CN111073822A - Saccharomyces cerevisiae engineering bacterium for producing dihydroartemisinic acid and construction method and application thereof - Google Patents

Abstract

The invention relates to the technical field of microorganisms, and discloses a saccharomyces cerevisiae engineering bacterium for producing dihydroartemisinic acid. The engineering bacteria of the invention enable the original sequence of the ALDH1 to be the ALDH1 with expression mutation on the basis of the saccharomyces cerevisiae modified by the dihydroartemisinic acid saccharomyces cerevisiae heterologous synthesis way^H194ROr ALDH1^V247FThe sequence of (a). The invention carries out site-directed mutagenesis on the key gene ALDH1 of the pathway to obtain a gene with better selectivity, so that the metabolic pathway is more favorable for synthesizing dihydroartemisinic acid, and the proportion of the artemisinic acid is reduced. Two mutants, ALDH1^H194RAnd ALDH1^V247FIt has been demonstrated in the present invention that the ratio dihydroartemisinic acid/artemisinic acid can be increased. On the basis, fusion expression of DBR2 and ADH1 and fusion expression of mutant ALDH1 and DBR2 can further improve dihydroArtemisinic acid/artemisinic acid ratio without sacrificing dihydroartemisinic acid production.

Description

Saccharomyces cerevisiae engineering bacterium for producing dihydroartemisinic acid and construction method and application thereof

Technical Field

The invention relates to the technical field of microorganisms, in particular to a saccharomyces cerevisiae engineering bacterium for producing dihydroartemisinic acid and a construction method and application thereof.

Background

Artemisinin is an effective antimalarial drug, and its numerous derivatives were recognized by the world health organization as a first-line antimalarial drug in 2002. At present, artemisinin is obtained mainly by directly extracting from a plant artemisia apiacea. Southernwood is distributed all over the world, but the content of artemisinin in most southernwood is very low (less than or equal to 1 per thousand), and the extraction cost is higher. The chemical synthesis method for synthesizing artemisinin from the beginning has the disadvantages of high synthesis difficulty, high cost and being not feasible economically due to the complex structure of artemisinin molecules. The biological semisynthesis method for obtaining artemisinin becomes the best choice, namely, microorganisms are transformed through genetic engineering to produce artemisinin precursors, namely arteannuin, arteannuic acid or dihydroarteannuic acid and the like, and artemisinin is synthesized through a few simple chemical synthesis methods.

Wherein, dihydroarteannuic acid is the most direct precursor for synthesizing artemisinin, and all other precursors (such as arteannuic acid and the like) need to be synthesized into dihydroarteannuic acid by a chemical method first to further synthesize artemisinin.

For example, Paddon CJ et al heterogeneously synthesizes a large amount of artemisinic acid by using Saccharomyces cerevisiae in 2013, and synthesizes dihydroartemisinic acid by a chemical method, thereby synthesizing artemisinin. However, the process of biologically synthesizing arteannuic acid first and then chemically converting dihydroarteannuic acid produces chiral dihydroarteannuic acid in the 11-S form as a by-product, which cannot be used as a raw material for the subsequent synthesis of artemisinin.

The situation can be avoided in the technology for heterogeneously and directly synthesizing the dihydroartemisinic acid by using the microorganism, for example, the dihydroartemisinic acid can be directly heterogeneously synthesized by using saccharomyces cerevisiae, and in 2008, Zhang Y and the like firstly synthesize the dihydroartemisinic acid in the saccharomyces cerevisiae by expressing key genes such as DBR2 and the like;

dihydroartemisinic acid is a sesquiterpene derivative, which has been constructed by the following heterologous biosynthetic pathway of Saccharomyces cerevisiae: the yeast utilizes ethanol as a carbon source, firstly converts the ethanol into acetyl-CoA, then enters a Mevalonate (MVA) pathway to synthesize farnesyl pyrophosphate (FPP) with 15 carbons, then takes the FPP as a substrate, synthesizes arteannuadiene through catalysis of arteannuadiene synthetase (ADS), then is oxidized into arteannuin by P450 mono-oxidase CYP71AV1, CPR1 and CYB5 can assist the step, then the arteannuin synthesizes arteannuin under catalysis of ADH1, arteannuin synthesizes dihydroarteannuin under catalysis of DBR2, finally dihydroarteannuin is generated through catalysis of ALDH1, and the arteannuin can be directly catalyzed by ALDH1 to generate byproduct arteannuin a, wherein the specific synthesis pathway is shown in figure 1. In the approach, key enzymes which are lacked by the saccharomyces cerevisiae are ADS, CYP71AV1, CPR1, CYB5, ADH1, DBR2 and ALDH1, and under the premise of not considering the yield, sequences for expressing the enzymes are introduced into the saccharomyces cerevisiae in a gene integration mode or a recombinant plasmid mode, so that the dihydroartemisinic acid can be produced.

Based on the metabolic pathway, the patent CN201676830. X completes the construction of recombinant strains by gene integration and plasmid introduction of several key enzymes ADS, CYP71AV1, CPR1, CYB5, ADH1, DBR2 and ALDH1 required by the metabolic pathway, and over-expresses some Saccharomyces cerevisiae endogenous genes, so that the yield of synthesizing dihydroartemisinic acid by Saccharomyces cerevisiae can be increased to 1.17 g/L.

Although the technology of directly synthesizing dihydroartemisinic acid by using microorganism heterologous does not have the situation of synthesizing chiral dihydroartemisinic acid by-product, but produces artemisinic acid as by-product at the same time, the recombinant strain constructed by the prior patent CN201610876830.X has the ratio of dihydroartemisinic acid/artemisinic acid of only 2.53, which shows that the proportion of artemisinic acid in the recombinant strain is too high to affect the production of target substance.

Disclosure of Invention

In view of the above, the invention aims to provide a saccharomyces cerevisiae engineering bacterium for producing dihydroartemisinic acid and a construction method thereof, so that the engineering bacterium can obviously improve the ratio of dihydroartemisinic acid to artemisinic acid and reduce the output of the artemisinic acid;

the invention also aims to provide the engineering bacteria of the saccharomyces cerevisiae for producing the dihydroartemisinic acid and the construction method thereof, so that the engineering bacteria can obviously improve the ratio of the dihydroartemisinic acid to the artemisinic acid and reduce the output of the artemisinic acid on the premise of ensuring that the yield of the dihydroartemisinic acid is not reduced;

the invention also aims to provide the application of the engineering bacteria in producing the dihydroartemisinic acid and the application of the core gene component in the engineering bacteria in constructing the engineering bacteria for producing the dihydroartemisinic acid.

In order to achieve the above purpose, the invention provides the following technical scheme:

a Saccharomyces cerevisiae engineering strain modified by dihydroartemisinic acid Saccharomyces cerevisiae heterologous synthesis way, a Saccharomyces cerevisiae chassis strain modified by dihydroartemisinic acid Saccharomyces cerevisiae heterologous synthesis way, wherein the original sequence for expressing ALDH1 is ALDH1 for expressing mutation^H194ROr expression of a mutated ALDH1^V247FThe sequence of (a).

The saccharomyces cerevisiae engineering bacteria are established on the basis of saccharomyces cerevisiae modified by a dihydroartemisinic acid saccharomyces cerevisiae heterologous synthesis way, and perform site-directed mutation on a key gene ALDH1 of a path to obtain a gene with better selectivity, so that a metabolic path is more favorable for synthesis of dihydroartemisinic acid, and the proportion of the artemisinic acid is reduced. Wherein, ALDH1^H194RThat is, histidine at position 194 of ALDH1 is mutated to arginine; ALDH1^V247FThat is, valine at position 247 of ALDH1 was mutated to phenylalanine.

Preferably, the saccharomyces cerevisiae modified by the heterologous synthesis pathway of saccharomyces cerevisiae dihydroartemisinic acid can be any saccharomyces cerevisiae strain, such as saccharomyces cerevisiae of the cen.pk2 system commonly used in the art, and in the specific embodiment of the invention, saccharomyces cerevisiae of the cen.pk2.1c.

The general saccharomyces cerevisiae can not synthesize dihydroartemisinic acid, seven key enzymes such as ADS, CYP71AV1, CPR1, CYB5, ADH1, DBR2 and ALDH1 are lacked, the dihydroartemisinic acid can be produced by introducing coding genes of the key enzymes into saccharomyces cerevisiae, for example SyBE _ Sc01130085 in patent CN201610876830.X, and the method for modifying a chassis strain according to a heterologous synthesis pathway of the dihydroartemisinic acid saccharomyces cerevisiae can also refer to the prior patent CN201610876830. X;

expression of mutant ALDH1 as described in the invention^H194RThe sequence of (A) may be a sequence expressing ALDH1^H194RThe sequences of (1) may also be expression DBR2 and ALDH1^H194RThe sequence of the fusion protein of (1)Columns; the expression of mutant ALDH1^V247FThe sequence of (A) may be a sequence expressing ALDH1^V247FThe sequences of (1) may also be expression DBR2 and ALDH1^V247FThe sequence of the fusion protein of (1).

On the basis of the saccharomyces cerevisiae engineering bacteria, the expression of the original DBR2 is replaced by fusion expression of the DBR2 and the ADH1, namely the sequence of the original expression DBR2 is the sequence of the fusion protein expressing the DBR2 and the ADH1, so that the ratio of dihydroartemisinic acid to artemisinic acid can be further improved, and the yield of the dihydroartemisinic acid is not sacrificed.

Based on the technical effects, the invention provides the application of the saccharomyces cerevisiae engineering bacteria in the production of dihydroartemisinic acid or products taking dihydroartemisinic acid as an intermediate product. Meanwhile, the invention also provides ALDH1^H194RAnd coding sequence thereof or ALDH1^V247FAnd the application of the coding sequence thereof in constructing engineering bacteria of saccharomyces cerevisiae for producing dihydroartemisinic acid; and DBR2 and ALDH1^H194RThe fusion protein and the coding sequence or DBR2 and ALDH1 thereof^V247FThe fusion protein and the application of the coding sequence thereof in constructing the engineering bacteria of the saccharomyces cerevisiae for producing the dihydroartemisinic acid.

Further, the invention provides DBR2 and ALDH1^H194RThe fusion protein and the coding sequence thereof are combined with the fusion protein of DBR2 and ADH1 and the application of the coding sequence thereof in constructing engineering bacteria of saccharomyces cerevisiae for producing dihydroartemisinic acid; and DBR2 and ALDH1^V247FThe fusion protein and the coding sequence thereof are combined with the fusion protein of DBR2 and ADH1 and the application of the coding sequence thereof in constructing engineering bacteria of saccharomyces cerevisiae for producing dihydroartemisinic acid.

Meanwhile, the invention also provides a construction method of the saccharomyces cerevisiae engineering bacteria, which comprises the following steps:

step 1, using a chassis strain modified according to a dihydroartemisinic acid saccharomyces cerevisiae heterologous synthesis approach as a starting strain, and transferring at least the coding sequences of ADS, CYP71AV1, CPR1, CYB5, ADH1, DBR2 and ALDH1 into the chassis strain in a gene integration and/or plasmid introduction mode;

step 2, if the original sequence of the ALDH1 is transferred into the chassis strain in a plasmid introduction mode, the plasmid original sequence is utilizedHas two end enzyme cutting sites of the sequence expressing ALDH1, and is used for expressing mutant ALDH1^H194ROr expression of a mutated ALDH1^V247FThe original sequence of the ALDH1 is replaced by an enzyme digestion mode, and then the plasmid is transferred into a chassis strain;

if the original sequence for expressing ALDH1 is transferred into the chassis strain by a gene integration mode, synthesizing the upstream and downstream homologous arms by utilizing the upstream and downstream sequences of the original sequence for expressing ALDH1, and carrying out OE-PCR and plasmid digestion to combine the upstream and downstream homologous arms with the expression mutant ALDH1^H194ROr expression of a mutated ALDH1^V247FThe sequences of (a) are joined to obtain an upstream homology arm + expression ALDH1^H194RSequence of (1)/expression of ALDH1^V247FThe sequence + downstream homology arm of (1) is transferred into saccharomyces cerevisiae in an electrotransformation mode, and the homology arm is used for replacing the original sequence for expressing ALDH1 through a saccharomyces cerevisiae homologous recombination mechanism.

Preferably, the coding sequences of ADS, CYP71AV1 and DBR2 are transferred into the chassis strain by means of plasmid introduction, and the CPR1, CYB5, ADH1 and ALDH1 are transferred into the chassis strain by means of gene integration. In the present embodiment, the construction process of the present invention is described in detail by selecting SyBE _ Sc01130057 strain in the prior patent cn201610876830.x as the starting strain for construction, which is different from the final SyBE _ Sc01130085 strain only in whether the plasmid SyBE _ Ec01130021 (plasmid expressing ADS, CYP71AV1 and DBR 2) is introduced, and the information about SyBE _ Sc01130057 and SyBE _ Sc01130085 strains is fully presented in the prior patent.

Preferably, the construction method of the present invention further comprises:

synthesizing the sequence of fusion protein expressing DBR2 and ADH1 and replacing the original sequence expressing DBR 2. Specifically, if the sequence of the original expression DBR2 is transferred into the chassis strain in a plasmid introduction mode, the sequence of the fusion protein expressing DBR2 and ADH1 is processed by utilizing enzyme cutting sites at two ends of the sequence of the original expression DBR2 on the plasmid, the sequence of the original expression DBR2 is replaced by an enzyme cutting mode, and then the plasmid is transferred into the chassis strain;

if the sequence of the original expression DBR2 is transferred into a chassis strain in a gene integration mode, synthesizing an upper homologous arm and a lower homologous arm by utilizing an upper sequence and a lower sequence of the original expression DBR2, connecting the upper homologous arm and the lower homologous arm with the sequence of the fusion protein expressing DBR2 and ADH1 in an OE-PCR mode to obtain a sequence of the fusion protein expressing the DBR2 and the ADH1 and a segment of the lower homologous arm of the upper homologous arm, transferring the segment into saccharomyces cerevisiae in an electric conversion mode, and replacing the sequence of the original expression DBR2 by utilizing the homologous arm through a saccharomyces cerevisiae homologous recombination mechanism.

In addition, the invention also provides a method for producing dihydroartemisinic acid, and the saccharomyces cerevisiae engineering bacteria provided by the invention are used as fermentation production strains for fermentation production.

In a specific embodiment of the invention, the seed culture medium in the fermentation production is an SC solid culture medium and an SM culture medium, and the fermentation culture medium is an SM culture medium; wherein the formula of the SC solid culture medium comprises 20g/L glucose, 6.7g/L yeast nitrogen source, 10ml/L amino acid solution, 20mg/L adenine and 20g/L agar powder; the SM culture medium formula is 40g/L glucose, 8g/LKH₂PO₄，15g/L(NH₄)₂SO₄，9.25g/L MgSO₄·7H₂O, 10mL/L of metal ion solution, 12mL/L of vitamin solution and 10mL/L of amino acid solution, and the pH value is adjusted to 5.05 by NaOH;

wherein the metal ion solution contains 5.75g/L ZnSO₄·7H₂O、0.32g/L MnCl₂·4H₂O、0.47g/LCoCl₂·6H₂O、0.32g/L CuSO₄、0.48g/L Na₂MoO₄·2H₂O、2.9g/L CaCl₂·2H₂O、 2.8g/LFeSO₄·7H₂O and 80 mL/L0.5M EDTA;

the vitamin solution contains 0.05g/L biotin, 1g/L calcium pantothenate, 1g/L nicotinic acid, 25g/L inositol, 1g/L thiamine hydrochloride, 1g/L pyridoxine hydrochloride, 0.2g/L p-aminobenzoic acid, and 2g/L adenine sulfate. The amino acid solution contains 2g/L methionine, 6g/L tryptophan, 8g/L isoleucine, 5g/L phenylalanine, 10g/L glutamic acid, 20g/L threonine, 10g/L aspartic acid, 15g/L valine, 40g/L serine and 2g/L arginine.

The production steps are divided into two links of seed culture and fermentation production, wherein the seed culture comprises the following steps:

the strain was streaked out and purified on SC solid medium, and cultured at 30 ℃ for 3 days. Then, single colony was picked, inoculated into 3mLSM medium, and cultured at 30 ℃ for 16-20h, at which time OD₆₀₀A value of 5 to 8 as the initial OD₆₀₀Transfer to another tube containing 3ml of SM medium at 0.05 and incubate at 30 ℃ for 12-16 h.

Fermentation production:

culturing the seed with initial OD₆₀₀Transferring the strain to a medium containing 25ml of SM at 0.5, and culturing at 30 ℃ with a shaking table at a rotation speed of 200 r/min. 625 mul/bottle of absolute ethyl alcohol is supplemented for about 24 hours, 5ml of IPM is added for extraction and fermentation, the fermentation condition is 30 ℃ according to the old time, and the rotating speed of a shaking table is 200 r/min. The total fermentation time was 120 hours.

According to the technical scheme, the key gene ALDH1 of the dihydroartemisinic acid heterologous synthesis path is subjected to site-directed mutagenesis to obtain a gene with better selectivity, so that the metabolic path is more favorable for synthesizing dihydroartemisinic acid, and the proportion of the artemisinic acid is reduced. Two mutants, ALDH1^H194RAnd ALDH1^V247FIt has been demonstrated in the present invention that the ratio dihydroartemisinic acid/artemisinic acid can be increased. On the basis, fusion expression of the DBR2 and the ADH1 and fusion expression of the mutant ALDH1 and the DBR2 can further improve the ratio of dihydroartemisinic acid to artemisinic acid without sacrificing the yield of the dihydroartemisinic acid.

Drawings

FIG. 1 is a flow chart of the overall construction in the embodiment of the present invention;

FIG. 2 shows a schematic diagram of the construction of module hpHA;

FIG. 3 is a schematic diagram showing the introduction of module hpHA;

FIGS. 4 and 5 show the modular His3 tag (with homology arm 1, i.e.with the partial sequence upstream of the His3 tag as homology arm 1) + P_GAL7+ALDH1^V247FCoding sequence of (c) + T_TDH1The construction of (a);

FIG. 6 shows a modular His3 labelTags (containing homology arm 1, i.e., the partial sequence upstream of His3 tag as homology arm 1) + P_GAL7+ALDH1^V247FCoding sequence of (c) + T_TDH1Schematic introduction of (a);

FIGS. 7 and 8 show the modular His3 tag (with homology arm 1, i.e.with the partial sequence upstream of the His3 tag as homology arm 1) + P_GAL7+ALDH1^H194RCoding sequence of (c) + T_TDH1The construction of (a);

FIG. 9 shows the modular His3 tag (with homology arm 1, i.e., the partial sequence upstream of the His3 tag as homology arm 1) + P_GAL7+ALDH1^H194RCoding sequence of (c) + T_TDH1Schematic introduction of (a);

FIGS. 10 and 11 show the modular His3 tag (with homology arm 1, i.e.with the partial sequence upstream of the His3 tag as homology arm 1) + P_GAL7+DBR2-ALDH1^H194RCoding sequence of (c) + T_TDH1The construction of (a);

FIG. 12 shows the modular His3 tag (with homology arm 1, i.e., the partial sequence upstream of the His3 tag as homology arm 1) + P_GAL7+DBR2-ALDH1^H194RCoding sequence of (c) + T_TDH1Schematic introduction of (a);

FIG. 13 and FIG. 14 show a structure containing P_GAL7+ DBR2-ADH1 coding sequence + T_CYC1The plasmid SyBE _ Ec 01130067;

FIG. 15 shows the results of different strains of dihydroartemisinic acid vial fermentation experiments;

FIG. 16 shows the results of fermentation experiments with SyBE _ Sc01130457 fermenter to produce dihydroartemisinic acid.

Detailed Description

The invention discloses a saccharomyces cerevisiae engineering bacterium for producing dihydroartemisinic acid and a construction method and application thereof, and a person skilled in the art can realize the production by properly improving process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. The engineered saccharomyces cerevisiae strain and the construction method and application thereof have been described in the preferred embodiments, and it is obvious for related people to change or properly change and combine the engineered saccharomyces cerevisiae strain and the construction method and application thereof to realize and apply the technology of the present invention without departing from the content, spirit and scope of the invention.

In the construction method, aiming at ALDH1 and DBR2 introduced by a gene integration mode, in order to ensure that the original ALDH1 and DBR2 can be replaced, before the original sequence is replaced by a target sequence, the original sequence is replaced by a screening label 1 with a homology arm, a strain with the replaced original sequence is screened out by a culture medium corresponding to the screening label 1, and then the screening label 1 is replaced by the target sequence with the homology arm.

In order to verify that the selection tag 1 is replaced by a target sequence having a homology arm, a selection tag 2 is generally added upstream or downstream of the target sequence, and the selection tag can be selected from amino acid selection tags or resistance gene selection tags which are conventional in the art, such as His3, G418, hphMX (hygromycin B resistance gene);

the expression of the mutant ALDH1 described in the invention^H194RThe sequence of (1), expression of the mutated ALDH1^V247FThe sequences of (1), expression DBR2 and ALDH1^H194RThe fusion protein of (1), expression DBR2 and ALDH1^V247FThe sequence of the fusion protein of (2) and the sequences of the fusion proteins of expression DBR2 and ADH1 can be determined according to actual needs, and whether a promoter and a terminator are added or not can be determined. The actual requirement depends on whether the original sequence to be replaced retains the promoter and terminator and whether the promoter and/or terminator of the original sequence is used as the homology arm. In a particular embodiment of the invention, the promoter and terminator may be, for example, GAL7 promoter (P)_GAL7) TDH1 terminator (T)_TDH1) CYC1 terminator (T)_CYC1) And the like, conventional promoters and terminators in the art.

The ALDH1, DBR2 and ADH1 used in the present invention preferably use coding sequences from artemisia annua, which are already presented in the prior patent cn201610876830.x, and other coding sequences can be found in cn201610876830.x or known in the art, and those skilled in the art can optimize the relevant sequences according to the codon preference of saccharomyces cerevisiae.

For convenience of describing the technical scheme of the invention, in a specific embodiment, the invention adopts SyBE _ Sc01130057 strain in cn201610876830.x as a starting strain for construction, wherein coding sequences of CPR1, CYB5, ADH1 and ALDH1 are introduced in a gene integration manner, coding sequences of ADS, CYP71AV1 and DBR2 (plasmid SyBE _ Ec01130021) are introduced in a plasmid manner, so that a final SyBE _ Sc01130085 strain is formed;

meanwhile, the plasmid used in the present invention is not necessarily used in order to amplify a desired sequence using it as a template, and may be synthesized one by a reagent company.

In a specific embodiment of the present invention, the module hpHA of the screening tag 1 with homology arm used in the examples is homology arm 1 (partial sequence upstream of His3 tag) + hpHMX + T_TDH1(i.e., terminator and homology arm, the same below); expression of the mutated ALDH1 used^H194ROr ALDH1^V247FThe sequence of (a) is a His3 tag (containing homology arm 1, i.e. the partial sequence at the upstream of the His3 tag is used as the homology arm 1) + P_GAL7+ALDH1^H194R/ALDH1^V247FCoding sequence of (c) + T_TDH1(ii) a Expression DBR2 and ALDH1 used^H194R/ALDH1^V247FThe sequence of the fusion protein is blocked by His3 label (containing homology arm 1, i.e. the partial sequence at the upstream of His3 label is used as homology arm 1) + P_GAL7+DBR2-ALDH1^H194R/ALDH1^V247FCoding sequence of (c) + T_TDH1(ii) a The module used for expressing the sequence of the DBR2 and ADH1 fusion protein is P_GAL7+ DBR2-ADH1 coding sequence + T_CYC1(ii) a The promoter, terminator, screening tag and homology arms used in the above modules are SyBE _ Sc01130057 and SyBE _ Sc01130085 strains adapted to CN201610876830.X, and these can be adjusted according to actual situations after the original strains are changed, and are not intended to limit the present invention.

The primers and plasmids involved in the construction in the examples of the present invention are shown in tables 1 and 2 below:

TABLE 1

TABLE 2

For the purpose of visually describing the construction process of the embodiment of the present invention, the overall construction flow is shown in fig. 1 of the present invention.

The invention is further illustrated by the following examples.

Example 1: construction and introduction of the module hpHA

Amplifying a fragment H0(hpHMX coding sequence) by taking a plasmid SyBE _ Ec01130018 as a template and 17E0b-hpHA-F and 17E0b-hpHA-R as primers; amplifying Hup (taking a homology arm 1 near an upstream His3 of an original ALDH1 coding sequence as an upstream homology arm) by taking a genome of a strain SyBE _ Sc01130057 as a template and 17E0up-F and 17E0up-R as primers; hdown (T downstream of the original ALDH1 coding sequence) is amplified by using the genome of SyBE _ Sc01130057 as a template and 17E0down-F and 17E0down-R as primers_TDH1As a downstream homology arm); then, the three fragments of H0, Hup and Hdown are amplified into a module hphA by an OE-PCR method by taking 17E0up-F and 17E0down-R as primers, namely a part sequence of the upstream of the homologous arm 1(His3 label) + hphMX + T_TDH1. Introducing hphA into a strain SyBE _ Sc01130057, and performing yeast internal homologous recombination to obtain a strain SyBE _ Sc 01130352; construction scheme FIG. 2, an introduction scheme is shown in FIG. 3.

Example 2: his3 tag (containing homology arm 1, i.e. using partial sequence upstream of His3 tag as homology arm 1) + P_GAL7+ALDH1^H194R/ALDH1^V247FCoding sequence of (c) + T_TDH1Construction and import of modules of

1. His3 tag + P_GAL7+ALDH1^V247FCoding sequence of (c) + T_TDH1Construction and import of modules of

Treating the plasmid pSB1C3 with EcoRI and PstI to obtain a fragment Vector-EP; using the genome of the strain SyBE _ Sc01130057 as a template, and amplifying a segment E-His3, namely a His3 tag, by using primers 17E1-His3-FE and 18E-His3-R through PCR;

using SyBE _ Ec01130018 as template, and using 18E-pGAL7-F and 18E5cF-R to amplify fragment E-ALDcF-a, namely P_GAL7+ALDH1^V247FThe upper half of the coding sequence of (a); amplifying a fragment E-ALDcF-b, namely ALDH1, by PCR by using primers 18E5cF-F and 17E1-ALDH1-RP^V247FThe lower half of the coding sequence;

the fragment E-ALDcF-a and the fragment E-ALDcF-b are connected by OE-PCR, and are amplified by primers 18E-pGAL7-F and 17E1-ALDH1-RP to obtain the fragment E-ALDcF, namely P_GAL7+ALDH1^V247FThe coding sequence of (a);

E-His3 was treated with restriction enzymes BsaI and EcoRI to obtain fragment E-His3C, and E-ALDcF was treated with restriction enzymes BsaI and PstI to obtain fragment E-ALDcFC. E-His3C, E-ALDcFC, Vector-EP were linked by T4 ligase to construct a tag containing His3 + P_GAL7+ALDH1^V247FCoding sequence of (c) + T_TDH1The plasmid SyBE _ Ec01130198 of (1), the construction schematic diagram is shown in FIG. 4 and FIG. 5;

plasmid SyBE _ Ec01130198 was digested with restriction enzyme PmeI to release the module His3 tag + P_GAL7+ALDH1^V247FCoding sequence of (c) + T_TDH1(ii) a The module is introduced into a strain SyBE _ Sc01130352, and a strain SyBE _ Sc01130413 is obtained through yeast internal homologous recombination, the introduction schematic diagram is shown in figure 6, the strain SyBE _ Sc01130413 is introduced into a plasmid SyBE _ Ec01130021 to form a strain SyBE _ Sc01130428, and the difference of the strain from a control strain SyBE _ Sc01130085 is only that ALDH1 is used^V247FReplaces the coding sequence of ALDH 1;

wherein, His3 label + P_GAL7+ALDH1^V247FCoding sequence of (c) + T_TDH1The sequence of (a) is shown as SEQ ID NO. 1, 1-305bp is homology arm 1, 1-896bp is His3 label, 897-1623bp is P_GAL71624-3123bp is ALDH1^V247F3124 and 3614bp is T_TDH1；

2. His3 tag + P_GAL7+ALDH1^H194RCoding sequence of (c) + T_TDH1Construction and import of modules of

Treating the plasmid pSB1C3 with EcoRI and PstI to obtain a fragment Vector-EP; using the genome of the strain SyBE _ Sc01130057 as a template, and amplifying a segment E-His3, namely a His3 tag, by using primers 17E1-His3-FE and 18E-His3-R through PCR;

using SyBE _ Ec01130018 as template, and using 18E-pGAL7-F and 18E5dR-R to amplify fragment E-ALDdR-a, namely P_GAL7+ALDH1^H194RThe upper half of the coding sequence of (a); amplifying fragment E-ALDdR-b, namely ALDH1, by PCR with primers 18E5dR-F and 17E1-ALDH1-RP^H194RThe lower half of the coding sequence;

the fragment E-ALDdR-a and the fragment E-ALDdR-b are connected by OE-PCR and amplified by primers 18E-pGAL7-F and 17E1-ALDH1-RP to obtain the fragment E-ALDdR, namely P_GAL7+ALDH1^H194RThe coding sequence of (a);

E-His3 was treated with restriction enzymes BsaI and EcoRI to obtain fragment E-His3C, and E-ALDdR was treated with restriction enzymes BsaI and PstI to obtain fragment E-ALDdRC. E-His3C, E-ALDdRC and Vector-EP are connected by T4 ligase to construct a tag containing His3 and P_GAL7+ALDH1^H194RCoding sequence of (c) + T_TDH1The plasmid SyBE _ Ec01130199, the construction schematic diagram is shown in FIG. 7 and FIG. 8;

plasmid SyBE _ Ec01130199 was digested with restriction enzyme PmeI, releasing the module His3 tag + P_GAL7+ALDH1^H194RCoding sequence of (c) + T_TDH1(ii) a The module is introduced into a strain SyBE _ Sc01130352, a strain SyBE _ Sc01130414 is obtained through yeast internal homologous recombination, the introduction schematic diagram is shown in figure 9, the strain SyBE _ Sc01130414 is introduced into a plasmid SyBE _ Ec01130021 to form a strain SyBE _ Sc01130429, and the difference of the strain from a control strain SyBE _ Sc01130085 is only that ALDH1 is used^H194RReplaces the coding sequence of ALDH 1.

Wherein, ALDH1^H194RThe coding sequence of (2) is shown in SEQ ID NO 2, and the sequence of other genetic elements is referred to in example 1.

Example 3: his3 tag (containing homology arm 1, i.e. using partial sequence upstream of His3 tag as homology arm 1) + P_GAL7+DBR2-ALDH1^H194RCoding sequence of (c) + T_TDH1Construction and import of modules of

Treating the plasmid pSB1C3 with EcoRI and PstI to obtain a fragment Vector-EP; amplifying a segment E-His3, namely a His3 tag, by using a primer 17E1-His3-FE and a primer 17E1-His3-R through PCR by using the plasmid pRS423 as a template;

using SyBE _ Ec01130021 as template, the primers 17E1-pGAL7-F and 17E1z-DBR2-R are used to amplify the fragment E-DBR2, i.e. P_GAL7+ DBR2 coding sequence;

using SyBE _ Ec01130018 as template, and primers 17E1z-ALDH1-F and 18E5dR-R, fragment E-ALD-1, ALDH1 were amplified by PCR^H194RThe lower half of the coding sequence; the fragments E-ALD-2 and ALDH1 were amplified by PCR using SyBE _ Ec01130018 as template and primers 18E5dR-F and 17E1-ALDH1-RP^H194RThe upper half of the coding sequence of (a);

connecting the segment E-His3 and the segment E-DBR2 by using primers 17E-His3-FE and 17E1z-DBR2-R through OE-PCR to obtain a segment E-a, namely a homologous arm 1+ His3 tag + P_GAL7+ DBR2 coding sequence; fragment E-ALD-1 and fragment E-ALD-2 were ligated by OE-PCR and amplified with primers 17E1z-ALDH1-F and 17E1-ALDH1-RP to obtain fragment E-b, ALDH1^H194RThe coding sequence of (a);

treating the fragment E-a with BsaI and EcoRI to obtain a fragment E-aC; fragment E-b was treated with BsaI, PstI to obtain fragment E-bC. E-aC, E-bC, Vector-EP are connected by T4 ligase to obtain a plasmid SyBE _ Ec01130218, and the construction schematic diagram is shown in figure 10 and figure 11;

plasmid SyBE _ Ec01130218 digested with restriction enzyme PmeI, releasing the module His3 tag + P_GAL7+DBR2-ALDH1^H194RCoding sequence of (c) + T_TDH1(ii) a The module is introduced into a strain SyBE _ Sc01130352, and the strain SyBE _ Sc01130445 is obtained through yeast internal homologous recombination, and the introduction schematic diagram is shown in figure 12.

Wherein, the DBR2-ALDH1^H194RThe coding sequence of (2) is shown in SEQ ID NO 3, and the sequence of other genetic elements is referred to in example 1.

Example 4: p_GAL7+ DBR2-ADH1 coding sequence + T_CYC1Construction and import of modules of

The plasmid SyBE _ Ec01130021 is treated with restriction enzymes PstI and XhoI to separate a 11071bp long fragment, and the fragment p2u-PX is obtained.

Using plasmid SyBE _ Ec01130016 as a template, and obtaining a fragment u-ADH1 by PCR amplification with primers u-ADH1-R4 and u-ADH 1-F4; the fragment u-CYC1t was obtained by PCR amplification using the plasmid SyBE _ Ec01130021 as template and the primers u-CYC1t-F and u-CYC1 t-R. The fragment u-DBR2 was obtained by PCR amplification using the plasmid SyBE _ Ec01130021 as template and the primers u-pGAL7-F and u-DBR-R4. The u-ADH1, u-DBR2 and u-CYC1t fragments were ligated by OE-PCR, amplified with primers u-pGAL7-F and u-CYC1t-R to obtain u-DA fragments, and the construction scheme is as shown in FIG. 13.

Treating the fragment u-DA with restriction enzymes PstI and XhoI to obtain a fragment u-DA-PX, and connecting the u-DA-PX with the fragment p2u-PX through T4 ligase to construct a plasmid SyBE _ Ec01130067, wherein the construction schematic diagram is shown in figure 14, and the difference from the plasmid SyBE _ Ec01130021 is only that the DBR2 coding sequence is replaced by a DBR2-ADH1 coding sequence.

The plasmid SyBE _ Ec01130067 was introduced into the strain SyBE _ Sc01130445, obtaining the strain SyBE _ Sc01130457, which differs from the control strain SyBE _ Sc01130085 only by the use of the DBR2-ALDH1^H194RThe coding sequence of ALDH1 is replaced by the coding sequence of DBR2-ADH1, and the coding sequence of DBR2 is replaced by the coding sequence of DBR2-ADH 1.

Wherein, P_GAL7+ DBR2-ADH1 coding sequence + T_CYC1The sequence of (A) is shown as SEQ ID NO. 4, and 1-727bp is P_GAL7728-3064bp DBR2-ADH1 coding sequence, 3065-3565bp T_CYC1。

Example 5: dihydroartemisinic acid shake flask fermentation contrast test

In order to characterize the excellent characteristics of the strains, the present embodiment compares the strains SyBE _ Sc01130457, SyBE _ Sc01130428 and SyBE _ Sc01130429 modified from the previous embodiments with the dihydroartemisinic acid-producing strain SyBE _ Sc01130085 which has not been subjected to the path optimization through the shake flask fermentation test, and compares the yield of the dihydroartemisinic acid and the ratio of the dihydroartemisinic acid/artemisinic acid.

(1) Preparation of culture medium

All media used in the fermentation test were SM media, and the formula was as follows:

40g/L glucose, 8g/L KH₂PO₄，15g/L(NH₄)₂SO₄，9.25g/L MgSO₄·7H₂O, 10mL/L of metal ion solution, 12mL/L of vitamin solution and 10mL/L of amino acid solution, and the pH value is adjusted to 5.05 by NaOH;

wherein the metal ion solution contains 5.75g/L ZnSO₄·7H₂O、0.32g/L MnCl₂·4H₂O、0.47g/LCoCl₂·6H₂O、0.32g/L CuSO₄、0.48g/L Na₂MoO₄·2H₂O、2.9g/L CaCl₂·2H₂O、 2.8g/LFeSO₄·7H₂O and 80 mL/L0.5M EDTA;

the vitamin solution contains 0.05g/L biotin, 1g/L calcium pantothenate, 1g/L nicotinic acid, 25g/L inositol, 1g/L thiamine hydrochloride, 1g/L pyridoxine hydrochloride, 0.2g/L p-aminobenzoic acid, and 2g/L adenine sulfate. The amino acid solution contains 2g/L methionine, 6g/L tryptophan, 8g/L isoleucine, 5g/L phenylalanine, 10g/L glutamic acid, 20g/L threonine, 10g/L aspartic acid, 15g/L valine, 40g/L serine and 2g/L arginine.

(2) Seed culture

Strains SyBE _ Sc01130085 and SyBE _ Sc01130457 were streaked and purified on SC solid medium (20g/L glucose, 6.7g/L yeast nitrogen source, 10ml/L amino acid solution, 20mg/L adenine, 20g/L agar powder), and incubated at 30 ℃ for 3 days. Then, single colony was picked, inoculated into 3mLSM medium, and cultured at 30 ℃ for 16-20h, at which time OD₆₀₀A value of 5 to 8 as the initial OD₆₀₀Transfer to another tube containing 3ml of SM medium at 0.05 and incubate at 30 ℃ for 12-16 h.

(3) Shake flask fermentation process

The culture of the previous step was cultured at an initial OD6₀₀Transferring the strain to a medium containing 25ml of SM at 0.5, and culturing at 30 ℃ with a shaking table at a rotation speed of 200 r/min. 625 mul/bottle of absolute ethyl alcohol is supplemented for about 24 hours, 5ml of IPM is added for extraction and fermentation, the fermentation condition is 30 ℃ according to the old time, and the rotating speed of a shaking table is 200 r/min. The total fermentation time was 120 hours.

(4) Product extraction and determination

Taking a sample from the shake flask, centrifuging at 12000r/min, separating an upper IPM organic phase, dissolving and diluting by 20 times by using methanol, and performing ultraviolet-high performance liquid chromatography for product determination. The high performance liquid chromatography instrument method is as follows: the chromatographic column is a ThermoC18 high performance liquid chromatographic column (4.6mm multiplied by 150mm multiplied by 5 mu m), and the column temperature is 25 ℃; the sample introduction was 10 μ L, the total flow rate was 1mL/min, mobile phase A was acetonitrile + 0.1% formic acid, mobile phase B was 65% acetonitrile + 0.1% formic acid in water, the gradient procedure was as follows: maintaining 0% A and 100% B for 0-3 min; uniformly increasing A from 0% to 100% in 3-10 min; maintaining 100% A for 10-13 min; the phase 13min-15minA is uniformly reduced from 100% to 0%, and is maintained at 0% A and 100% B for 20 min.

(5) Results

As can be seen from FIG. 15, where SyBE _ Sc01130085 is a control strain, it can produce 327mg/L dihydroartemisinic acid, 129mg/L artemisinic acid, and the ratio of dihydroartemisinic acid/artemisinic acid is 2.53; mutant ALDH1 optimized the dihydroartemisinic acid/artemisinic acid ratio, SyBE _ Sc01130429 (with mutant ALDH 1)^H194R) Can produce 326mg/L dihydroartemisinic acid and 87.3mg/L artemisinic acid, and the proportion is increased to 3.73; SyBE _ Sc01130429 (mutant-containing ALDH 1)^V247F) The ratio can be greatly increased to 29, almost no arteannuic acid is produced, but the yield of dihydroarteannuic acid is reduced to 213 mg/L; strain SyBE _ Sc01130457 (ALDH 1)^H194RFusion expression with the DBR2 matched with fusion expression of the DBR2 and the ADH 1) can produce 311mg/L of dihydroartemisinic acid, 31mg/L of artemisinic acid, and the ratio of the dihydroartemisinic acid to the artemisinic acid is 10.1 which is about 4 times of that of a control strain, and the yield of the dihydroartemisinic acid is not excessively lost.

Example 6: fermentation test of dihydroartemisinic acid fermentation tank

The constructed strain SyBE _ Sc011300457 is streaked on a Sc solid culture medium (20g/L glucose, 6.7g/L yeast nitrogen source, 10ml/L amino acid solution and 20g/L agar powder) and cultured for 3 days at 30 ℃. Then, single colonies were picked, inoculated into 3mL seed medium, cultured at 30 ℃ for 16-24h, and when OD600 reached 5, 1.2mL of the culture was aliquoted and transferred into 4 bottles of 50mL seed medium with an initial OD600 of about 0.05, and cultured at 30 ℃ for 24h for fermenter inoculation. The seed culture medium comprises the following components:20g/L glucose, 8g/L KH₂PO₄，15g/L(NH₄)₂SO₄，9.25g/L MgSO₄·7H₂O, 10mL/L of metal ion solution, 12mL/L of vitamin solution and 10mL/L of amino acid solution. Wherein the metal ion solution contains 5.57g/L ZnSO₄·7H₂O，0.32g/L MnCl₂·4H₂O，0.47g/L CoCl₂·6H₂O，0.32g/L CuSO₄，0.48g/L Na₂MoO₄·2H₂O，2.9g/L CaCl₂·2H₂O，2.8g/L FeSO₄·7H₂O and 80 mL/L0.5M EDTA, pH 8; the vitamin solution contains 0.05g/L biotin, 1g/L calcium pantothenate, 1g/L nicotinic acid, 25g/L inositol, 1g/L thiamine hydrochloride, 1g/L pyridoxine hydrochloride, 0.2g/L p-aminobenzoic acid, and 2g/L adenine sulfate. The amino acid solution contains 2g/L methionine, 6g/L tryptophan, 8g/L isoleucine, 5g/L phenylalanine, 10g/L glutamic acid, 20g/L threonine, 10g/L aspartic acid, 15g/L valine, 40g/L serine and 2g/L arginine.

Mixing 16g KH₂PO₄，30g(NH₄)₂SO₄，12.5g MgSO₄·7H₂O was dissolved in 1596mL of distilled water and added to the fermentor and autoclaved at 121 ℃ for 20 minutes. Then 60mL of autoclaved 715g/L glucose hydrate, 20mL of filter-sterilized metal ion solution, 24mL of vitamin solution, 20mL of amino acid solution, and 400mL of extractant IPM (isopropyl myristate) were added to the fermentor. Finally, 200mL of seed culture was added and fermentation was started with a total fermentation volume of 2L and an initial OD600 of about 0.7.

The fermentation temperature is controlled at 30 ℃, the pH is controlled at 5.05, wherein 5M NaOH is used for controlling the pH, the aeration is 1.5vvm, the dissolved oxygen is associated with stirring, the dissolved oxygen is controlled at 40%, the stirring speed is 300rpm at the lowest, and 700rpm at the highest. Feeding in a fed-batch manner is started when the glucose is exhausted, 357g/L of hydrated glucose is fed at first, the glucose feeding is stopped after the OD600 reaches 50 (about 36 h), 95% of ethanol is fed when the ethanol is exhausted, the glucose concentration in the culture medium is controlled to be 0 in the whole feeding process, and the ethanol concentration is controlled to be less than 20g/L after the ethanol feeding is started. Every 24h based on the total of glucose and ethanol supplementedThe volume of the mixture was added 1/10 supplemented with saline solution (80g/L KH)₂PO₄，61.5g/L MgSO₄·7H₂O，35g/L K₂SO₄100mL/L of metal ion solution and 120mL/L of vitamin solution) and the fermentation lasts for 150 hours.

The fermentation result is shown in figure 16, the highest yield of dihydroartemisinic acid (DHAA) can reach 1.74g/L, only 175mg/L of artemisinic acid is produced, and the proportion of the dihydroartemisinic acid and the dihydroartemisinic acid is also obviously improved.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Tianjin university

<120> engineering bacterium of saccharomyces cerevisiae for producing dihydroartemisinic acid, construction method and application thereof

<130>MP1915822

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>3614

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atgacagagc agaaagccct agtaaagcgt attacaaatg aaaccaagat tcagattgcg 60

atctctttaa agggtggtcc cctagcgata gagcactcga tcttcccaga aaaagaggca 120

gaagcagtag cagaacaggc cacacaatcg caagtgatta acgtccacac aggtataggg 180

tttctggacc atatgataca tgctctggcc aagcattccg gctggtcgct aatcgttgag 240

tgcattggtg acttacacat agacgaccat cacaccactg aagactgcgg gattgctctc 300

ggtcaagctt ttaaagaggc cctaggggcc gtgcgtggag taaaaaggtt tggatcagga 360

tttgcgcctt tggatgaggc actttccaga gcggtggtag atctttcgaa caggccgtac 420

gcagttgtcg aacttggttt gcaaagggag aaagtaggag atctctcttg cgagatgatc 480

ccgcattttc ttgaaagctt tgcagaggct agcagaatta ccctccacgt tgattgtctg 540

cgaggcaaga atgatcatca ccgtagtgag agtgcgttca aggctcttgc ggttgccata 600

agagaagcca cctcgcccaa tggtaccaac gatgttccct ccaccaaagg tgttcttatg 660

tagtgacacc gattatttaa agctgcagca tacgatatat atacatgtgt atatatgtat 720

acctatgaat gtcagtaagt atgtatacga acagtatgat actgaagatg acaaggtaat 780

gcatcattct atacgtgtca ttctgaacga ggcgcgcttt ccttttttct ttttgctttt 840

tctttttttt tctcttgaac tcgacggatc tatgcggtgt gaaataccgc ctcgaggatt 900

tgccagctta ctatccttct tgaaaatatg cactctatat cttttagttc ttaattgcaa 960

cacatagatt tgctgtataa cgaattttat gctatttttt aaatttggag ttcagtgata 1020

aaagtgtcac agcgaatttc ctcacatgta gggaccgaat tgtttacaag ttctctgtac 1080

caccatggag acatcaaaga ttgaaaatct atggaaagat atggacggta gcaacaagaa 1140

tatagcacga gccgcgaagt tcatttcgtt acttttgata tcgctcacaa ctattgcgaa 1200

gcgcttcagt gaaaaaatca taaggaaaag ttgtaaatat tattggtagt attcgtttgg 1260

taaagtagag ggggtaattt ttccccttta ttttgttcat acattcttaa attgctttgc 1320

ctctcctttt ggaaagctat acttcggagc actgttgagc gaaggctcat tagatatatt 1380

ttctgtcatt ttccttaacc caaaaataag ggaaagggtc caaaaagcgc tcggacaact 1440

gttgaccgtg atccgaagga ctggctatac agtgttcaca aaatagccaa gctgaaaata 1500

atgtgtagct atgttcagtt agtttggcta gcaaagatat aaaagcaggt cggaaatatt 1560

tatgggcatt attatgcaga gcatcaacat gataaaaaaa aacagttgaa tattccctca 1620

aaaatgtctt ctggtgctaa cggttcttct aagtctgctt ctcacaagat caagttcact 1680

aagttgttca tcaacggtga attcgttgac tctatctctg gtaacacttt cgacactatc 1740

aacccagcta ctgaagaagt tttggctact gttgctgaag gtagaaagga agacatcgac 1800

ttggctgtta aggctgctag agaagctttc gacaacggtc catggccaag aatgtctggt 1860

gaagctagaa gaaagatcat gttgaagttc gctgacttga tcgacgaaaa cgctgacgaa 1920

ttgactactt tggaagttat cgacggtggt aagttgttcg gtccagttag acacttcgaa 1980

gttccagttt cttctgacac tttcagatac ttcgctggtg ctgctgacaa gatcagaggt 2040

gctactttga agatgtcttc taacatccaa gcttacactt tgagagaacc aatcggtgtt 2100

gttggtcaca tcatcccatg gaacggtcca gctttcatgt tcgctactaa ggttgctcca 2160

gctttggctg ctggttgtac tatggttatc aagccagctg aacacactcc attgactgtt 2220

ttgttcttgg ctcacttgtc taagttggct ggtgttccag acggtgttat caacgttgtt 2280

aacggtttcg gtaagactgc tggtgctgct gtttcttctc acatggacat cgacatggtt 2340

actttcactg gttctactga atttggtaga actgttatgc aagctgctgc tttgtctaac 2400

ttgaagccag tttctttgga attgggtggt aagtctccat tgatcgtttt cgacgacgct 2460

gacgttgaca aggctgctga attcgctatc ttgggtaact tcactaacaa gggtgaaatg 2520

tgtgttgctg gttctagagt tttcgttcaa gaaggtatcc acgacgtttt cgttaagaag 2580

ttggaaggtg ctgttaaggc ttgggctact agagacccat tcgacttggc tactagacac 2640

ggtccacaaa acaacaagca acaatacgac aaggttttgt cttgtatcaa ccacggtaag 2700

aaggaaggtg ctactttggt tactggtggt aagccattcg gtaagaaggg ttactacatc 2760

gaaccaactt tgttcactaa cgttactgac gacatgacta tcgctaagga agaaatcttc 2820

ggtccagtta tctctgtttt gaagttcaag actgttgaag aagttatcaa gagagctaac 2880

gctactaagt acggtttggc ttctggtgtt ttcactaaga acatcgacgt tgttaacact 2940

gtttctagat ctttgagagc tggtgctgtt tgggttaact gttacttggc tttggacaga 3000

gacgctccac acggtggtta caatatgtct ggtttcggta gagaacaagg tttggaagct 3060

ttggaacact acttgcaaat caagactgtt gctactccaa tctacgactc tccatggttg 3120

taaataaagc aatcttgatg aggataatga tttttttttg aatatacata aatactaccg 3180

tttttctgct agattttgtg aagacgtaaa taagtacata ttacttttta agccaagaca 3240

agattaagca ttaactttac ccttttctct tctaagtttc aatactagtt atcactgttt 3300

aaaagttatg gcgagaacgt cggcggttaa aatatattac cctgaacgtg gtgaattgaa 3360

gttctaggat ggtttaaaga tttttccttt ttgggaaata agtaaacaat atattgctgc 3420

ctttgcaaaa cgcacatacc cacaatatgt gactattggc aaagaacgca ttatcctttg 3480

aagaggtgga tactgatact aagagagtct ctattccggc tccactttta gtccagagat 3540

tacttgtctt cttacgtatc agaacaagaa agcatttcca aagtaattgc atttgccctt 3600

gagcagtata tata 3614

<210>2

<211>1500

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

atgtcttctg gtgctaacgg ttcttctaag tctgcttatc acaagatcaa gttcactaag 60

ttgttcatca acggtgaatt cgttgactct atctctggta acactttcga cactatcaac 120

ccagctactg aagaagtttt ggctactgtt gctgaaggta gaaaggaaga catcgacttg 180

gctgttaagg ctgctagaga agctttcgac aacggtccat ggccaagaat gtctggtgaa 240

gctagaagaa agatcatgtt gaagttcgct gacttgatcg acgaaaacgc tgacgaattg 300

actactttgg aagttatcga cggtggtaag ttgttcggtc cagttagaca cttcgaagtt 360

ccagtttctt ctgacacttt cagatacttcgctggtgctg ctgacaagat cagaggtgct 420

actttgaaga tgtcttctaa catccaagct tacactttga gagaaccaat cggtgttgtt 480

ggtcacatca tcccatggaa cggtccagct ttcatgttcg ctactaaggt tgctccagct 540

ttggctgctg gttgtactat ggttatcaag ccagctgaaa gaactccatt gactgttttg 600

ttcttggctc acttgtctaa gttggctggt gttccagacg gtgttatcaa cgttgttaac 660

ggtttcggta agactgctgg tgctgctgtt tcttctcaca tggacatcga catggttact 720

ttcactggtt ctactgaagt tggtagaact gttatgcaag ctgctgcttt gtctaacttg 780

aagccagttt ctttggaatt gggtggtaag tctccattga tcgttttcga cgacgctgac 840

gttgacaagg ctgctgaatt cgctatcttg ggtaacttca ctaacaaggg tgaaatgtgt 900

gttgctggtt ctagagtttt cgttcaagaa ggtatccacg acgttttcgt taagaagttg 960

gaaggtgctg ttaaggcttg ggctactaga gacccattcg acttggctac tagacacggt 1020

ccacaaaaca acaagcaaca atacgacaag gttttgtctt gtatcaacca cggtaagaag 1080

gaaggtgcta ctttggttac tggtggtaag ccattcggta agaagggtta ctacatcgaa 1140

ccaactttgt tcactaacgt tactgacgac atgactatcg ctaaggaaga aatcttcggt 1200

ccagttatct ctgttttgaa gttcaagact gttgaagaag ttatcaagag agctaacgct 1260

actaagtacg gtttggcttc tggtgttttc actaagaaca tcgacgttgt taacactgtt 1320

tctagatctt tgagagctgg tgctgtttgg gttaactgtt acttggcttt ggacagagac 1380

gctccacacg gtggttacaa gatgtctggt ttcggtagag aacaaggttt ggaagctttg 1440

gaacactact tgcaaatcaa gactgttgct actccaatct acgactctcc atggttgtaa 1500

<210>3

<211>2700

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atgtctgaaa agccaacctt gttctctgct tacaagatgg gtaacttcaa cttgtctcac 60

agagttgttt tggctccaat gaccagatgt agagctatca acgctatccc aaacgaagct 120

ttggttgaat actacagaca aagatctacc gctggtggtt tcttgatcac cgaaggtacc 180

atgatctctc catcttctgc tggtttccca cacgttccag gtatcttcac caaggaacaa 240

gttgaaggtt ggaagaaggt tgttgacgct gctcacaagg aaggtgctgt tatcttctgt 300

caattgtggc acgttggtag agcttctcac aaggtttacc aaccaggtgg tgctgctcca 360

atctcttcta cctctaagcc aatctctaag aagtgggaaa tcttgttgcc agacgctacc 420

tacggtacct acccagaacc aagaccattg gctgctaacg aaatcttgga agttgttgaa 480

gactacagag ttgctgctat caacgctatc gaagctggtt tcgacggtat cgaaatccac 540

ggtgctcacg gttacttgtt ggaccaattc atgaaggacg gtatcaacga cagaaccgac 600

gaatacggtg gttctttgga aaacagatgt aagttcatct tgcaagttgt tcaagctgtt 660

tctgctgcta tcggtaccga cagagttggt atcagaatct ctccagctat cgaccacacc 720

gacgctatgg actctgaccc aagatctttg ggtttggctg ttatcgaaag attgaacaag 780

ttgcaattca agttgggttc tagattggct tacttgcacg ttacccaacc aagatacacc 840

gctgacggtc acggtcaaac cgaagctggt gctaacggtt ctgaccacga agaagaagtt 900

gctcaattga tgaagacctg gagaggtgct tacgttggta ccttcatctg ttgtggtggt 960

tacaccagag aattgggttt gcaagctgtt gctcaaggtg acgctgactt ggttgctttc 1020

ggtagatact tcatctctaa cccagacttg gttttgagat tgaagttgaa cgctccattg 1080

aacagatacg acagagctac cttctacacc cacgacccag ttgttggtta caccgactac 1140

ccatctttgg accaaggttc tttgttggca gaagccgctg caaaagaagc ggctgctaaa 1200

gcttcttctg gtgctaacgg ttcttctaag tctgcttctc acaagatcaa gttcactaag 1260

ttgttcatca acggtgaatt cgttgactct atctctggta acactttcga cactatcaac 1320

ccagctactg aagaagtttt ggctactgtt gctgaaggta gaaaggaaga catcgacttg 1380

gctgttaagg ctgctagaga agctttcgac aacggtccat ggccaagaat gtctggtgaa 1440

gctagaagaa agatcatgtt gaagttcgct gacttgatcg acgaaaacgc tgacgaattg 1500

actactttgg aagttatcga cggtggtaag ttgttcggtc cagttagaca cttcgaagtt 1560

ccagtttctt ctgacacttt cagatacttc gctggtgctg ctgacaagat cagaggtgct 1620

actttgaaga tgtcttctaa catccaagct tacactttga gagaaccaat cggtgttgtt 1680

ggtcacatca tcccatggaa cggtccagct ttcatgttcg ctactaaggt tgctccagct 1740

ttggctgctg gttgtactat ggttatcaag ccagctgaaa gaactccatt gactgttttg 1800

ttcttggctc acttgtctaa gttggctggt gttccagacg gtgttatcaa cgttgttaac 1860

ggtttcggta agactgctgg tgctgctgtt tcttctcaca tggacatcga catggttact 1920

ttcactggtt ctactgaagt tggtagaact gttatgcaag ctgctgcttt gtctaacttg 1980

aagccagtttctttggaatt gggtggtaag tctccattga tcgttttcga cgacgctgac 2040

gttgacaagg ctgctgaatt cgctatcttg ggtaacttca ctaacaaggg tgaaatgtgt 2100

gttgctggtt ctagagtttt cgttcaagaa ggtatccacg acgttttcgt taagaagttg 2160

gaaggtgctg ttaaggcttg ggctactaga gacccattcg acttggctac tagacacggt 2220

ccacaaaaca acaagcaaca atacgacaag gttttgtctt gtatcaacca cggtaagaag 2280

gaaggtgcta ctttggttac tggtggtaag ccattcggta agaagggtta ctacatcgaa 2340

ccaactttgt tcactaacgt tactgacgac atgactatcg ctaaggaaga aatcttcggt 2400

ccagttatct ctgttttgaa gttcaagact gttgaagaag ttatcaagag agctaacgct 2460

actaagtacg gtttggcttc tggtgttttc actaagaaca tcgacgttgt taacactgtt 2520

tctagatctt tgagagctgg tgctgtttgg gttaactgtt acttggcttt ggacagagac 2580

gctccacacg gtggttacaa gatgtctggt ttcggtagag aacaaggttt ggaagctttg 2640

gaacactact tgcaaatcaa gactgttgct actccaatct acgactctcc atggttgtaa 2700

<210>4

<211>3565

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gatttgccag cttactatcc ttcttgaaaa tatgcactct atatctttta gttcttaatt 60

gcaacacata gatttgctgt ataacgaatt ttatgctatt ttttaaattt ggagttcagt 120

gataaaagtg tcacagcgaa tttcctcaca tgtagggacc gaattgttta caagttctct 180

gtaccaccat ggagacatca aagattgaaa atctatggaa agatatggac ggtagcaaca 240

agaatatagc acgagccgcg aagttcattt cgttactttt gatatcgctc acaactattg 300

cgaagcgctt cagtgaaaaa atcataagga aaagttgtaa atattattgg tagtattcgt 360

ttggtaaagt agagggggta atttttcccc tttattttgt tcatacattc ttaaattgct 420

ttgcctctcc ttttggaaag ctatacttcg gagcactgtt gagcgaaggc tcattagata 480

tattttctgt cattttcctt aacccaaaaa taagggaaag ggtccaaaaa gcgctcggac 540

aactgttgac cgtgatccga aggactggct atacagtgtt cacaaaatag ccaagctgaa 600

aataatgtgt agctatgttc agttagtttg gctagcaaag atataaaagc aggtcggaaa 660

tatttatggg cattattatg cagagcatca acatgataaa aaaaaacagt tgaatattcc 720

ctcaaaaatg tctgaaaagc caaccttgtt ctctgcttac aagatgggta acttcaactt 780

gtctcacaga gttgttttgg ctccaatgac cagatgtaga gctatcaacg ctatcccaaa 840

cgaagctttg gttgaatact acagacaaag atctaccgct ggtggtttct tgatcaccga 900

aggtaccatg atctctccat cttctgctgg tttcccacac gttccaggta tcttcaccaa 960

ggaacaagtt gaaggttgga agaaggttgt tgacgctgct cacaaggaag gtgctgttat 1020

cttctgtcaa ttgtggcacg ttggtagagc ttctcacaag gtttaccaac caggtggtgc 1080

tgctccaatc tcttctacct ctaagccaat ctctaagaag tgggaaatct tgttgccaga 1140

cgctacctac ggtacctacc cagaaccaag accattggct gctaacgaaa tcttggaagt 1200

tgttgaagac tacagagttg ctgctatcaa cgctatcgaa gctggtttcg acggtatcga 1260

aatccacggt gctcacggtt acttgttgga ccaattcatg aaggacggta tcaacgacag 1320

aaccgacgaa tacggtggtt ctttggaaaa cagatgtaag ttcatcttgc aagttgttca 1380

agctgtttct gctgctatcg gtaccgacag agttggtatc agaatctctc cagctatcga 1440

ccacaccgac gctatggact ctgacccaag atctttgggt ttggctgtta tcgaaagatt 1500

gaacaagttg caattcaagt tgggttctag attggcttac ttgcacgtta cccaaccaag 1560

atacaccgct gacggtcacg gtcaaaccga agctggtgct aacggttctg accacgaaga 1620

agaagttgct caattgatga agacctggag aggtgcttac gttggtacct tcatctgttg 1680

tggtggttac accagagaat tgggtttgca agctgttgct caaggtgacg ctgacttggt 1740

tgctttcggt agatacttca tctctaaccc agacttggtt ttgagattga agttgaacgc 1800

tccattgaac agatacgaca gagctacctt ctacacccac gacccagttg ttggttacac 1860

cgactaccca tctttggacc aaggttcttt gttggcagaa gccgctgcaa aagaagcggc 1920

tgctaaagct gctcaaaagg ctccaggtgt tatcacttgt aaggctgctg ttgtttggga 1980

atcttctggt ccagttgttt tggaagaaat cagagttgac ccaccaaagg cttctgaagt 2040

tagaatcaag atgttgtgtg cttctttgtg tcacactgac gttttgtgta ctaagggttt 2100

cccaatccca ttgttcccaa gaatcccagg tcacgaaggt gttggtgtta tcgaatctat 2160

cggtaaggac gctaagggtt tgaagccagg tgacatcgtt atgccattgt acttgggtga 2220

atgtggtcaa tgtttgaact gtaagactgg taagactaac ttgtgtcacg tttacccacc 2280

atctttctct ggtttgatga acgacggtac ttctagaatg tctatcgcta gaactggtga 2340

atctatctac cacttcgctt cttgttctac ttggactgaa tacgctgttg ctgactgtaa 2400

ctacgttttg aagatcaacc caaagatctc ttacccacac gcttctttct tgtcttgtgg 2460

tttcactact ggtttcggtg ctacttggag agaaactcaa gtttctaagg gttcttctgt 2520

tgctgttttc ggtatcggta ctgttggttt gggtgttatc aagggtgctc aattgcaagg 2580

tgcttctaag atcatcggtg ttgacgttaa ccaatacaag gctgctaagg gtaaggtttt 2640

cggtatgact gacttcatca acccaaagga ccacccagac aagtctgttt ctgaattggt 2700

taaggaattg actcacggtt tgggtgttga ccactgtttc gaatgtactg gtgttccatc 2760

tttgttgaac gaagctttgg aagcttctaa gatcggtatc ggtactgttg ttccaatcgg 2820

tgctggtggt gaagcttctg ttgctatcaa ctctttgatc ttgttctctg gtagaacttt 2880

gaagttcact gctttcggtg gtgttagaac tcaatctgac ttgccagtta tcatcgacaa 2940

gtgtttgaac aaggaaatcc aattggacga attgttgact cacgaaatcc acttggacaa 3000

catccaagaa gctttcgaaa tcttgaagaa gccagactgt gttaagatct tgatcaagtt 3060

ctaaacaggc cccttttcct ttgtcgatat catgtaatta gttatgtcac gcttacattc 3120

acgccctccc cccacatccg ctctaaccga aaaggaagga gttagacaac ctgaagtcta 3180

ggtccctatt tattttttta tagttatgtt agtattaaga acgttattta tatttcaaat 3240

ttttcttttt tttctgtaca aacgcgtgta cgcatgtaac attatactga aaaccttgct 3300

tgagaaggtt ttgggacgct cgaaggcttt aatttgcaag cttcgcagtt tacactctca 3360

tcgtcgctct catcatcgct tccgttgttg ttttccttag tagcgtctgc ttccagagag 3420

tatttatctc ttattacctc taaaggttct gcttgatttc tgactttgtt cgcctcatgt 3480

gcatattttt cttggttctt ttgggacaaa atatgcgtaa aggacttttg ttgttccctc 3540

acattccagt ttagttgtcg acctg 3565

Claims (13)

1. A saccharomyces cerevisiae engineering bacterium for producing dihydroartemisinic acid is characterized in that the engineering bacterium is modified by a dihydroartemisinic acid saccharomyces cerevisiae heterologous synthesis wayThe original sequence for expressing ALDH1 of Saccharomyces cerevisiae chassis strain is ALDH1 with mutation expression^H194ROr expression of a mutated ALDH1^V247FThe sequence of (a).

2. The saccharomyces cerevisiae engineering strain of claim 1, wherein the saccharomyces cerevisiae chassis strain is commercially available saccharomyces cerevisiae of the cen. pk2 system.

3. The engineered Saccharomyces cerevisiae of claim 1, wherein the expression of the mutated ALDH1 is performed^H194RThe sequence of (A) is to express ALDH1^H194RThe sequences of (1) or expression DBR2 and ALDH1^H194RThe sequence of the fusion protein of (1).

4. The engineered Saccharomyces cerevisiae of claim 1, wherein the expression of the mutated ALDH1 is performed^V247FThe sequence of (A) is to express ALDH1^V247FThe sequences of (1) or expression DBR2 and ALDH1^V247FThe sequence of the fusion protein of (1).

5. The engineered saccharomyces cerevisiae strain of any one of claims 1-4, further comprising a sequence originally expressing DBR2 as a fusion protein expressing DBR2 and ADH 1.

6. Use of the engineered saccharomyces cerevisiae strain of any one of claims 1-5 in the production of dihydroartemisinic acid or products with dihydroartemisinic acid as an intermediate.

7.ALDH1^H194RAnd coding sequence thereof or ALDH1^V247FAnd the application of the coding sequence in constructing engineering bacteria of saccharomyces cerevisiae for producing dihydroartemisinic acid.

DBR2 and ALDH1^H194RThe fusion protein and the coding sequence or DBR2 and ALDH1 thereof^V247FThe fusion protein and the application of the coding sequence thereof in constructing the engineering bacteria of the saccharomyces cerevisiae for producing the dihydroartemisinic acid.

9. The construction method of the saccharomyces cerevisiae engineering bacteria as claimed in claim 1, which is characterized by comprising the following steps:

step 1, using a chassis strain modified according to a dihydroartemisinic acid saccharomyces cerevisiae heterologous synthesis approach as a starting strain, and transferring at least the coding sequences of ADS, CYP71AV1, CPR1, CYB5, ADH1, DBR2 and ALDH1 into the chassis strain in a gene integration and/or plasmid introduction mode;

step 2, if the original sequence of the ALDH1 is transferred into a chassis strain in a mode of plasmid introduction, enzyme cutting sites at two ends of the original sequence of the ALDH1 on the plasmid are used for expressing the mutated ALDH1^H194ROr expression of a mutated ALDH1^V247FThe original sequence of the ALDH1 is replaced by an enzyme digestion mode, and then the plasmid is transferred into a chassis strain;

if the original sequence for expressing ALDH1 is transferred into the chassis strain by a gene integration mode, synthesizing the upstream and downstream homologous arms by utilizing the upstream and downstream sequences of the original sequence for expressing ALDH1, and carrying out OE-PCR and plasmid digestion to combine the upstream and downstream homologous arms with the expression mutant ALDH1^H194ROr expression of a mutated ALDH1^V247FThe sequences of (a) are joined to obtain an upstream homology arm + expression ALDH1^H194RSequence of (1)/expression of ALDH1^V247FThe sequence + downstream homology arm of (1) is transferred into saccharomyces cerevisiae in an electrotransformation mode, and the homology arm is used for replacing the original sequence for expressing ALDH1 through a saccharomyces cerevisiae homologous recombination mechanism.

10. The construction method according to claim 9, wherein the coding sequences of ADS, CYP71AV1 and DBR2 are transferred into the chassis strain by means of plasmid introduction, and the CPR1, CYB5, ADH1 and ALDH1 are transferred into the chassis strain by means of gene integration.

11. The construction method according to claim 9 or 10, further comprising:

synthesizing the sequence of fusion protein expressing DBR2 and ADH1 and replacing the original sequence expressing DBR 2.

12. The construction method according to claim 11, wherein if the original sequence of the expression DBR2 is transferred into the chassis strain by means of plasmid introduction, the sequence of the fusion protein expressing DBR2 and ADH1 is processed by using enzyme cutting sites at both ends of the original sequence of the expression DBR2 on the plasmid, the original sequence of the expression DBR2 is replaced by enzyme cutting, and then the plasmid is transferred into the chassis strain;

if the sequence of the original expression DBR2 is transferred into a chassis strain in a gene integration mode, synthesizing an upper homologous arm and a lower homologous arm by utilizing an upper sequence and a lower sequence of the original expression DBR2, connecting the upper homologous arm and the lower homologous arm with the sequence of the fusion protein expressing DBR2 and ADH1 in an OE-PCR mode to obtain a sequence of the fusion protein expressing the DBR2 and the ADH1 and a segment of the lower homologous arm of the upper homologous arm, transferring the segment into saccharomyces cerevisiae in an electric conversion mode, and replacing the sequence of the original expression DBR2 by utilizing the homologous arm through a saccharomyces cerevisiae homologous recombination mechanism.

13. A method for producing dihydroartemisinic acid, which is characterized by adopting the saccharomyces cerevisiae engineering bacteria of any one of claims 1-5 for fermentation production.

Images