CN111057789A - Method for synchronously detecting PnVY and TYLCCNV - Google Patents
Method for synchronously detecting PnVY and TYLCCNV Download PDFInfo
- Publication number
- CN111057789A CN111057789A CN201911262660.6A CN201911262660A CN111057789A CN 111057789 A CN111057789 A CN 111057789A CN 201911262660 A CN201911262660 A CN 201911262660A CN 111057789 A CN111057789 A CN 111057789A
- Authority
- CN
- China
- Prior art keywords
- pnvy
- tylccnv
- mul
- detecting
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for synchronously detecting PNVY and TYLCCNV, which belongs to the field of plant protection, wherein the two viruses have different nucleic acid types, primers for detecting the PNVY and the TYLCCNV are designed and synthesized, and specific primers suitable for compound infection of the two viruses are screened; the CTAB method is used for extracting the total nucleic acid of the infected plant tissue, so that the DNA and RNA in the extracted nucleic acid can be ensured, and the detection cost can be reduced; and a one-step double detection system is optimized, and the synchronous and rapid detection of PnVY and TYLCCNV is achieved. The method has the advantages of short time used in the whole detection process, reduction of reagent pollution and influence factors in reaction, effective single or compound identification of PnVY and TYLCCNV, and guarantee of the accuracy of detection results.
Description
Technical Field
The invention belongs to the field of plant protection, and particularly relates to a method for synchronously detecting PNVY and TYLCCNV.
Background
In recent years, with the continuous expansion of Panax notoginseng planting areas in Yunnan, virus diseases gradually occur in each Panax notoginseng producing area in Yunnan, which causes obvious influence on the yield and quality of Panax notoginseng, and poses a serious threat to the industry of Panax notoginseng in Yunnan, the main virus diseases on Panax notoginseng at present are Panax notoginseng Y virus (PnVY), Chinese Tomato yellow leaf curl virus (TYLCCV) and satellite Tomato yellow leaf curl virus DNA β (Tomato yellow leaf curl China beta, TYLCCNB) and Panax notoginseng A virus (Panaxvirus A, PnVA), wherein TYLCCV, TYLCCNB are DNA viruses, TYLCCV belongs to the genus Phaseolus viridae (Begovirues) of Geminiviridae (Gemini viridae) and the field virus propagation range is accurately determined by single-stranded DNA virus (TYV) of the single-stranded DNA virus (PnV) and the single-stranded RNA of the PnV, and the single-stranded RNA of the PCR virus (TYV) is accurately determined and is a single-stranded virus vector.
The conventional methods for detecting and identifying plant viruses mainly comprise conventional biological detection, serology technology, electron microscope technology, molecular biology technology and the like. Conventional biological assays mainly include host range assays, propagation pathway assays, differential host responses, and the like, but are time consuming and limited by season, environment, and the like. The electron microscope technology is often applied to the identification of plant viruses, but has higher requirements on the material for preparing virus samples and expensive equipment, and limits the wide application of the electron microscope technology. The sensitivity of the RT-PCR detection method is higher than that of a serology method, and the time required by the whole detection process is short, so the RT-PCR technology is widely applied to the detection of plant viruses, but the conventional two-step RT-PCR technology can only detect one virus at a time, and the detection of the condition of multiple virus complex infection takes long time.
Disclosure of Invention
In order to overcome the problems in the background art, the invention aims to provide a method for synchronously detecting PNVY and TYLCCNV, which can efficiently, quickly and accurately detect and identify the PVY and TYLCCNV generated on pseudo-ginseng by a one-step RT-PCR technology.
In order to realize the purpose, the invention is realized by the following technical scheme:
the method for synchronously detecting PNVY and TYLCCNV comprises the following steps:
1) designing and synthesizing:
primers for synthesizing and detecting PnVY and TYLCCNV are respectively designed, and the primer sequences are as follows:
PnVY: forward primer (PnVYdF4) 5 '-3': CGTACATCAAGTTCGGCTC
Reverse primer (PnVYcRa2) 5 '-3': TAATTGTCAGCACATCGTA
TYLCCNV: forward primer (tylcnvf 1) 5 '-3': CCTGTATATGCGACTTTGAAAGT
Reverse primer (tylcnvr 1) 5 '-3': CCCAATTCCAGCTATAAAGAGTA
2) Extracting total RNA and DNA of infected plant tissues by a CTAB method to be used as an RT-PCR amplification template;
3) carrying out RT-PCR amplification;
4) detecting the amplification result by gel electrophoresis.
Further preferably, in step 1), the primer for detecting PnVY is ssRNA, and the size of the amplified fragment is 1032 bp; the primer for detecting the TYLCCNV is ssDNA, and the size of an amplified fragment is 650 bp.
More preferably, in the step 2), the step of extracting total nucleic acid of the infected plant tissue by the CTAB method comprises the following steps: 100mg of a diseased leaf sample which is ground into powder by liquid nitrogen is weighed into a 1.5mL centrifuge tube, and 1.2mL CTAB buffer is addedLiquid; carrying out warm bath at 65 ℃ for 45-60 min; 13000r/min for 10min, taking 650. mu.L of supernatant to a new 1.5mL centrifuge tube, adding equal volume of chloroform/isoamylol (24:1), and vortexing and mixing uniformly for 30 s; centrifuging at 13000r/min for 10min, transferring 500 μ L of supernatant to a new 1.5mL centrifuge tube carefully, adding 350 μ L of isopropanol, slightly inverting the centrifuge tube, mixing the liquid thoroughly, standing at room temperature for 10min, centrifuging at 13000r/min for 15min, and carefully sucking out the supernatant with a micropipette; adding 500 mu L of 75% ethanol into the precipitate, centrifuging for 10min at 13000r/min, carefully sucking out the supernatant by a micropipette, and naturally drying the precipitate for 10-15 min at room temperature; add 100. mu. LddH2Placing O on ice for 30min, repeatedly blowing liquid with micropipette to dissolve precipitate, and storing at-20 deg.C for use.
Further preferably, the CTAB buffer comprises 2% CTAB, 2% PVP-40, 100mM Tris-HCl, 1.4M NaCl, 20mM EDTA, 0.2% mercaptoethanol, pH 8.0.
Further preferably, in Step 3), the reaction system of the one-Step RT-PCR is 10. mu.L, comprising 0.4. mu.L of LPrimeScript 1Step Enzyme Mix, 5. mu.L of 2X 1Step Buffer, 0.35. mu.L each of 10. mu.M forward and reverse primers PnVYdF4/PnVYcRa2, and 0.25. mu. L, ddH each of 10. mu.M forward and reverse primers TYLCCVF 1/TYLCCCNVR 12O2.4. mu.L and template 1. mu.L.
Further preferably, in step 3), the reaction conditions of the one-step RT-PCR are as follows: reverse transcription at 50 deg.C for 30min, at 94 deg.C for 2min, at 94 deg.C for 30s, at 55 deg.C for 30s, at 72 deg.C for 1min, amplification for 35 cycles, extension at 72 deg.C for 10min, and storage at 4 deg.C.
The invention has the beneficial effects that:
(1) the invention can effectively identify PnVY and TYLCCNV singly or compositely, ensures the accuracy of the detection result, designs a plurality of pairs of specific primers aiming at PnVY and TYLCCNV because the two viruses involved in the invention have different nucleic acid types, and screens out two pairs of primers of PnVdF 4/PnVYcRa2 and TYLCCNV 1/TYLCCNV 1 as the primers for one-step double detection through a plurality of tests. The invention is diluted to 10-2The sample template can still simultaneously detect PnVY and TYLCCNV, and has strong specificity and high sensitivity.
(2) The invention ensures that the detection of PnVY and TYLCCNV is simpler and more convenient than the two-step method RT-PCR, and reduces the factors such as detection time, reagent pollution and the like.
Drawings
FIG. 1: one-step RT-PCR amplification result of field pseudo-ginseng sample multiple infection PnVY and TYLCCNV
M: 2Kb Plus DNA Ladder; 1-4: a sample of notoginseng co-infected with PnVY and tylcccv; 5: a healthy pseudo-ginseng sample;
FIG. 2: one-step RT-PCR amplification result of templates with different dilution times
M：2Kb Plus DNA Ladder；1：100X is diluted; 2: 10-1X is diluted; 3: 10-2X is diluted; 4: 10-3X is diluted; 5: 10-4And (6) diluting by adopting X.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, preferred embodiments of the present invention will be described in detail below to facilitate understanding of the skilled person.
The first embodiment is as follows:
1. experimental Material
The field susceptible panax notoginseng samples which are confirmed to be infected with PnVY alone and PnVY and TYLCCNV in a complex way by single RT-PCR are taken as materials, and the healthy panax notoginseng samples are taken as negative controls.
2. (1) primer design Synthesis
Primers for synthesizing and detecting PnVY and TYLCCNV are respectively designed, and the primer sequences are as follows:
PnVY: forward primer (PnVYdF4) 5 '-3': CGTACATCAAGTTCGGCTC
Reverse primer (PnVYcRa2) 5 '-3': TAATTGTCAGCACATCGTA
TYLCCNV: forward primer (tylcnvf 1) 5 '-3': CCTGTATATGCGACTTTGAAAGT
Reverse primer (tylcnvr 1) 5 '-3': CCCAATTCCAGCTATAAAGAGTA
The amplified fragment size of each pair of primers and the virus to be detected are as follows:
(2) extracting total RNA and DNA of infected plant tissues by a CTAB method to be used as an RT-PCR amplification template;
(3) one-step RT-PCR amplification;
(4) and detecting the amplification result by agarose gel electrophoresis.
3. Extraction of total nucleic acid of susceptible plant tissues by CTAB method: and (3) overlapping 3-5 diseased leaves together, weighing about 500mg into a mortar, and adding liquid nitrogen for fully grinding. 100mg of a pulverized sample was weighed into a 1.5mL centrifuge tube, and 1.2mL of a buffer solution for LCTAB (2% CTAB, 2% PVP-40, 100mM Tris-HCl, pH 8.0, 1.4M NaCl, 20mM EDTA, 0.2% mercaptoethanol) was added; carrying out warm bath at 65 ℃ for 45-60 min; 13000r/min for 10min, taking 650. mu.L of supernatant to a new 1.5mL centrifuge tube, adding equal volume of chloroform/isoamylol (24:1), and vortexing and mixing uniformly for 30 s; centrifuging at 13000r/min for 10min, transferring 500 μ L of supernatant to a new 1.5mL centrifuge tube carefully, adding 350 μ L of isopropanol, slightly inverting the centrifuge tube, mixing the liquid thoroughly, standing at room temperature for 10min, centrifuging at 13000r/min for 15min, and carefully sucking out the supernatant with a micropipette; adding 500 mu L of 75% ethanol into the precipitate, centrifuging for 10min at 13000r/min, carefully sucking out the supernatant by a micropipette, and naturally drying the precipitate for 10-15 min at room temperature; add 100. mu. LddH2Placing O on ice for 30min, repeatedly blowing liquid with micropipette to dissolve precipitate, and storing at-20 deg.C for use.
4. The reagent used in the one-step RT-PCR method is PrimeScript of TaKaRaTMOne Step RT-PCR KitVer.2, the optimized reaction system is 10 μ L, comprising 0.4 μ L PrimeScript 1Step Enzyme Mix, 5 μ L2 × 1Step Buffer, 0.35 μ L each of 10 μ M forward and reverse primers PnVYdF4/PnVYcRa2, and 0.25 μ L, ddH each of 10 μ M forward and reverse primers TYLCCNVF1/TYLCCNVR12O2.4. mu.L and template 1. mu.L.
5. The reaction conditions of the one-step RT-PCR are as follows: reverse transcription at 50 deg.C for 30min, at 94 deg.C for 2min, at 94 deg.C for 30s, at 55 deg.C for 30s, at 72 deg.C for 1min, amplification for 35 cycles, extension at 72 deg.C for 10min, and storage at 4 deg.C.
6. Electrophoretic detection
A1.0% agarose gel (containing 5ul/100ml Gold View) was prepared, electrophoresed under a 0.5 XTBE buffer at 80V for 50min at a constant voltage, and photographed by observing on a gel imager.
7. Analysis of detection results
Detecting a single nucleic acid strip of 1032bp in pseudo-ginseng leaves infected with PnVY alone; two bands of 1032bp and 650bp are detected in the panax notoginseng diseased leaves infected with PnVY and TYLCCNV in a complex way, while no band is detected in the healthy panax notoginseng sample.
8. Verification of the authenticity of the amplification product
Randomly selecting 1032bp and 650bp bands in the amplification product, respectively cutting corresponding bands from the gel under an ultraviolet lamp, purifying by using a TIANGEN non-reactive DNA Purification Kit DNA Purification recovery Kit, and connecting the recovery product to a Taobaobian engineering (Dalian) Limited company
The nucleotide consistency of the 1032bp fragment and PnVY registered in GenBank reaches 98 percent and the nucleotide consistency of the 650bp fragment and TYLCCNV registered in GenBank reaches 96 percent through sequence comparison, which indicates that the 1032bp and 650bp bands obtained from field susceptible panax notoginseng are corresponding cDNA amplification products of PnVY and TYLCCNV.
Example two:
1. experimental Material
The field susceptible panax notoginseng samples which are confirmed to be infected with TYLCCNV alone and PnVY and TYLCCNV in a complex way by single RT-PCR are taken as materials, and the healthy panax notoginseng samples are taken as negative controls.
2. (1) primer design Synthesis
Primers for synthesizing and detecting PnVY and TYLCCNV are respectively designed, and the primer sequences are as follows:
PnVY: forward primer (PnVYdF4) 5 '-3': CGTACATCAAGTTCGGCTC
Reverse primer (PnVYcRa2) 5 '-3': TAATTGTCAGCACATCGTA
TYLCCNV: forward primer (tylcnvf 1) 5 '-3': CCTGTATATGCGACTTTGAAAGT
Reverse primer (tylcnvr 1) 5 '-3': CCCAATTCCAGCTATAAAGAGTA
The amplified fragment size of each pair of primers and the virus to be detected are as follows:
(2) extracting total RNA and DNA of infected plant tissues by a CTAB method to be used as an RT-PCR amplification template;
(3) one-step RT-PCR amplification;
(4) and detecting the amplification result by agarose gel electrophoresis.
3. Extraction of total nucleic acid of susceptible plant tissues by CTAB method: and (3) overlapping 3-5 diseased leaves together, weighing about 500mg into a mortar, and adding liquid nitrogen for fully grinding. 100mg of a pulverized sample was weighed into a 1.5mL centrifuge tube, and 1.2mL of a buffer solution for LCTAB (2% CTAB, 2% PVP-40, 100mM Tris-HCl, pH 8.0, 1.4M NaCl, 20mM EDTA, 0.2% mercaptoethanol) was added; carrying out warm bath at 65 ℃ for 45-60 min; 13000r/min for 10min, taking 650. mu.L of supernatant to a new 1.5mL centrifuge tube, adding equal volume of chloroform/isoamylol (24:1), and vortexing and mixing uniformly for 30 s; centrifuging at 13000r/min for 10min, transferring 500 μ L of supernatant to a new 1.5mL centrifuge tube carefully, adding 350 μ L of isopropanol, slightly inverting the centrifuge tube, mixing the liquid thoroughly, standing at room temperature for 10min, centrifuging at 13000r/min for 15min, and carefully sucking out the supernatant with a micropipette; adding 500 mu L of 75% ethanol into the precipitate, centrifuging for 10min at 13000r/min, carefully sucking out the supernatant by a micropipette, and naturally drying the precipitate for 10-15 min at room temperature; add 100. mu. LddH2Placing O on ice for 30min, repeatedly blowing liquid with micropipette to dissolve precipitate, and storing at-20 deg.C for use.
4. The reagent used in the one-step RT-PCR method is PrimeScript of TaKaRaTMOne Step RT-PCR KitVer.2, the optimized reaction system is 10 μ L, comprising 0.4 μ L PrimeScript 1Step Enzyme Mix, 5 μ L2 × 1Step Buffer, 0.35 μ L each of 10 μ M forward and reverse primers PnVYdF4/PnVYcRa2, 10 μ M forward and reverse primers TYLCCNVF1/TYLCCNVR1 0.25 mu L, ddH each2O2.4. mu.L and template 1. mu.L.
5. The reaction conditions of the one-step RT-PCR are as follows: reverse transcription at 50 deg.C for 30min, at 94 deg.C for 2min, at 94 deg.C for 30s, at 55 deg.C for 30s, at 72 deg.C for 1min, amplification for 35 cycles, extension at 72 deg.C for 10min, and storage at 4 deg.C.
6. Electrophoretic detection
A1.0% agarose gel (containing 5ul/100ml Gold View) was prepared, electrophoresed under a 0.5 XTBE buffer at 80V for 50min at a constant voltage, and photographed by observing on a gel imager.
7. Analysis of detection results
Detecting a single nucleic acid strip of 1032bp in pseudo-ginseng leaves infected with PnVY alone; two bands of 1032bp and 650bp are detected in the panax notoginseng diseased leaves infected with PnVY and TYLCCNV in a complex way, while no band is detected in the healthy panax notoginseng sample.
8. Verification of the authenticity of the amplification product
Randomly selecting 1032bp and 650bp bands in the amplification product, respectively cutting corresponding bands from the gel under an ultraviolet lamp, purifying by using a TIANGEN non-reactive DNA Purification Kit DNA Purification recovery Kit, and connecting the recovery product to a Taobaobian engineering (Dalian) Limited company
The nucleotide consistency of the 1032bp fragment and PnVY registered in GenBank reaches 98 percent and the nucleotide consistency of the 650bp fragment and TYLCCNV registered in GenBank reaches 96 percent through sequence comparison, which indicates that the 1032bp and 650bp bands obtained from field susceptible panax notoginseng are corresponding cDNA amplification products of PnVY and TYLCCNV.
Finally, it is noted that the above-mentioned preferred embodiments illustrate rather than limit the invention, and that, although the invention has been described in detail with reference to the above-mentioned preferred embodiments, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the scope of the invention as defined by the appended claims.
Claims (6)
1. A method for synchronously detecting PNVY and TYLCCNV is characterized in that: the method comprises the following steps:
1) designing and synthesizing a primer:
primers for synthesizing and detecting PnVY and TYLCCNV are respectively designed, and the primer sequences are as follows:
PnVY：
forward primer (PnVYdF4) 5 '-3': CGTACATCAAGTTCGGCTC
Reverse primer (PnVYcRa2) 5 '-3': TAATTGTCAGCACATCGTA
TYLCCNV：
Forward primer (tylcnvf 1) 5 '-3': CCTGTATATGCGACTTTGAAAGT
Reverse primer (tylcnvr 1) 5 '-3': CCCAATTCCAGCTATAAAGAGTA
2) Extracting total RNA and DNA of infected plant tissues by a CTAB method to be used as an RT-PCR amplification template;
3) one-step RT-PCR amplification;
4) and detecting the amplification result by agarose gel electrophoresis.
2. The method of claim 1, wherein the method of simultaneously detecting PNVY and TYLCCNV comprises: in the step 1), the primer for detecting PnVY is ssRNA, and the size of the amplified fragment is 1032 bp; the primer for detecting the TYLCCNV is ssDNA, and the size of an amplified fragment is 650 bp.
3. The method of claim 1, wherein the method of simultaneously detecting PNVY and TYLCCNV comprises: in the step 2), the step of extracting the total nucleic acid of the infected plant tissue by the CTAB method is as follows: weighing 100mg of liquid nitrogen, grinding into powder, putting the powder into a 1.5mL centrifuge tube, and adding 1.2mL CTAB buffer solution; carrying out warm bath at 65 ℃ for 45-60 min; 13000r/min for 10min, 650. mu.L of the supernatant was transferred to a new 1.5mL centrifuge tube, an equal volume of chloroform/isoamyl alcohol (24:1) was added,vortex, shake and mix evenly for 30 s; centrifuging at 13000r/min for 10min, transferring 500 μ L of supernatant to a new 1.5mL centrifuge tube carefully, adding 350 μ L of isopropanol, slightly inverting the centrifuge tube, mixing the liquid thoroughly, standing at room temperature for 10min, centrifuging at 13000r/min for 15min, and carefully sucking out the supernatant with a micropipette; adding 500 mu L of 75% ethanol into the precipitate, centrifuging for 10min at 13000r/min, carefully sucking out the supernatant by a micropipette, and naturally drying the precipitate for 10-15 min at room temperature; add 100. mu. LddH2Placing O on ice for 30min, repeatedly blowing liquid with micropipette to dissolve precipitate, and storing at-20 deg.C for use.
4. A method for simultaneous detection of PNVY and tylcccv according to claim 3, characterized in that: the CTAB buffer solution comprises 2% CTAB, 2% PVP-40, 100mM Tris-HCl, 1.4M NaCl, 20mM EDTA, 0.2% mercaptoethanol and pH 8.0.
5. A method for simultaneous detection of PNVY and TYLCCNV according to any of claims 1-4, wherein: in the Step 3), the reaction system of the one-Step RT-PCR is 10 muL, and comprises 0.35 muL of 0.4 muL PrimeScript 1Step enzyme, 0.35 muL of 5 muL 2 × 1Step Buffer, 0.25 muL of 10 muM forward and reverse primers PnVYdF4/PnVYcRa2 and 0.25 muL L, ddH of 10 muM forward and reverse primers TYLCCNVF 1/TYLCCCNVR 12O2.4 muL and a template 1 muL.
6. A method for simultaneous detection of PNVY and tylcccv according to any one of claims 1-5, characterized in that: in the step 3), the reaction conditions of the one-step RT-PCR are as follows: reverse transcription at 50 deg.C for 30min, at 94 deg.C for 2min, at 94 deg.C for 30s, at 55 deg.C for 30s, at 72 deg.C for 1min, amplification for 35 cycles, extension at 72 deg.C for 10min, and storage at 4 deg.C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911262660.6A CN111057789A (en) | 2019-12-11 | 2019-12-11 | Method for synchronously detecting PnVY and TYLCCNV |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911262660.6A CN111057789A (en) | 2019-12-11 | 2019-12-11 | Method for synchronously detecting PnVY and TYLCCNV |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111057789A true CN111057789A (en) | 2020-04-24 |
Family
ID=70300459
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911262660.6A Pending CN111057789A (en) | 2019-12-11 | 2019-12-11 | Method for synchronously detecting PnVY and TYLCCNV |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111057789A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102230027A (en) * | 2011-06-10 | 2011-11-02 | 云南农业大学 | Method for synchronous detection of sweet potato feathery mottle virus (SPFMV), sweet potato virus C (SPVC), sweet potato virus G (SPVG) and sweet potato virus 2 (SPV2) |
-
2019
- 2019-12-11 CN CN201911262660.6A patent/CN111057789A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102230027A (en) * | 2011-06-10 | 2011-11-02 | 云南农业大学 | Method for synchronous detection of sweet potato feathery mottle virus (SPFMV), sweet potato virus C (SPVC), sweet potato virus G (SPVG) and sweet potato virus 2 (SPV2) |
Non-Patent Citations (2)
| Title |
|---|
| CHENCHEN JING等: "Molecular identification of tobacco leaf curl disease in Sichuan province of China", 《VIROLOGY JOURNAL》 * |
| 李晓静: "三七病毒病病原种类鉴定及其相关病毒分子变异分析", 《中国优秀博硕士学位论文全文数据库（硕士）农业科技辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| May et al. | A sequence-independent, unstructured internal ribosome entry site is responsible for internal expression of the coat protein of Turnip crinkle virus | |
| Castillo et al. | Rapid isolation of mycoviral double-stranded RNA from Botrytis cinerea and Saccharomyces cerevisiae | |
| CN108103168A (en) | The appraisal procedure of DNA mass in a kind of FFPE samples | |
| Yi et al. | Brome mosaic virus capsid protein regulates accumulation of viral replication proteins by binding to the replicase assembly RNA element | |
| CN113604585B (en) | Universal primer and application thereof in multi-cell species identification and cross contamination detection | |
| CN111304365A (en) | Novel one-step loop-mediated isothermal detection reagent for gosling gout virus and application thereof | |
| Saunders et al. | The tobacco mosaic virus origin of assembly sequence is dispensable for specific viral RNA encapsidation but necessary for initiating assembly at a single site | |
| CN110172526A (en) | A kind of Rapid identification Fusarium graminearum produces kit and its application of virus gene type | |
| CN111455109B (en) | Method for synchronously detecting ZYMV, PRSV and ZTMV | |
| CN111808994A (en) | RPA primer and detection method for detecting banana streak virus GF isolate | |
| German et al. | Analysis of the dsRNAs of apple chlorotic leaf spot virus | |
| KR100801558B1 (en) | Primer for detecting Rice black-streaked dwarf virus Rice dwarf virus and Rice stripe virus and method for detecting simultaneously said viruses using the same | |
| CN111057789A (en) | Method for synchronously detecting PnVY and TYLCCNV | |
| CN107130057B (en) | Detect rice black-streaked dwarf virus and the RT PCR of southern rice black-streaked dwarf virus and its application | |
| CN101705225B (en) | High-efficiency separation method for lower molecular multiplex PCR-amplified fragments | |
| CN112592995B (en) | Universal primer for detecting target gene expression in transgenic plant and detection method | |
| CN111057796A (en) | PCR primer group and kit for detecting pepper mild mottle virus and application thereof | |
| CN107326088B (en) | Method for detecting insect-resistant herbicide-tolerant corn GH5112E-117C | |
| US20210207125A1 (en) | Method of isolating nucleic acids for long sequencing reads | |
| CN106755317B (en) | Primer, method and application for detecting rice orange leaf disease phytoplasma | |
| CN106755602B (en) | Method for synchronously detecting SPVG, SPLV and SPMMV | |
| CN111118221A (en) | RPA primer, probe and kit for detecting mosaic virus of cassava mosaic virus of Sri Lanka | |
| CN112063759A (en) | RT-LAMP primer, kit and detection method for simultaneously detecting multiple viruses of banana | |
| CN113322353B (en) | RPA kit for detecting sweet potato pinnate mottle virus and sweet potato chlorotic stunt virus | |
| CN108359746A (en) | Detect the method and primer of the cell cross contamination caused by Hela cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |