CN104846116B

CN104846116B - Detect PCR primer group, probe and its kit and detection method of human immunodeficiency virus type 1

Info

Publication number: CN104846116B
Application number: CN201510175465.5A
Authority: CN
Inventors: 朱托夫
Original assignee: GUANGZHOU SUPBIO BIO-TECHNOLOGY Co Ltd
Current assignee: GUANGZHOU SUPBIO BIO-TECHNOLOGY Co Ltd
Priority date: 2015-04-14
Filing date: 2015-04-14
Publication date: 2018-01-16
Anticipated expiration: 2035-04-14
Also published as: CN104846116A

Abstract

The invention discloses PCR primer group, probe and its kit and detection method of detection human immunodeficiency virus type 1, the kit contains the primer sets and probe of high sensitive, design Multiple Cycle simultaneously mentions primer annealing temperature, reach high sensitivity and specificity, minimum detectability is sensitiveer than current other detection methods up to the cells of 1 DNA/ of the detectable 2 copy HIV of each reaction million.And the detection method and addition cell quantification system of the present invention, the DNA of HIV 1 and cell number can be quantified simultaneously in same reaction.It is simple, stably that preparation is additionally added in the kit of the present invention, reliable plasmid standards for quantitation of tracing to the source, current HIV DNA can be solved and quantitatively trace to the source sex chromosome mosaicism.Present invention can apply to HIV early detection, neonate or people at highest risk's HIV examination, 1 viral repositories of HIV detect, antiviral treatment curative effect evaluation, disease relapse controls and thoroughly criterion of cure foundation etc., and its method is simple to operate, and cost is low, acted on extensive clinical practice, be advantageous to popularization and application.

Description

Detect human immunodeficiency virus type 1 PCR primer group, probe and its kit and Detection method

Technical field

The invention belongs to field of virus detection, is related to a kind of PCR primer group for detecting human immunodeficiency virus type 1, visits Pin and its kit and detection method.

Background technology

AIDS be acquired immunodeficiency syndrome (acquired immunodeficiency syndrome, AIDS), be a kind of chronic lethal sexually transmitted disease, by human immunodeficiency virus (human immunodeficiency virus, HIV) cause, be divided into human immunodeficiency virus type 1（HIV-1）With the type of human immunodeficiency virus 2（HIV-2）, HIV-1 is mesh The preceding whole world main strain popular including China, HIV-2 types are only popular in West Africa at present.Human body is caused to be exempted from after HIV Epidemic disease function defect, so as to a series of clinical syndromes such as the sexy dye of chance of occurrence and tumours, case fatality rate is almost up to 100%.According to 2011 annual datas, AIDS have involved the multiple countries and regions of global 200d, and the infected's sum is more than 60,000,000,20,000,000 People dies from AIDS.Because the sick incubation period is long, disguise is strong, route of transmission is diversified, case fatality rate is high, both incompetent healings at present Medicine also without effective vaccine prevention, bring exceptional hardship to preventing and controlling.

China is currently in HIV/AIDS and is widely current the phase, and government takes a series of firm measures, effectively Illegal blood collecting and supplying behavior is controlled, blood use safety is ensured to greatest extent, but intravenous administration is taken drugs and passed through property The impetus for broadcasting HIV is not well controlled, and especially spread through sex intercourse turns into main mode of transmission, and in some areas The second generation for HIV person occur propagates (being spread through sex intercourse in mother-to-baby transmission, family), to the national HIV/AIDS nothing that runs rampant Doubt the effect played and added fuel to the flames.According to the treatment standard of national newest promulgation in 2014, wherein needing to carry out immediately more than 8 one-tenth With even lifelong HAART (Highly active antiretroviral therapy, HAART), The many-sides such as public affairs are defended, clinic, legislation, public security are respectively formed serious challenge.Expand HIV detections and antiviral therapy, early diagnosis are early controlled, drop Low new hair number and case fatality rate, the strategic objective of AIDS entirety prevention and control since being China " 12 ".

HIV detections both at home and abroad are primarily present problems with present：

（1）" window phase "（Refer to after infection to producing antibody in vivo and reaching this period between detection level, during which tool Infectious but antibody test are feminine gender, are influenceed by different detection methods and individual difference）And early diagnosis.After HIV infection really Surely the order that the virus marker thing infected occurs successively is：Viral nucleic acid（RNA and proviral DNA）, virus protein（Such as p24 Antigen）, antiviral antibody.At present, domestic and international HIV conventional detections are main or antibody serum detects（ELISA、WB）.This technology Established for more than 20 years, mature and reliable, but always by the puzzlement of so-called " window phase " problem, " window phase " typically 40 days with On.In terms of detection of nucleic acids, because virus marker thing occurs earlier, having antibody test technology incomparable in window phase reach Advantage.But limited by sensitivity, peripheral blood serum HIV RNA are detected at present（The virus load inspection listed both at home and abroad at present Test agent box detection limit is between 20 ~ 200 copies/mL）Still there are 11 days or so window phases.

Although HIV-1 is retrovirus, the virion with contagiousness is RNA, after HIV enters human body, can be entered Enter to CD4+ T cells, be DNA by the reverse transcriptase reverse transcription of itself, that is, usually said provirus, then it is incorporated into In the genome of cell, so as to infect T cell.The HIV-1 kit for detecting nucleic acid that the country has listed at present is by detecting blood The HIV RNA concentration of the inside come diagnose whether HIV infection.In early infection or carrying out the patient of anti-AIDS treatment In, free virus is seldom, and viral RNA is easily degraded in extraction process, and this kind of kit is difficult to detect.It is but thin Still there is the inhibition of HIV gene of integration in born of the same parents, once the immunocompetence of people declines or not timely medication, these viruses integrated Son will start to replicate, and make disease development.

（2）Viral repository detection.The clinical evaluation of result to HIV antiviral therapies is divided into " thoroughly curing " and " function Property cure ".The former requires that realization for a long time without any antiviral therapy, still can't detect HIV nucleic acid in vivo；The latter's effect class Like viral elite effector, low-level HIV-1 RNA and/or DNA are still can detect in vivo, but for a long time from HIV correlation diseases The infringement of trouble.Follow-up research finds that receiving HAART treatments patient's body, there is another latent form always in fact HIV-1, i.e., so-called viral repository.Chun etc. is found that for 1997 first is incorporated into static Memorability CD4+T lymphocytes In viral repository, its small portion contains the HIV DNA of integration, can restart duplication-assembling under certain stimulation Virus.These latent infection cells are sufficiently stable, thus viral repository be widely regarded as HAART can not be from patient's body The biggest obstacle that the main reason for interior removing HIV and AIDS are cured.

Viral repository correlation, which predominantly detects technology, in recent years includes：① QVOA（Quantitative viral outgrowth assay）, also known as IUPM（Infectious Units Per Million) analysis, by Siliciano and Siliciano is established for 2005.This method is higher to personnel and equipment requirement, expensive, and sample requirement amount is big（120- 180mL blood）, waste time and energy, and result accuracy influence factor is numerous, recall rate is relatively low, is not also suitable for tissue biopsy.② CD4+T lymphocyte counts, detected more using CD4/8/3 streamings instrument, but evidence suggests can directly reflect inhibition of HIV storage The change in storehouse, whether there is certain correlation and wait further to solve.3. RNA is detected.As described above, because HAART can be highly effective Ground controls patients blood plasma's HIV-1 rna contents, or even is reduced to the lower bound of routine clinical detection（20-50 copies/mL）With Under, and RNA detections require higher to the extraction of equipment, personnel and sample, therefore it can not be applied to viral repository and detect.

（3）The diagnosis of neonate's HIV.Its baby of mother of HIV is examined due to the presence of maternal antibody with antibody Survey method is usually the positive.But the baby for actually there was only 20%~60% can be in the uterus of mother, in childbirth and induced labor or pass through From its maternal infection HIV during postpartum breastfeeding.Neonatal positive can not illustrate it is HIV.Because parent HIV antibody As long as may last about 15 months, in general, baby does not show any symptom of HIV.Virocyte is trained The method of supporting is not a kind of reliable and practical method to baby；The detection of the special IgM antibodies of HIV is in the presence of maternal antibody and not Possible, the HIV antigens detected in the presence of excessive serum antibody in serum are also very difficult.To these reliable cores for baby The early diagnosis that sour method carries out HIV is highly important.In addition, infant is very fast by disease development after HIV, it is early Phase diagnosis delays to prevent disease development particularly important to taking remedy measures in time.

In summary, traditional HIV detection methods, " window phase ", time-consuming, cost and sample is limited to and requires high and inspection The features such as sensitivity is low is surveyed, needs a kind of high sensitive HIV DNA detection methods of exploitation badly.It is rarely seen both at home and abroad at present to have HIV DNA Detection kit, there is the HIV DNA PCR detection methods sensitivity that article is reported in every million cell detection to 10 copy HIV DNA or more.

The content of the invention

In order to solve the above problems, the present invention filters out highly sensitive and high specific primer sequence by lot of experiments Row and detection probe, and specific PCR response procedures and condition, construct high sensitive HIV-1 DNA PCR detection kits and Detection method, minimum detection limit is up to the detectable cells of 2 copy HIV-1 DNA/ million of each reaction.

It is an object of the invention to provide the PCR primer of detection human immunodeficiency virus type 1.

Another object of the present invention is to provide a kind of PCR detection kit for detecting human immunodeficiency virus type 1.

It is still another object of the present invention to provide a kind of PCR detection method for detecting detection human immunodeficiency virus type 1.

The technical solution used in the present invention is：

The PCR primer group of human immunodeficiency virus type 1 is detected, the primer sets are primer sets 1 or primer sets 2 or primer sets 3, wherein,

Primer sets 1 are by SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4、SEQ ID NO:5 With SEQ ID NO:6 compositions；

Primer sets 2 are by SEQ ID NO:2、SEQ ID NO:7、SEQ ID NO:8、SEQ ID NO:9、SEQ ID NO:10 With SEQ ID NO:11 compositions；

Primer sets 3 are by SEQ ID NO:4、SEQ ID NO:6、SEQ ID NO:10、SEQ ID NO:12、SEQ ID NO: 13 and SEQ ID NO:14 compositions.

The PCR detection probes of human immunodeficiency virus type 1 are detected, its sequence is：SEQ ID NO:15、SEQ ID NO: 16、SEQ ID NO:17、SEQ ID NO:18、SEQ ID NO:19、SEQ ID NO:20、SEQ ID NO:21 and SEQ ID NO:22；Or the nucleotide complementary sequence for those sequences.

Further, the fluorophor of the above-mentioned end of probe sequence 5 ' mark is a kind of in FAM, HEX, VIC, CY5, TET, is visited The quenching group of the end of pin sequence 3 ' mark is a kind of in TAMRA, MGB, BHQ.

A kind of PCR detection kit for detecting human immunodeficiency virus type 1, the kit contain at least one set of above-mentioned institute The primer sets stated.

Further, mentioned reagent box also contains detection probe；Specific probe conditions are as follows：

When containing primer sets 1 in kit, the kit just also contains probe SEQ ID NO:15 or its nucleotides it is mutual Complementary series；

When containing primer sets 2 in kit, probe SEQ ID NO are just also contained in the kit:16、SEQ ID NO: 17、SEQ ID NO:18 or those sequences nucleotide complementary sequence at least one probe；

When containing primer sets 3 in kit, probe SEQ ID NO are just also contained in the kit:19、SEQ ID NO: 20、SEQ ID NO:21、SEQ ID NO:22 or those sequences nucleotide complementary sequence at least one probe.

Further, mentioned reagent box also contains cell quantification primer sets and cell quantification probe, and the cell quantification draws Thing group is by SEQ ID NO:23 、SEQ ID NO:24、SEQ ID NO:25 and SEQ ID NO:26 compositions；The probe be containing SEQ ID NO:27 or be its nucleotide complementary sequence；

The fluorophor that cell quantification probe sequence is marked can select from FAM, HEX, VIC, CY5, TET, but be different from The fluorophor of above-mentioned testing goal gene probe.

Further, mentioned reagent box also contains：Robust positive control product, weakly positive reference substance, negative controls, the positive are fixed Measure reference material and containTaqThe enzyme system of enzyme and UNG enzymes.

Further, above-mentioned positive qualitative reference product are 8E5 or Ach2 cell line genomes, for simultaneously to HIV DNA And cell number quantifies.

A kind of PCR detection method for detecting human immunodeficiency virus type 1, it is characterised in that：Comprise the following steps：

1）DNA is extracted：

Take whole blood sample to be measured, negative quality-control product, weakly positive quality-control product, strong positive quality-control product, positive qualitative reference product each 200 μ l, using QIAamp DNA Blood Mini Kit extracts kits, by specification operation, divide extraction each group sample DNA is as template；

2）PCR reaction systems：

The μ L of PCR reaction solutions 29.2；

The μ L of enzyme system 0.8；

The μ L of DNA profiling 20；

3）PCR response procedures：

By taking ABI7500 as an example, the first step：37 DEG C 5 minutes；Second step：95 DEG C 10 minutes；3rd step： 95 ℃ 15 seconds, 62 ~ 68 DEG C 15 seconds, 72 DEG C 20 seconds, 5 ~ 8 circulation；4th step：95 DEG C 15 seconds, 62 ~ 65 DEG C 15 Second, 72 DEG C 20 seconds, 5 ~ 8 circulation；5th step：95 DEG C 15 seconds, 60 DEG C 1 minute, 40 circulation；Gathered at 60 DEG C glimmering Light；

4）Interpretation of result：

Reaction automatically saves result after terminating, and the curve of amplification curve and the amplification of corresponding cell to HIV-1 DNA is carried out Analyze respectively；Click on Analyze to be analyzed, the canonical plotting under Std Curve windows is reached optimal, i.e., Correlation numerical value is between -1.0 ~ -0.98, then to recording quantitative result under Plate windows；

HIV-1 DNA contents result calculates in cell：

With in a sample, with the quantitative HIV-1 DNA quantitative values of 2 standard curves divided by cell quantification value, bid is obtained HIV-1 DNA contents in each cell in this.

Further, in above-mentioned whole detection process, it need to ensure that each sample meets following quality requirement：

1. negative quality-control product：HIV-1 DNA cloning curve is shown without CT values；

2. weakly positive reference material：Detected value is between 0.00005 ~ 0.005copies/cell；

3. strong positive reference material：Detected value is between 0. 05 ~ 0.5copies/cell；

4. the result of positive qualitative reference product is the positive, Ct values ＜ 30, and 2 standard curve linearly dependent coefficients 0.98 ≤ r ≤ 1；

Requirements above needs meet that otherwise, this experiment is invalid, need to re-start simultaneously in once experiment.

The beneficial effects of the invention are as follows：

1）The high sensitive HIV-1 DNA PCR detection kits minimum detectability of the present invention is up to each reaction detectable 2 Copy the cells of HIV-1 DNA/ million；

2）The detection method of the high sensitive HIV-1 DNA PCR detection kits and its detection method of the technology of the present invention exploitation HIV-1 DNA and cell number can be quantified simultaneously；

3）The high sensitive HIV-1 PCR detection kits and its detection method of the technology of the present invention exploitation are due to spies such as high sensitivities Property, its clinical practice is extensive, can be used for：1. HIV-1 infects early detection；2. neonate or people at highest risk's HIV examination；③ HIV-1 viruses repository detects；4. antiviral treatment curative effect evaluation, disease relapse are controlled and thoroughly criterion of cure is established.

4）In the method for the invention, conventional fluorescent probe PCR is innovated, by adding 3 pairs of PCR primers, used Multiple circulations, and improve primer annealing temperature, make the present invention HIV-1 DNA PCR detection methods reach high sensitivity and Specificity, wherein minimum detectability are up to/million cells of the copy of detection 2 in each PCR.Meanwhile the present invention is also in PCR reactions Add cell quantification reaction system, you can HIV-1 DNA and cell number are quantified simultaneously in same PCR reactions（Often Rule method needs in addition to count cell concentration）.Furthermore the inventive method uses 8E5 or Ach2 cell line gradient concentration bases Because group being used as plasmid standards for quantitation, due to only incorporating a HIV-1 DNA in each 8E5 or Ach2 cells, therefore can pass through 8E5 or Ach2 genomic RNA numbers in OD values quantitative determination standard items, you can obtain plasmid standards for quantitation and correspond to HIV-1 DNA copies Number, solve HIV-1 DNA and quantitatively trace to the source sex chromosome mosaicism, and preparation method is reliable and stable.

Brief description of the drawings

Fig. 1 is reagent standard curve amplification figure of the present invention；

Fig. 2 is the specificity experiments figure of embodiment 4；

Fig. 3 is the sensitivity experiment figure of embodiment 5；

Fig. 4 is the linear quantitative regression curve of embodiment 5.

Embodiment

With reference to specific embodiment, the present invention is further illustrated, but is not limited thereto

Embodiment 1：Detect human immunodeficiency virus type 1 DNA PCR primer group

Early stage of the invention is by design of primers principle and combines actual conditions, designs a large amount of detection human immunodeficiencies 1 type DNA of poison PCR primer, highly sensitive and the primer sequence of high specific and detection are then filtered out by lot of experiments Probe, the final PCR primer group for choosing detection human immunodeficiency virus type 1 DNA best results, including 3 groups, its nucleosides Acid sequence difference is as follows：

Primer sets 1：

SEQ ID NO:1:TCTGGCTAACTAGGGAACCCACTGCT ；

SEQ ID NO:2：TGCGCGCTTCAAGCCGAGTCCTGCGT；

SEQ ID NO:3：AGGGAACCCACTGCTTAAGCCTCAATAAAGCT；

SEQ ID NO:4：AGCAAGCCGAGTCCTGCGTCGAGA ；

SEQ ID NO:5：AGCCTCAATAAAGCTTGCCT ；

SEQ ID NO:6：CCGCCACTGCTAGAGATTTTCCA；

Correspondingly the detection probe of primer sets 1 is：SEQ ID NO:15：TCTGGTAACTAGAGATCCCT is the sequence Nucleotide complementary sequence.

Primer sets 2：

SEQ ID NO:2：TGCGCGCTTCAAGCCGAGTCCTGCGT；

SEQ ID NO:7：GGTTAGACCAGATCTGAGCCTGGGAGCT ；

SEQ ID NO:8：GGAACCCACTGCTTAAGCCTCAATAAAGCTTGC；

SEQ ID NO:9：TGTTCGGGCGCCACTGCTAGAGA；

SEQ ID NO:10：AAGCCTCAATAAAGCTTGCCTTGA ；

SEQ ID NO:11：AGGGTCTGAGGGATCTCTAGTTACCAGAG；

The detection probe of corresponding primer sets 2 is selected from least one of following probe sequence：

SEQ ID NO:16：TTCAAGTAGTGTGTGCCC ；

SEQ ID NO:17：AGTAGTGTGTGCCCGTCT；

SEQ ID NO:18：TAGTGTGTGCCCGTCTGT；

Or the nucleotide complementary sequence for those sequences；

Primer sets 3：

SEQ ID NO:4：AGCAAGCCGAGTCCTGCGTCGAGA；

SEQ ID NO:6：CCGCCACTGCTAGAGATTTTCCA；

SEQ ID NO:10：AAGCCTCAATAAAGCTTGCCTTGA；

SEQ ID NO:12：ACCAGATCTGAGCCTGGGAGCT ；

SEQ ID NO:13：GCTAACTAGGGAACCCACTGCT；

SEQ ID NO:14：TTCGGGCGCCACTGCTA；

The detection probe of corresponding primer sets 3 is selected from least one of following probe sequence：

SEQ ID NO:19：TGTTGTGTGTGACTCTGGTAACTAGAGA ；

SEQ ID NO:20：TGTTGTGTGTGACTCTGGTAACTA；

SEQ ID NO:21：TGTGTGTGACTCTGGTAACTAGAGA；

SEQ ID NO:22：TGTTGTGTGTGACTCTGGTAACTAG；

Or the nucleotide complementary sequence for those sequences.

Embodiment 2：Detect the PCR detection kit of human immunodeficiency virus type 1

The PCR detection kit of detection human immunodeficiency virus type 1 includes following composition：

1）Contain at least one set of primer sets described in embodiment 1；

2）Contain detection probe：

The fluorophor that the end of probe sequence 5 ' marks is any one in FAM, HEX, VIC, CY5, TET, probe sequence 3 ' The quenching group of end mark is any one in TAMRA, MGB, BHQ.

3）Cell quantification primer sets and cell quantification probe, its sequence are respectively：

Cell quantification primer sets sequence is：

SEQ ID NO:23：CGGGGTCACCCACACTGTGCCCATCTACG；

SEQ ID NO:24：GGTCACCCACACTGTGCCCATCTACG；

SEQ ID NO:25：CCACACTGTGCCCATCTACGA；

SEQ ID NO:26：GCGCTCGGTGAGGATCTT C；

Cell quantification probe sequence is：

SEQ ID NO:27：ATGCCCTCCCCCATGCCATCCT is its nucleotide complementary sequence；

The fluorophor that cell quantification probe sequence is marked can select from FAM, HEX, VIC, CY5, TET, but be different from 2）Described in probe mark fluorescent group.

4）PCR reaction solutions：Contain 15 ~ 25mM Tris-HCl (pH8.0), 15 ~ 25mM KCl, 2.5 ~ 5mM (NH₄)SO₄, 2~5mM MgCl₂, 0.5 ~ 2mM dNTP/UTP Mix, 200 ~ 600Nm HIV-1 DNA primer groups, 100 ~ 300nM HIV-1 DNA probe, 200 ~ 600nM cell quantification primer sets, 100 ~ 300nM cell quantification probes.

5）Also contain enzyme system（TaqEnzyme mixes with UNG enzymes）, strong positive quality-control product, weakly positive quality-control product, negative controls and Positive qualitative reference product.Wherein, negative quality-control product is physiological saline；Strong positive quality-control product and weakly positive quality-control product are containing HIV-1 Gene order and the sequence plasmid of amplification gene containing cell quantification, and HIV-1 bases in strong positive quality-control product and weakly positive quality-control product The concentration of cause is respectively between 0.05 ~ 0.5 copies/cell and 0.0005 ~ 0.005 copies/cell.

Embodiment 3：Detect the detection method of human immunodeficiency virus type 1 PCR detection kit

The detection kit established using embodiment 2, is detected, step is as follows to detected sample：

1）DNA is extracted：

Take whole blood sample to be measured, negative quality-control product, weakly positive quality-control product, strong positive quality-control product, positive qualitative reference product each 200 μ l, using QIAamp DNA Blood Mini Kit extracts kits, middle whole blood sample extraction step behaviour to specifications Make, elution volume 100uL, the DNA in extraction acquisition each group sample is as follow-up pcr template respectively；

2）PCR reaction systems：

The μ L of PCR reaction solutions 29.2；

The μ L of enzyme system 0.8；

The μ L of DNA profiling 20；

3）PCR response procedures：

4）Interpretation of result：

Reaction automatically saves result after terminating, and the curve of amplification curve and the amplification of corresponding cell to HIV-1 DNA is carried out Analyze respectively.According to the Value values of image adjustment Baseline Start values, End values and Threshold after analysis（With Family can voluntarily adjust according to actual conditions, and Start values can adjust negative quality-control product in 1-10, Stop values in 5-20 Amplification curve is straight or less than threshold line）, click on Analyze and analyzed, reach the canonical plotting under Std Curve windows To optimal, i.e. Correlation numerical value is between -1.0 ~ -0.98.Then arrive under Plate windows and record quantitative result.

HIV-1 DNA contents result calculates in cell：

With in a sample, with the quantitative HIV-1 DNA quantitative values of 2 standard curves（Unit：copies/μL）It is divided by thin Born of the same parents' quantitative result（Unit：cells/μL）, draw in sample HIV-1 DNA contents in each cell（Unit：copies/ cell）.

5）Quality control

In whole detection process, it need to ensure that each sample meets following quality requirement：

4. positive qualitative reference product（FAM passages and VIC passages）Result be the positive, Ct values ＜ 30, and 2 standards Curve linear coefficient correlation 0.98≤r≤1.

Standard curve amplification is as shown in Figure 1.Red expands for HIV-1 DNA quantitation curves；Green is cell quantification Standard curve expands.

Embodiment 4：Specificity experiments

124 HIV-1 ' negative ' specimens or healthy population sample are detected, it is HBV that ' negative ' specimens, which include, 1 type is simple Herpesviral, herpes simplex types 2 virus, varicella virus, Epstein-Barr virus, cytomegalovirus, 6 type herpe simplexes disease Poison, hepatitis A virus, HCV, flavivirus, the type of human T-leukemia virus 1 and 2 types, COxsackie disease Malicious B3 and the nucleic acid of Escherichia coli extraction are detected, and are as a result shown as negative（100%）（As shown in Fig. 2 red is HIV-1 DNA cloning, it is feminine gender；Green expands for cell quantification）.Result above proves that the inventive method has specificity well.

Embodiment 5：Sensitivity and range of linearity experiment

（1）Human immunodeficiency virus type 1 DNA PCR detection kit sensitivity analysis

HIV negative cells are diluted into 8E5 cells（1 copy HIV-1 DNA is incorporated in genome）To concentration be every 1 × 10⁶Contain 10 8E5 cells in individual cell（2 copy HIV-1 DNA of detection in being reacted equivalent to each PCR）, using embodiment 3 kit and detection method detects to HIV-1 DNA.Testing result by being repeated several times as shown in figure 3, detected, originally The minimum detectability of invention（2 cells of copy HIV-1 DNA/ million of detection in each PCR reactions）Recall rate is up to 96%.

（2）The range of linearity of human immunodeficiency virus type 1 DNA PCR detection kit

HIV negative cells are diluted into 8E5 cells（1 copy HIV-1 DNA is incorporated in genome）It is every hundred to concentration Contain 1 × 10 in ten thousand cells⁶、1×10⁵、1×10⁴、1×10³、1×10²With 10 8E5 cells, using the kit of embodiment 3 And detection method detects to HIV-1 DNA, its detected value and average is taken to carry out result calculating and judgement.Carrying out data warp can With property inspection and multinomial regression analysis, and after precision test, it is determined that in detection range, this reagent result is linear.Most Termination fruit shows that linear coverage is 0.00001 ~ 1 copies/cell, the linear regression curves of HIV-1 quantitation curves Figure is as shown in figure 4, R²=0.995。

（3）Detection method and conventional fluorescent PCR comparison

Utilize embodiment 5（2）The dilution process, by 8E5 cells be diluted in every million cell respectively containing 200,100, 20th, 10,5 and 2 8E5 cells, the detection method described in embodiment 3, after nucleic acid extraction, carry out respectively detection method and Conventional fluorescent PCR method detects.As a result conventional fluorescent PCR method detection positive rate be respectively：100%、95%、50%、25%、 10% and 0%；The inventive method Positive rate is respectively：100%、100%、100%、95%、60%、20%.

Embodiment 6：Clinical samples detect

HIV Screening tests contrast with Western Blot methods in detection method faggotry crowd（Accuracy）

HIV Western Blot detection methods are at present by as HIV diagnosis method.By with Shenzhen CDC AIDS Anti- center cooperation processed, with the HIV-1 DNA detection kits and Western Blot detection methods of the present invention simultaneously to 191 Faggotry's whole blood sample is detected, as a result such as table 1：

The inventive method and WB detection methods uniformity 99.0% as seen from Table 1.Its 2 sample not being inconsistent（Present invention inspection Survey is the positive, and WB detections are feminine gender）, the HIV-1 positives are confirmed that it is through CD4+/CD8+ cell counts.The result pair Than further demonstrate sensitivity and accuracy of the present invention in detection method.

<110>Guangzhou Supbio Bio-Technology Co., Ltd.

<120>Detect PCR primer group, probe and its kit and detection method of human immunodeficiency virus type 1

<130>

<160> 27

<170> PatentIn version 3.5

<210> 1

<211> 26

<212> DNA

<213>Artificial primer

<400> 1

tctggctaac tagggaaccc actgct 26

<210> 2

<211> 26

<212> DNA

<213>Artificial primer

<400> 2

tgcgcgcttc aagccgagtc ctgcgt 26

<210> 3

<211> 32

<212> DNA

<213>Artificial primer

<400> 3

agggaaccca ctgcttaagc ctcaataaag ct 32

<210> 4

<211> 24

<212> DNA

<213>Artificial primer

<400> 4

agcaagccga gtcctgcgtc gaga 24

<210> 5

<211> 20

<212> DNA

<213>Artificial primer

<400> 5

agcctcaata aagcttgcct 20

<210> 6

<211> 23

<212> DNA

<213>Artificial primer

<400> 6

ccgccactgc tagagatttt cca 23

<210> 7

<211> 28

<212> DNA

<213>Artificial primer

<400> 7

ggttagacca gatctgagcc tgggagct 28

<210> 8

<211> 33

<212> DNA

<213>Artificial primer

<400> 8

ggaacccact gcttaagcct caataaagct tgc 33

<210> 9

<211> 23

<212> DNA

<213>Artificial primer

<400> 9

tgttcgggcg ccactgctag aga 23

<210> 10

<211> 24

<212> DNA

<213>Artificial primer

<400> 10

aagcctcaat aaagcttgcc ttga 24

<210> 11

<211> 29

<212> DNA

<213>Artificial primer

<400> 11

agggtctgag ggatctctag ttaccagag 29

<210> 12

<211> 22

<212> DNA

<213>Artificial primer

<400> 12

accagatctg agcctgggag ct 22

<210> 13

<211> 22

<212> DNA

<213>Artificial primer

<400> 13

gctaactagg gaacccactg ct 22

<210> 14

<211> 17

<212> DNA

<213>Artificial primer

<400> 14

ttcgggcgcc actgcta 17

<210> 15

<211> 20

<212> DNA

<213>If probes

<400> 15

tctggtaact agagatccct 20

<210> 16

<211> 18

<212> DNA

<213>If probes

<400> 16

ttcaagtagt gtgtgccc 18

<210> 17

<211> 18

<212> DNA

<213>If probes

<400> 17

agtagtgtgt gcccgtct 18

<210> 18

<211> 18

<212> DNA

<213>If probes

<400> 18

tagtgtgtgc ccgtctgt 18

<210> 19

<211> 28

<212> DNA

<213>If probes

<400> 19

tgttgtgtgt gactctggta actagaga 28

<210> 20

<211> 24

<212> DNA

<213>If probes

<400> 20

tgttgtgtgt gactctggta acta 24

<210> 21

<211> 25

<212> DNA

<213>If probes

<400> 21

tgtgtgtgac tctggtaact agaga 25

<210> 22

<211> 25

<212> DNA

<213>If probes

<400> 22

tgttgtgtgt gactctggta actag 25

<210> 23

<211> 29

<212> DNA

<213>Artificial primer

<400> 23

cggggtcacc cacactgtgc ccatctacg 29

<210> 24

<211> 26

<212> DNA

<213>Artificial primer

<400> 24

ggtcacccac actgtgccca tctacg 26

<210> 25

<211> 21

<212> DNA

<213>Artificial primer

<400> 25

ccacactgtg cccatctacg a 21

<210> 26

<211> 19

<212> DNA

<213>Artificial primer

<400> 26

gcgctcggtg aggatcttc 19

<210> 27

<211> 22

<212> DNA

<213>If probes

<400> 27

atgccctccc ccatgccatc ct 22

Claims

1. detecting the PCR primer group and probe of human immunodeficiency virus type 1, the primer sets are primer sets 1 or primer sets 2 or drawn Thing group 3, wherein,

Primer sets 1 are by SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4、SEQ ID NO:5 and SEQ ID NO:6 compositions；

Primer sets 2 are by SEQ ID NO:2、SEQ ID NO:7、SEQ ID NO:8、SEQ ID NO:9、SEQ ID NO:10 Hes SEQ ID NO:11 compositions；

Primer sets 3 are by SEQ ID NO:4、SEQ ID NO:6、SEQ ID NO:10、SEQ ID NO:12、SEQ ID NO:13 Hes SEQ ID NO:14 compositions；

Probe sequence is：SEQ ID NO:15、SEQ ID NO:16、SEQ ID NO:17、SEQ ID NO:18、SEQ ID NO: 19、SEQ ID NO:20、SEQ ID NO:21 and SEQ ID NO:22；Or the nucleotide complementary sequence for those sequences.

2. the PCR primer group and probe of detection human immunodeficiency virus type 1 according to claim 1, it is characterised in that： The fluorophor of the end of probe sequence 5 ' mark is a kind of in FAM, HEX, VIC, CY5, TET, and the end mark of probe sequence 3 ' is quenched Group is a kind of in TAMRA, MGB, BHQ.

A kind of 3. PCR detection kit for detecting human immunodeficiency virus type 1, it is characterised in that：The kit contains at least Primer sets described in one group of claim 1；

The kit also contains detection probe；Specific probe conditions are as follows：

When containing primer sets 1 in kit, the kit just also contains probe SEQ ID NO:15 or its nucleotide complementary sequence Row；

When containing primer sets 2 in kit, probe SEQ ID NO are just also contained in the kit:16、SEQ ID NO:17、 SEQ ID NO:18 or those sequences nucleotide complementary sequence at least one probe；

When containing primer sets 3 in kit, probe SEQ ID NO are just also contained in the kit:19、SEQ ID NO:20、 SEQ ID NO:21、SEQ ID NO:22 or those sequences nucleotide complementary sequence at least one probe.

4. a kind of PCR detection kit for detecting human immunodeficiency virus type 1 according to claim 3, its feature exist In：The kit also contains cell quantification primer sets and cell quantification probe, and the cell quantification primer sets are by SEQ ID NO: 23、SEQ ID NO:24、SEQ ID NO:25 and SEQ ID NO:26 compositions；The cell quantification probe is SEQ ID NO:27 Or it is its nucleotide complementary sequence；

The fluorophor that cell quantification probe sequence is marked selects from FAM, HEX, VIC, CY5, TET, but is different from right It is required that the fluorophor of 3 detection probes.

5. a kind of PCR detection kit for detecting human immunodeficiency virus type 1 according to claim 3, its feature exist In：The kit also contains：Robust positive control product, weakly positive reference substance, negative controls, positive qualitative reference product and contain Taq enzyme and the enzyme system of UNG enzymes.

6. a kind of PCR detection kit for detecting human immunodeficiency virus type 1 according to claim 5, its feature exist In：Described positive qualitative reference product are 8E5 or Ach2 cell line genomes, for being quantified to HIV DNA and cell number simultaneously.

A kind of 7. PCR detection method for detecting human immunodeficiency virus type 1, it is characterised in that：Comprise the following steps：

1) DNA is extracted：

Take whole blood sample to be measured, negative quality-control product, weakly positive quality-control product, strong positive quality-control product, each 200 μ of positive qualitative reference product L, using QIAamp DNA Blood Mini Kit extracts kits, by specification operation, the DNA of point extraction each group sample makees For template；

2) PCR reaction systems：

The μ L of PCR reaction solutions 29.2；

The μ L of enzyme system 0.8；

The μ L of DNA profiling 20；

3) PCR response procedures：

By taking ABI7500 as an example, the first step：37 DEG C 5 minutes；Second step：95 DEG C 10 minutes；3rd step：95 DEG C 15 seconds, 62~68 DEG C 15 seconds, 72 DEG C 20 seconds, 5~8 circulation；4th step：95 DEG C 15 seconds, 62~65 DEG C 15 seconds, 72 DEG C 20 seconds, 5~8 circulation；The Five steps：95 DEG C 15 seconds, 60 DEG C 1 minute, 40 circulation；Fluorescence is gathered at 60 DEG C；

4) interpretation of result：

Reaction automatically saves result after terminating, and the curve of amplification curve and the amplification of corresponding cell to HIV-1DNA is divided respectively Analysis；Click on Analyze to be analyzed, the canonical plotting under Std Curve windows is reached optimal, i.e. Correlation numbers Value is between -1.0~-0.98, then to recording quantitative result under Plate windows；

HIV-1DNA content results calculate in cell：

With in a sample, with the quantitative HIV-1DNA quantitative values of 2 standard curves divided by cell quantification value, draw every in sample HIV-1DNA contents in individual cell；

The above method is used for the diagnosis or treatment of non-disease；

The PCR reaction solutions contain 15~25mM Tris-HCl pH8.0,15~25mM KCl, 2.5~5mM (NH₄)₂SO₄, 2 ~5mM MgCl₂, 0.5~2mM dNTP/UTP Mix, 200~600Nm HIV-1DNA primer sets, 100~300nM HIV- 1DNA probes, 200~600nM cell quantification primer sets, 100~300nM cell quantification probes, the primer sets are claim Primer sets described in 1, the probe are the probe described in claim 1.

8. detection method according to claim 7, it is characterised in that：In whole detection process, it need to ensure that each sample expires It is enough lower quality requirement：

1. negative quality-control product：HIV-1DNA amplification curves are shown without CT values；

2. weakly positive reference material：Detected value is between 0.00005~0.005copies/cell；

3. strong positive reference material：Detected value is between 0.05~0.5copies/cell；

4. the result of positive qualitative reference product is the positive, Ct values ＜ 30, and 2 0.98≤r of standard curve linearly dependent coefficient ≤1；