present;
(3) low drug resistance (15-29 points): the sensitivity of the virus to the drug has been reduced and/or the virological index of the patient to the treatment is not ideal;
(4) moderate resistance (30-59 points): the tolerance of the virus to the drug is between low and high drug resistance;
(5) high drug resistance (>60 min): the virus genotype is similar to the most resistant strains demonstrated in vitro, and patients with similar viruses generally have little or no virological response to drug treatment.
3. Statistical analysis
Statistical analysis age, CD using the SAS software package, using independent paired T-test4HIV-1 virus load copy data and the time of the antiviral drug to generate drug resistance are subjected to a normality test, a chi-square test is used for comparing the drug resistance generation condition of each antiviral drug and HIV-1 gene mutation sites, and the P value is less than 0.05, so that the statistical difference is obvious.
The present invention is illustrated in detail by the examples described above, but the present invention is not limited to the details described above, i.e., it is not intended that the present invention be implemented by relying on the details described above. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.
Claims (10)
1. A detection method for pregnant and lying-in women HIV-1 drug resistance is characterized by comprising the following steps:
(1) collecting blood of pregnant and lying-in women HIV patients and separating;
(2) for CD4+ T lymphocytes for counting and viral load detection;
(3) extracting RNA from a specimen with the virus number more than 1000 copies/ml;
(4) taking the RNA in the step (3) as a template, carrying out first PCR amplification on the base sequence at the outer side of the RNA, and then carrying out second PCR amplification on the base sequence at the inner side of the RNA;
(5) and (3) determining, splicing and checking the sequence of the positive product of the second PCR amplification, and screening out the mutation site generating the drug resistance.
2. The method for detecting HIV-1 resistance of pregnant and lying-in women according to claim 1, wherein the method comprises the following steps: in the step (1), the patient extracts peripheral venous blood by an aseptic technique, then adds an anticoagulant, fully and uniformly mixes the peripheral venous blood with blood cells, centrifuges the mixture, and takes upper plasma to be subpackaged into freezing tubes; meanwhile, the lymphocyte enrichment fluid under the plasma layer is sucked and put into the cryopreservation tubes, and all the cryopreservation tubes are numbered and stored in a refrigerator at the temperature of minus 80 ℃.
3. The method for detecting HIV-1 resistance of pregnant and lying-in women according to claim 1, wherein the method comprises the following steps: the CD is treated in the step (2)4The method for counting the + T lymphocytes comprises the steps of adding 15-25 mu l of antibody into a TruCount tube, adding 40-60 mu l of fully and uniformly mixed anticoagulated whole blood into the TruCount tube by a reverse sample adding method, vortex and uniformly mixing, placing for 10-20min at room temperature in a dark place, adding 450 mu l of 1 × FACS solution and dissolvingMixing hemocyanin with vortex, standing at room temperature in dark for 10-20min, loading onto machine within 24 hr, and collecting 15000 cells for detection.
4. The method for detecting HIV-1 resistance of pregnant and lying-in women according to claim 1, wherein the method comprises the following steps: and (3) extracting RNA by adopting a magnetic bead method.
5. The method for detecting HIV-1 resistance of pregnant and lying-in women according to claim 4, wherein the method comprises the following steps: before RNA extraction, pretreatment is required, and the method mainly comprises the following steps:
(1) taking out a plasma sample, balancing to room temperature, thawing for later use, and compiling a unique identification number of the sample on a sample tube;
(2) equilibrating the AVE buffer to room temperature;
(3) the pipette and the operation table are cleaned by sequentially disinfecting and wiping with 1% sodium hypochlorite, distilled water and 75% alcohol before and after each experiment, and the table surface is irradiated by an ultraviolet disinfection lamp.
(4) The plasma was mixed by inversion, adjusted to 1m L volume and the insoluble material was discarded.
(5) HIV RNA is extracted by a magnetic bead method.
6. The method for detecting HIV-1 resistance of pregnant and lying-in women according to claim 1, wherein the method comprises the following steps: the PCR amplification is nested asymmetric RT-PCR.
7. The method for detecting HIV-1 resistance of pregnant and lying-in women according to claim 6, wherein the method comprises the following steps: the length of the PCR amplification primer is an oligonucleotide chain of 19-30 bp; the base sequence of the upstream PCR amplification primer is selected from 5'-TTGGAAATGTGCAAAGGAAGGAC-3' at the outer upstream or 5'-CAGAGCCAACAGCCCCACCA-3' at the inner upstream; the downstream PCR amplification primer base sequence is one of 5'-CTGTATTTCTGCTATTAAGTCTTTGATGGG-3' downstream of the base sequence or 5'-CTGCCAGTTCTAGCTCTGCTTC-3' downstream of the base sequence.
8. The method for detecting HIV-1 resistance of pregnant and lying-in women according to claim 1, wherein the method comprises the following steps: the reaction system of the first PCR amplification is as follows:
9. the method for detecting HIV-1 resistance of pregnant and lying-in women according to claim 1, wherein the method comprises the following steps: the reaction system of the second PCR amplification is as follows:
10. the method for detecting HIV-1 resistance of pregnant women according to claim 8 or 9, wherein the method comprises the following steps: the circulation conditions of the reaction system for the first PCR amplification are as follows: 30min at 50 ℃, 5min at 94 ℃ and 1 cycle; 94 ℃ 30sec, 55 ℃ 30sec, 72 ℃ 2: 30min, 30 cycles; keeping the temperature at 72 ℃ for 10min and keeping the temperature at 4 ℃; the circulation conditions of the reaction system for the first PCR amplification are as follows: 5min at 94 ℃ for 1 cycle; 94 ℃ 30sec, 63 ℃ 30sec, 72 ℃ 2: 30min, 35 cycles; keeping the temperature at 72 ℃ for 10min and keeping the temperature at 4 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010486487.4A CN111560480A (en) | 2020-06-01 | 2020-06-01 | Method for detecting HIV-1 drug resistance of pregnant and lying-in women |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010486487.4A CN111560480A (en) | 2020-06-01 | 2020-06-01 | Method for detecting HIV-1 drug resistance of pregnant and lying-in women |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111560480A true CN111560480A (en) | 2020-08-21 |
Family
ID=72072501
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010486487.4A Withdrawn CN111560480A (en) | 2020-06-01 | 2020-06-01 | Method for detecting HIV-1 drug resistance of pregnant and lying-in women |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111560480A (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005040354A2 (en) * | 2003-10-24 | 2005-05-06 | Chiron Corporation | Sensitive monitor of anti-viral therapy |
| CN1982473A (en) * | 2005-12-16 | 2007-06-20 | 天津生物芯片技术有限责任公司 | Gene chip for inspecting IIIV P-reverse transcriptase inhibiting resistance and its reagent kit |
| WO2011036328A2 (en) * | 2009-09-25 | 2011-03-31 | Fundación Pública Andaluza Para La Gestión De La Investigación En Salud De Sevilla | Method for early detection of resistance to antiretroviral therapy in hiv |
| WO2013006684A1 (en) * | 2011-07-05 | 2013-01-10 | The Gov. Of The U.S.A. As Represented By The Secretary Of The Dept. Of Health And Human Services. | Hiv-1 genotyping assay for global surveillance of hiv-1 drug resistance |
| CN104946794A (en) * | 2015-06-01 | 2015-09-30 | 博奥生物集团有限公司 | HIV-1 genotype and drug resistant mutation site detection kit and application thereof |
| CN108866207A (en) * | 2018-08-06 | 2018-11-23 | 中国人民解放军军事科学院军事医学研究院 | The foundation and its application of novel HIV-1 Drug Resistance Detection method |
| CN111074004A (en) * | 2020-01-17 | 2020-04-28 | 复旦大学 | Human immunodeficiency virus 1 type drug-resistant genotype detection method and kit |
-
2020
- 2020-06-01 CN CN202010486487.4A patent/CN111560480A/en not_active Withdrawn
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005040354A2 (en) * | 2003-10-24 | 2005-05-06 | Chiron Corporation | Sensitive monitor of anti-viral therapy |
| CN1982473A (en) * | 2005-12-16 | 2007-06-20 | 天津生物芯片技术有限责任公司 | Gene chip for inspecting IIIV P-reverse transcriptase inhibiting resistance and its reagent kit |
| WO2011036328A2 (en) * | 2009-09-25 | 2011-03-31 | Fundación Pública Andaluza Para La Gestión De La Investigación En Salud De Sevilla | Method for early detection of resistance to antiretroviral therapy in hiv |
| WO2013006684A1 (en) * | 2011-07-05 | 2013-01-10 | The Gov. Of The U.S.A. As Represented By The Secretary Of The Dept. Of Health And Human Services. | Hiv-1 genotyping assay for global surveillance of hiv-1 drug resistance |
| CN104946794A (en) * | 2015-06-01 | 2015-09-30 | 博奥生物集团有限公司 | HIV-1 genotype and drug resistant mutation site detection kit and application thereof |
| CN108866207A (en) * | 2018-08-06 | 2018-11-23 | 中国人民解放军军事科学院军事医学研究院 | The foundation and its application of novel HIV-1 Drug Resistance Detection method |
| CN111074004A (en) * | 2020-01-17 | 2020-04-28 | 复旦大学 | Human immunodeficiency virus 1 type drug-resistant genotype detection method and kit |
Non-Patent Citations (1)
| Title |
|---|
| 潘克女: "HIV 感染者外周血单个核细胞中 HIV DNA 载量与 HIV RNA 及 CD4 + T 淋巴细胞间的关系", 《中国艾滋病性病》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rouet et al. | Transfer and evaluation of an automated, low-cost real-time reverse transcription-PCR test for diagnosis and monitoring of human immunodeficiency virus type 1 infection in a West African resource-limited setting | |
| Michelle Long et al. | Gender differences in HIV-1 diversity at time of infection | |
| Fujioka et al. | Analysis of enterovirus genotypes using single-strand conformation polymorphisms of polymerase chain reaction products | |
| WO2010102460A1 (en) | A method and kit for quantitative and qualitative detection of genetic material of pathogenic microorganisms | |
| WO2018035860A1 (en) | Multiplex taqman probe qpcr assay kit and method for simultaneous assay and quantitative analysis of four blood-borne viruses | |
| Zhao et al. | Nucleic acid testing and molecular characterization of HIV infections | |
| Steegen et al. | Evaluation of two commercially available alternatives for HIV-1 viral load testing in resource-limited settings | |
| Pao et al. | Serum hepatitis B virus DNA in hepatitis B virus seropositive and seronegative patients with normal liver function | |
| CN111500788B (en) | Kit for detecting human herpesvirus infection and detection method thereof | |
| Han et al. | Recent advances in detection technologies for COVID-19 | |
| Huang et al. | A novel RealTime HIV-1 Qualitative assay for the detection of HIV-1 nucleic acids in dried blood spots and plasma | |
| Van Doornum et al. | Development and implementation of real‐time nucleic acid amplification for the detection of enterovirus infections in comparison to rapid culture of various clinical specimens | |
| CN102559930A (en) | Kit of detecting hepahtis C virus by fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) | |
| Pattery et al. | Development and performance of conventional HIV-1 phenotyping (Antivirogram®) and genotype-based calculated phenotyping assay (virco® TYPE HIV-1) on protease and reverse transcriptase genes to evaluate drug resistance | |
| Zhang et al. | Early infant human immunodeficiency virus type 1 detection suitable for resource-limited settings with multiple circulating subtypes by use of nested three-monoplex DNA PCR and dried blood spots | |
| CN103045756A (en) | Reagent kit of detecting human immunodeficiency virus type 1 by fluorescence quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) | |
| Sharma et al. | In silico evaluation of the impact of the Omicron variant on the sensitivity of RT-qPCR assays for SARS-CoV-2 detection using whole genome sequencing | |
| CN104911277B (en) | A kind of kit and its detection method for detecting human immunodeficiency virus type 1 in dry blood cake sample | |
| CN114381552A (en) | Primer, probe and detection method for detecting porcine circovirus type 4 based on CRISPR-Cas12a | |
| Henderson et al. | HIV-1 populations in blood and breast milk are similar | |
| CN108998570B (en) | HIV-1 total DNA quantitative detection primer pair, probe and detection kit capable of covering multiple subtypes | |
| CN109457049B (en) | Composition, kit and method for genotyping detection of hepatitis B virus | |
| CN104846116B (en) | Detect PCR primer group, probe and its kit and detection method of human immunodeficiency virus type 1 | |
| CN102417936A (en) | Polymerase chain reaction (PCR) fluorescence quantitative detection kit and method for hepatitis B viruses (HBV) | |
| CN101122563A (en) | Hepatitis E virus fluorescent quantitative PCR detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20200821 |