CN111020042B

CN111020042B - Compositions and methods for detecting group A streptococci

Info

Publication number: CN111020042B
Application number: CN202010002639.9A
Authority: CN
Inventors: 易晓明; 黄河; 宴丝妮; 王铁军; 戴立忠; 邓中平; 刘佳
Original assignee: Sansure Biotech Inc
Current assignee: Sansure Biotech Inc
Priority date: 2020-01-02
Filing date: 2020-01-02
Publication date: 2023-06-16
Anticipated expiration: 2040-01-02
Also published as: CN111020042A

Abstract

The invention relates to a composition for detecting group A streptococcus, which comprises a first primer, wherein the sequence of the first primer is 5'-TTAGCATTAGGTGGATTTGTTCTT-3'; a second primer having a sequence of 5'-GCTATCTTTTGCTTCTTTTTCGTTA-3'; and a probe, the sequence of which is 5'-TAACCCAGTATTTGCCGATCAAAACTTTGC-3'. Realizes the detection of the group A streptococcus with accurate results. In addition, a method for detecting the group A streptococcus and application thereof are also provided.

Description

Compositions and methods for detecting group A streptococci

Technical Field

The invention relates to the field of in vitro diagnosis, in particular to a composition for detecting group A streptococcus.

Background

Group a streptococcus (Group A Streptococcus, GAS), which is commonly expressed as beta-hemolysis when cultured on platelets, is therefore also known as group a beta-hemolytic streptococcus (group aβ -haemolytic streptococcus), a common causative bacterium for humans. GAS is carried at 5% to 15% or less in healthy people. GAS infection may be a factor affecting acute angina or skin infection, and may be one of the causes of various suppurative and non-suppurative complications. It is counted that there are 6 million 1600 tens of thousands and 1 million 1100 tens of thousands of acute angina and skin infections caused by GAS each year worldwide, respectively. There are about 1810 tens of thousands of patients with GAS-related severe diseases, and at an increasing rate of about 178 tens of thousands of patients annually, at least 51.7 tens of thousands die of these diseases annually. That is, there is a need for detecting GAS to aid in determining the occurrence and progression of related diseases.

For detection of GAS, culture, immunochromatography and colloidal gold have been mainly focused so far. The identification method based on biochemical and bacterial culture has low sensitivity, and the culture period is as long as 24-72 hours, so that the optimal treatment period is missed. However, for immunochromatography and colloidal gold methods, which depend on the amount of group A streptococcus or its antibodies in a sample, it is difficult to perform rapid and accurate detection at an early stage.

In contrast, currently, a smaller amount of research is focused on GAS detection based on fluorescent quantitative PCR methods. Chinese patent publication CN107058622a discloses a kit for combined detection of respiratory pathogens by multiplex fluorescence PCR, which includes GAS-specific primers and probes, but the sensitivity in detecting GAS is unsatisfactory, and the specificity is not verified by group B streptococcus.

Therefore, in the GAS detection field, there is a need to further find a fluorescent quantitative detection reagent with high sensitivity and good specificity.

Disclosure of Invention

Accordingly, the present invention provides in a first aspect a composition comprising:

a first primer shown as SEQ ID NO. 1, a second primer shown as SEQ ID NO. 2, and a probe shown as SEQ ID NO. 3.

As a result of extensive studies, the present inventors have selected the above composition from a plurality of primer and probe combinations. The compositions of the present invention enable GAS detection with higher amplification efficiency and better sensitivity than other primer and probe combinations. As demonstrated in example 3 of the present invention,

combinations

2 and 3, which are similar in sequence to the composition of the present invention, achieve GAS detection under the same design principle, but have a relatively uneven and non-straight amplification curve after CT values, and therefore do not achieve amplification efficiency and sensitivity similar to that of combination 1 of the present invention.

The compositions of the invention can detect GAS based on fluorescent PCR methods.

In the present invention, the probe may have a fluorescent group and a quenching group.

In some embodiments, the fluorophore and quencher are located at the 5 'end and 3' end of the probe.

In the present invention, the probe has a fluorescent group and a quenching group for fluorescent PCR detection. The fluorophore may be selected from, for example, CY5, cal Red 610, FAM, HEX, JOE, ROX, TET, TEXAS RED, and VIC, but the invention is not limited thereto.

In the present invention, the quenching group may be selected from, for example, BHQ1, BHQ2, BHQ3, eclipse and TAMRA, but the present invention is not limited thereto.

In particular embodiments, the fluorophore may be FAM.

In particular embodiments, the quenching group may be TAMRA.

In a specific embodiment, the probe is 5'-FAM-TAACCCAGTATTTGCCGATCAAAACTTTGC-TAMRA-3'.

In a specific embodiment, the first primer of the invention is used as an upstream primer during the detection process and the second primer of the invention is used as a downstream primer during the detection process.

In a preferred embodiment, the composition of the present invention further comprises a substance, such as a cotton swab or the like, for obtaining a pharyngeal swab sample.

In another preferred embodiment, the composition of the present invention further comprises means for preserving a pharyngeal swab sample, such as a pharyngeal swab culture tube, a pharyngeal swab collection tube, or the like.

It should be noted that the compositions of the present invention are particularly suited for testing throat swab samples. On one hand, the composition of the invention can realize the detection of throat swab samples due to the amplification efficiency and sensitivity, so that the whole detection process is more convenient and quicker. On the other hand, as demonstrated in example 8 below, the compositions of the present invention are not interfered with by other common pathogens in the oral mucosa, particularly avoiding false positives when detecting throat swab samples.

In some embodiments, the compositions of the invention may further comprise reagents for extracting nucleic acids by the magnetic bead method.

In order to prevent false negatives caused by PCR interference substances possibly existing in a sample, prevent false negatives from occurring in detection results and monitor whether a reaction system is effective, the reagent combination of the invention can be additionally provided with an internal standard monitoring system.

In particular embodiments, the internal standard monitoring system may include an internal standard template, an internal standard upstream primer, an internal standard downstream primer, and an internal standard probe.

In particular embodiments, the internal standard upstream primer and the internal standard downstream primer may each be present at a concentration of 0.1. Mu. Mol/L to 0.45. Mu. Mol/L; the internal standard probe can be present at a concentration of 0.1. Mu. Mol/L to 0.5. Mu. Mol/L; the internal standard template may be present at a concentration of 5.00E+03copies/ml to 5.00E+05copies/ml.

Similarly, both ends of the internal standard probe may be labeled with a reporter fluorophore and a quencher fluorophore, respectively. Exemplary reporter fluorophores can be CY5, cal Red 610, FAM, HEX, JOE, ROX, TET, TEXAS Red, VIC, and the like. Exemplary fluorescence quenching groups may be BHQ1, BHQ2, BHQ3, eclipse, TAMRA, and the like.

In particular embodiments, the reporter fluorophore of the internal standard probe may be HEX and the fluorescence quenching group of the internal standard probe may be BHQ1.

In an exemplary embodiment, the internal standard template may be a recombinant, i.e., plasmid, of a 132 base pair long synthetic DNA sequence inserted into the pMD18T vector. Wherein the 132 base pair sequence is:

5’-GACTCTCGTTAATCCTACCGCGCTTCTGGAAAGGCTCTCCAGTTCCTCGTTCCTACACGAGTCAGTCGAGCTACCGTGGTCATTCCGAGACGCGTTAATCGACTCGACGAGTACGACCGTCGACGAGTCAGT-3’(SEQ ID NO:4)；

the internal standard upstream primer may be: 5'-GACTCTCGTTAATCCTA-3' (SEQ ID NO: 5);

the internal standard downstream primer may be: 5'-ACTGACTCGTCGAC-3' (SEQ ID NO: 6);

the internal standard probe may be: 5'HEX-CGCGCTTCTGGAAAGGCTCTCCAGT-BHQ1-3' (the nucleotide sequence of which is shown in SEQ ID NO: 7).

In some embodiments, the compositions of the invention may further comprise a positive control. An exemplary positive control may be a plasmid containing the GAS gene or fragment thereof. The concentration of the positive control may be, for example, known, such as 1.00 to 5.00E+05copies/ml.

In some embodiments, the compositions of the present invention may further comprise a negative control. An exemplary negative control may be sterilized normal saline.

In addition to the above primers and probes, the reagent combinations of the present invention may further include other reagents for performing fluorescent quantitative PCR, such as PCR reaction buffers, dNTPs, DNA polymerase, positive or negative controls, and the like.

In some embodiments, the reagent combinations of the present invention may further comprise reagents for extracting and/or purifying GAS from a sample. Exemplary extraction or purification methods may include boiling, centrifugation, magnetic bead. In a preferred embodiment, the reagent combinations of the present invention comprise reagents related to the extraction or purification of RNA using the magnetic bead method.

In a second aspect, the invention also provides a kit comprising a composition of the invention.

The kit of the invention can be used for detecting GAS.

In a third aspect, there is provided the use of a composition of the invention in the manufacture of a kit for detecting GAS.

In a fourth aspect, the invention provides a method of detecting GAS comprising the steps of:

1) Obtaining a sample;

2) Extracting nucleic acid of GAS;

3) Performing a fluorescent quantitative PCR reaction using the first primer, the second primer and the probe or the kit of the present invention; and

4) The detection result is obtained and analyzed,

wherein the sequence of the first primer 5'-TTAGCATTAGGTGGATTTGTTCTT-3'; the sequence of the second primer is 5'-GCTATCTTTTGCTTCTTTTTCGTTA-3'; and the sequence of the probe was 5'-TAACCCAGTATTTGCCGATCAAAACTTTGC-3'.

In some embodiments, blood, pharyngeal swabs, cerebrospinal fluid or stool from an individual is used as a sample in the methods of the invention.

In a preferred embodiment, the sample is a pharyngeal swab.

As described above, by using the first reagent, the second reagent and the probe according to the present invention, GAS in a throat swab sample can be accurately detected. Further, the detection method of the invention can obtain results which are not interfered by other common pathogens in the oral mucosa.

In some embodiments, the methods of the invention can use boiling methods, spin columns, magnetic beads methods, and the like to extract DNA from GAS.

In a preferred embodiment, the method of the invention uses a magnetic bead method to extract DNA.

In an alternative embodiment, the method of the invention further comprises the step of purifying the extracted DNA after step 2).

In the method of the present invention, step 3) may employ a reaction system of usual fluorescent quantitative PCR. In addition to the first primer, the second primer, and the probe of the present invention, the reaction system may include a PCR reaction buffer, dNTPs, DNA polymerase, and the like.

In a preferred embodiment, in step 3) of the method of the invention, the DNA polymerase is present in a concentration of 0.08 to 0.28U/. Mu.l.

It should be noted that, by selecting the concentration of the DNA polymerase to be 0.08-0.28U/μl, under the condition of performing fluorescent quantitative PCR amplification using the first primer, the second primer and the probe of the present invention, better amplification efficiency and sensitivity are obtained, thereby further improving accuracy of GAS detection.

In a more preferred embodiment, in step 3) of the method of the invention, the DNA polymerase is present in a concentration of 0.16 to 0.20U/. Mu.l, for example in a concentration of 0.18U/. Mu.l.

In a specific embodiment, the DNA polymerase is Taq DNA polymerase.

In the method of the present invention, step 3) may employ reaction conditions of usual fluorescent quantitative PCR. For example, conventional denaturation, annealing and extension temperatures and durations, etc. may be used.

In an exemplary embodiment, in step 3) of the method of the present invention, the annealing and extension temperatures are 55-60 ℃.

In a preferred embodiment, in step 3) of the method of the invention, the annealing and extension temperature is between 56 and 58 ℃, more preferably 57 ℃.

It should be noted that, as demonstrated in the examples section below, by setting the annealing and extension temperatures at the same time as the preferred temperatures, optimal amplification efficiency and sensitivity are obtained in the case of performing fluorescent quantitative PCR amplification using the first primer, the second primer and the probe of the present invention, thereby further improving accuracy of GAS detection.

Drawings

FIG. 1 shows the amplification curve of combination 1 in example 1;

FIG. 2 shows the amplification curve of combination 2 in example 1;

FIG. 3 shows the amplification curve of combination 3 in example 1;

FIG. 4 shows an amplification curve using 4U DNA polymerase;

FIG. 5 shows an amplification curve using 9U DNA polymerase;

FIG. 6 shows an amplification curve using 14U DNA polymerase;

FIG. 7 shows amplification curves using an annealing and extension temperature of 55 ℃;

FIG. 8 shows amplification curves using an annealing and extension temperature of 57 ℃;

FIG. 9 shows amplification curves using annealing and extension temperatures of 60 ℃;

FIG. 10 shows the sensitivity results for detection using combination 1;

FIG. 11 shows the linear range results for detection using combination 1;

FIG. 12 shows the results of specific assays performed using combination 1 against positive samples of Streptococcus pneumoniae, streptococcus B, staphylococcus epidermidis, pseudomonas aeruginosa, escherichia coli, candida albicans and Staphylococcus aureus;

FIG. 13 shows the internal standard detection results in a specificity test using combination 1; and

FIG. 14 shows the detection results when primer and probe combinations of the prior art are used.

Detailed Description

The advantages and various effects of the present invention will be more clearly presented hereinafter by way of the following description of the present invention with reference to the accompanying drawings. It will be appreciated by those skilled in the art that these specific embodiments are provided to illustrate the invention and not to limit the invention. All other embodiments, based on the embodiments of the invention, which are apparent to those of ordinary skill in the art without inventive faculty, are intended to be within the scope of the invention.

Example 1 primers and probes designed for detection of GAS

Based on the spe B gene sequence of GAS, 10 upstream primer, downstream primer and probe combinations were designed in total. The specific sequences and detection results of the respective primers and probes are shown in Table 1 below by taking 3 sets as examples.

TABLE 1 primer probe sequence example of GAS-based spe B Gene sequence design

Example 2 detection of GAS in samples

2.1 extraction of GAS DNA

Nucleic acid of GAS in the sample was extracted using a magnetic bead method nucleic acid extraction or purification reagent (xiang long mechanical preparation 20150021) manufactured by san francisco biotechnology Co., ltd.

2.2 preparation of PCR reagents

2.2.1 Experimental materials

An internal standard template: a recombinant of 132 base pair long synthetic DNA sequence inserted into a pMD18T vector, wherein the 132 base pair sequence is shown in SEQ ID No. 4:

internal standard upstream primer: as shown in SEQ ID NO. 5;

internal standard downstream primer: as shown in SEQ ID NO. 6;

internal standard probe: 5'HEX-CGCGCTTCTGGAAAGGCTCTCCAGT-BHQ1-3';

positive control: calibrating the plasmid with known concentration, wherein the concentration is 5.00E+05copies/ml;

negative control: sterilizing physiological saline;

enzyme mix solution (2 μl): 9U H-Taq DNA polymerase+1U of UNG enzyme.

PCR reaction (28. Mu.l): 20. Mu.l of 2mmol/L dNTPs, 0.3. Mu. Mol/L of upstream primer and downstream primer for amplification of GAS target nucleotide, 0.3. Mu. Mol/L of probe GAS-P for GAS detection, 0.15. Mu. Mol/L of upstream and downstream primer for detection of internal standard, and 0.3. Mu. Mol/L of probe for detection of internal standard.

2.2.2 Experimental procedures

And (3) taking corresponding amounts of the reaction solution and the enzyme mixed solution according to the amounts of the sample to be detected, the negative control and the positive control in proportion (28. Mu.l/human part of the PCR reaction solution+2. Mu.l/human part of the enzyme solution+20. Mu.l/human part of the sample), fully and uniformly mixing to obtain the object to be detected, and carrying out instantaneous centrifugation for later use.

2.3 fluorescent PCR reactions

1) Placing the object to be detected into a sample tank of a fluorescent quantitative PCR instrument;

2) Fluorescence detection channel selection: selecting FAM channel (report: FAM, quantiser: none) to detect GAS DNA; selecting HEX or VIC channel (Reporter: VIC, quantum: none) to detect internal standard;

3) The fluorescent quantitative PCR reaction conditions were set as shown in Table 2 below

TABLE 2

4) Analysis of results: after the reaction is finished, the instrument automatically stores the result, the software of the instrument can be utilized for automatic analysis (the starting value, the ending value and the threshold line value of the base line can be manually adjusted for analysis), and then the Ct value and the fixed value result of the sample are recorded. The intersection of the amplification curve and the threshold line is called Ct (i.e., cycle threshold, which refers to the number of cycles that the fluorescent signal in the PCR reaction tube undergoes when reaching a set threshold); and judging according to the Ct value of each sample detection result and the amplification curve shape. If the sample amplification curve is S-shaped and has a Ct value less than or equal to 36, the sample amplification curve can be judged to be positive; if the Ct value of the result is more than 36 and the internal standard is positive (the Ct value of the internal standard is less than or equal to 36), the result can be judged as negative.

Example 3 comparison of the detection Effect of different combinations

Using the combinations 1 to 3 of example 1, 5 GAS clinical positive samples were tested according to the method of example 2, wherein the fluorescent quantitative PCR instrument was the macrostone SLAN-96, and the results are shown in FIGS. 1 to 3, respectively, and the average Ct values are summarized in Table 3.

Table 3 summary of the results of the 1-3 combinations

As shown in FIGS. 1 to 3 and Table 3, the Ct value of combination 1 was more advanced, indicating that the amplification efficiency and sensitivity were higher.

Example 4 Effect of DNA polymerase concentration on detection Effect

Using combination 1 of example 1, 8 cases of GAS positive samples of different gradients were tested according to the method of example 2 (wherein the fluorescent quantitative PCR apparatus was a macrostone SLAN-96), and the amounts of DNA polymerase used in the 50. Mu.l reaction system were as shown in Table 4, respectively.

TABLE 4 different amounts of DNA polymerase used

	Experiment 1	Experiment 2	Experiment 3
				DNA polymerase dosage	4U	9U	14U

The detection results are shown in FIGS. 4, 5 and 6 in order, and it can be seen that the detection effect is best when the amount of DNA polymerase is 9U; when the amount of the DNA polymerase is 14U and 4U, the amplification effect is poor, and the Ct value is behind 9U.

Example 5 Effect of annealing and extension temperatures on detection effects

Using combination 1 in example 1, 9 positive samples were tested according to the method in example 2 (wherein the fluorescent quantitative PCR instrument was ABI 7500), wherein the degradation temperatures at the time of fluorescent PCR are shown in Table 5, respectively.

TABLE 5 different annealing extension temperatures

	Experiment 4	Experiment 5	Experiment 6
				Annealing and extension temperature	55℃	57℃	60℃

The results of the detection are shown in FIGS. 7 to 9 in sequence, and it can be seen that the Ct value is more advanced when the annealing and extension temperature is 57 ℃, indicating that the amplification efficiency and sensitivity are higher.

Example 6 sensitivity test

High concentration GAS positive samples were diluted to 200copies/mL with physiological saline. Using combination 1 in example 1, the above samples were tested according to the method in example 2 (wherein the fluorescent quantitative PCR instrument was a macrostone SLAN-96) and the test was repeated 20 times. The results are shown in FIG. 10.

The results show that the sensitivity can reach 200copies/ml when the detection is performed by using the primer and the probe of the combination 1.

Example 7 Linear Range test

High concentration GAS positive samples (5e+10) ¹⁰ cobies/mL), diluted to 500 cobies/mL with a 10-fold gradient of physiological saline. Using combination 1 of example 1, the above samples were tested according to the method of example 2 (wherein the fluorescent quantitative PCR instrument was a macrostone SLAN-96). The results are shown in FIG. 11.

The result shows that when the primer and the probe of the combination 1 are used for detection, the linear range can reach 5.0E+02-5.0E+10 copies/ml; the linear range can reach 2.0E+02-5.0E+10 copies/ml by integrating the sensitivity detection test results.

Example 8 specificity test

Using combination 1 of example 1, positive samples of Streptococcus pneumoniae, streptococcus B, staphylococcus epidermidis, pseudomonas aeruginosa, escherichia coli, candida albicans and Staphylococcus aureus were tested according to the method of example 2 (wherein the fluorescent quantitative PCR apparatus was megalithic SLAN-96), none of which was negative (FIG. 12), and the internal standard was positive (FIG. 13). The results show that the detection specificity of the combination 1 is good, and other common pathogens can not be detected in a cross way.

Comparative example

To examine the difference in effect of the primer and probe combinations of combination 1 of the present invention relative to the existing GAS fluorescent quantitative PCR method, the sequences of the primer and probe for detecting GAS disclosed in patent CN107058622a were synthesized, as shown in table 6 below. High concentration GAS positive samples were diluted to 200copies/mL with physiological saline. The above samples were tested according to the method in example 2 using the primers and probes in combination 1 and table 6, respectively, in example 1, to perform a sensitivity comparison test, and the test was repeated 20 times.

TABLE 6 primer and probe sequences in the prior art

Name of the name	Sequence(s)
		Upstream primer	5'-GTGTTTTCGGCACAAAAGGT-3'
Downstream primer	5'-CGCACTAAACCCTTCAGCTC-3'
		Probe with a probe tip	5'-ROX-CAGCTATGCGGCGTGCCTCA-BHQ2-3’

The results show that when the primer and the probe of the combination 1 are used for detection, the positive rate of a 200copies/ml concentration sample is 100%, and the results are shown in FIG. 10, which show that the sensitivity of the combination 1 of the invention can reach 200copies/ml; the detection test was performed using the primers and probes disclosed in patent CN107058622a (in which the fluorescent quantitative PCR instrument was ABI 7500), and the positive rate of the 200copies/ml concentration sample was 65%, and the results are shown in fig. 14. The results show that the sensitivity performance of combination 1 in the invention is better.

Sequence listing

<110> san Hunan biotechnology Co., ltd

<120> compositions and methods for detecting group A streptococci

<130>

<160> 12

<170> PatentIn version 3.5

<210> 1

<211> 24

<212> DNA

<213> Synthesis

<400> 1

ttagcattag gtggatttgt tctt 24

<210> 2

<211> 25

<212> DNA

<213> Synthesis

<400> 2

gctatctttt gcttcttttt cgtta 25

<210> 3

<211> 30

<212> DNA

<213> Synthesis

<400> 3

taacccagta tttgccgatc aaaactttgc 30

<210> 4

<211> 132

<212> DNA

<213> Synthesis

<400> 4

gactctcgtt aatcctaccg cgcttctgga aaggctctcc agttcctcgt tcctacacga 60

gtcagtcgag ctaccgtggt cattccgaga cgcgttaatc gactcgacga gtacgaccgt 120

cgacgagtca gt 132

<210> 5

<211> 17

<212> DNA

<213> Synthesis

<400> 5

gactctcgtt aatccta 17

<210> 6

<211> 14

<212> DNA

<213> Synthesis

<400> 6

actgactcgt cgac 14

<210> 7

<211> 25

<212> DNA

<213> Synthesis

<400> 7

cgcgcttctg gaaaggctct ccagt 25

<210> 8

<211> 25

<212> DNA

<213> Synthesis

<400> 8

agtcttttag cattaggtgg atttg 25

<210> 9

<211> 27

<212> DNA

<213> Synthesis

<400> 9

tcttgctaac ccagtatttg ccgatca 27

<210> 10

<211> 23

<212> DNA

<213> Synthesis

<400> 10

ttcttgctaa cccagtattt gcc 23

<210> 11

<211> 25

<212> DNA

<213> Synthesis

<400> 11

tttgatagct gctgattttt ggata 25

<210> 12

<211> 30

<212> DNA

<213> Synthesis

<400> 12

tcaaaacttt gctcgtaacg aaaaagaagc 30

<210> 13

<211> 20

<212> DNA

<213> Synthesis

<400> 13

gtgttttcgg cacaaaaggt 20

<210> 14

<211> 20

<212> DNA

<213> Synthesis

<400> 14

cgcactaaac ccttcagctc 20

<210> 15

<211> 20

<212> DNA

<213> Synthesis

<400> 15

cagctatgcg gcgtgcctca 20

Claims

1. A composition for detecting group a streptococcus comprising:

a first primer having a sequence of 5'-TTAGCATTAGGTGGATTTGTTCTT-3';

a second primer having a sequence of 5'-GCTATCTTTTGCTTCTTTTTCGTTA-3'; and

the probe has a sequence of 5'-TAACCCAGTATTTGCCGATCAAAACTTTGC-3'.

2. The composition of claim 1, wherein the probe carries a fluorescent group and a quenching group.

3. The composition according to claim 1 or 2, wherein the composition further comprises a substance for obtaining a pharyngeal swab sample or a device for preserving a pharyngeal swab sample.

4. The composition of claim 1, wherein the composition further comprises reagents for extracting nucleic acids by a magnetic bead method.

5. A kit for detecting group a streptococcus based on a fluorescent PCR method comprising the composition of any one of claims 1-4.

6. A method of detecting group a streptococcus comprising the steps of:

1) Obtaining a sample;

2) Extracting nucleic acid of group A streptococcus;

3) Performing a fluorescent PCR reaction using the first primer, the second primer and the probe defined in claims 1 to 4 or the kit of claim 5; and

4) The detection result is obtained and analyzed,

wherein the method involves non-diagnostic purposes.

7. The method of claim 6, wherein the sample in step 1) is a pharyngeal swab.

8. The method according to claim 6, wherein in the fluorescent quantitative PCR reaction of step 3), an annealing temperature is 55 to 60 ℃.

9. The method of claim 8, wherein the annealing temperature is 56-58 ℃.

10. The method of claim 8, wherein the annealing temperature is 57 ℃.

11. The method according to any one of claims 6 to 10, wherein in said fluorescent quantitative PCR reaction of step 3), the DNA polymerase concentration is 0.08-0.28U/. Mu.l.

12. The method of claim 11, wherein the DNA polymerase concentration is 0.16 to 0.20U/. Mu.l.

13. Use of a composition as claimed in any one of claims 1 to 4 in the manufacture of a kit for detecting group a streptococcus.