CN111020006B - Electrochemical luminescence sensor system for measuring adenosine triphosphate, and preparation method and application thereof - Google Patents

Abstract

The invention discloses an electrochemiluminescence sensor system for measuring adenosine triphosphate, a preparation method and application thereof, wherein the system consists of a magnetic probe for amplifying an adenosine triphosphate concentration signal and an electrochemiluminescence sensor for measuring Trigger DNA; the magnetic probe is made of Fe ₃ O ₄ The nano-particles, the gold nano-particles, the DNA substrate and the aptazyme are compounded in sequence; electrochemical luminescence sensor connects amino modified Capture DNA to modified RuSiO through glutaraldehyde crosslinking ₂ The working electrode surface of CS. In the invention, adenosine triphosphate firstly participates in a constant-temperature amplification reaction guided by a magnetic probe, and generates a large amount of intermediate Trigger DNA; then, the electrochemical luminescence sensor of the invention is used for carrying out quantitative detection on the Trigger DNA of the intermediate, and finally, the aim of indirectly and quantitatively detecting the adenosine triphosphate is achieved.

Description

An electrochemiluminescent sensor system for measuring adenosine triphosphate, its preparation method and application

technical field

The invention belongs to the field of biomedical detection, and in particular relates to an electrochemiluminescent sensor system for measuring adenosine triphosphate, a preparation method and application thereof.

Background technique

Adenosine triphosphate (ATP) is a small molecule high-energy phosphate compound, and it is also the main energy source in organic life, ensuring the energy supply for various life activities of cells. As an "energy currency", it participates in many important physiological processes in living organisms, such as: gene synthesis, nutrient metabolism, drug delivery, and regulation of biological activities such as immunity and nerve mediation. Relevant studies have shown that ATP is an indicator of cell viability and cell damage in organic organisms, and changes in its content are closely related to the occurrence of cardiovascular diseases, Parkinson's disease, Alzheimer's disease and other diseases. In addition, in the field of food safety, the quantitative detection of ATP is also used for the detection of foodborne pathogenic microorganisms. Therefore, the establishment of a high-sensitivity, high-specificity ATP quantitative detection method plays an intuitive and important role in the fields of life science research, clinical diagnosis, food safety and environmental analysis.

At present, a variety of detection methods have been developed for the quantitative detection of ATP, such as: capillary electrophoresis, high performance liquid chromatography, mass spectrometry, chemiluminescence and so on. The above detection methods have the advantages of accuracy and high efficiency, but they also have disadvantages such as cumbersome and time-consuming sample processing steps, low sensitivity, bulky equipment, and high cost, which to some extent limit their wide application in different fields. Therefore, in order to meet the needs of research and application in various fields, it is urgent to develop a simple, fast and highly sensitive ATP quantitative detection method.

Electrochemiluminescence (ECL) is a chemiluminescent phenomenon driven by electrochemistry. Through the intelligent integration of electrochemiluminescence and chemiluminescence technologies, it has superior performance compared with other optical detection methods. Electrochemiluminescence does not require an additional light source, which not only simplifies the experimental equipment, but also avoids the background interference of magazines and scattered light sources, and has high sensitivity. In addition, electrochemiluminescence also has the advantages of high specificity, simple operation, and good reproducibility, which has attracted the attention of many researchers, and has been widely used in food and drug analysis, environmental monitoring and other fields. One of the most promising platforms for detection. In order to develop a sensor that meets the current ATP quantitative detection requirements, the present invention integrates the DNA signal amplification strategy and the excellent luminescence effect of nanomaterials, thereby realizing a multiple signal amplification system, and successfully applied to the quantitative detection of ATP.

Contents of the invention

Purpose of the invention: In view of the shortcomings of the prior art, such as cumbersome time-consuming, low sensitivity, bulky equipment, and high cost, the present invention provides an electrochemiluminescent sensor system for the determination of adenosine triphosphate. Electrochemiluminescent sensor system with multiple signal amplification strategies.

Another object of the present invention is to provide a preparation method of the electrochemiluminescence sensor system for adenosine triphosphate.

Another object of the present invention is to provide the application of the electrochemiluminescence sensor system of adenosine triphosphate. The invention provides a method for quantitative detection of adenosine triphosphate in human serum by applying the sensor system. The detection method has good specificity, high sensitivity, wide linear range and low cost.

Technical solution: In order to achieve the above object, as described in the present invention, an electrochemiluminescence sensor system for measuring adenosine triphosphate, the system is composed of a magnetic probe Au@Fe3O4-substrate-aptazyme for amplifying the concentration signal of adenosine triphosphate and measuring the electrochemiluminescence of Trigger DNA The composition of the sensor; the magnetic probe Au@Fe ₃ O ₄ -substrate-aptazyme is composed of Fe ₃ O ₄ nanoparticles, gold nanoparticles, DNA substrate and aptazyme sequentially; the electrochemiluminescence sensor for determining Trigger DNA passes Glutaraldehyde cross-linking was obtained by connecting amino-modified CaptureDNA to the surface of the modified RuSiO ₂ -CS working electrode.

In the present invention, adenosine triphosphate first participates in the constant temperature amplification reaction guided by the magnetic probe, and produces a large amount of intermediate Trigger DNA; then, the intermediate Trigger DNA is quantitatively detected by the electrochemical luminescence sensor of the present invention, and finally achieves indirect quantitative detection of adenosine triphosphate the goal of.

Wherein, the DNA substrate sequence is "SH-AAAAAAAAAAATTCACCAACTATrAGCTACGATGACTCACCTAGGAG"; the aptazyme sequence is "TCATCGTAGAGCGATCTAGGGGGAGTATTGCGGAGGATAGCACCCATGTTAGTTGGTGAA"; the Trigger DNA sequence is "GCTATACGATGACTCACCTAGGAG"; TGCTACGATGACTC _A "; The above sequences are represented by SEQ ID NO.1-4 respectively.

The intermediate Trigger DNA of the present invention is a DNA fragment produced by digesting DNA substrate through aptazyme, and its function is to organically link the signal amplification strategy mediated by the magnetic probe Au@Fe ₃ O ₄ -substrate-aptazyme with the sensor detection : When ATP is combined with the magnetic probe, the enzymatic cleavage activity of aptazyme is activated and specifically cleaves the DNA substrate strand, finally generating Trigger DNA; since the concentration of the product Trigger DNA is directly proportional to the ATP concentration, by detecting the Trigger DNA, the sensor will Able to achieve quantitative detection of ATP.

The preparation method of the electrochemiluminescent sensor system for measuring adenosine triphosphate according to the present invention comprises the following steps:

Preparation of Magnetic Probe Au@Fe ₃ O ₄ -substrate-aptazyme

(1) Weigh FeCl ₃ and trisodium citrate and dissolve them in ethylene glycol, add sodium acetate, add the mixed solution after stirring into the reaction kettle, precipitate and wash after the reaction, and obtain Fe ₃ O ₄ nanoparticles;

(2) Add trisodium citrate aqueous solution to HAuCl ₄ aqueous solution, continue to boil, obtain Au nanoparticle;

(3) Use APTES to aminate Fe ₃ O ₄ nanoparticles, mix the product with Au nanoparticles, and wash after magnetic separation to obtain Au@Fe ₃ O ₄ nanoparticles;

(4) After Au@Fe ₃ O ₄ nanoparticles are mixed with DNA substrate, magnetically separated after reaction, washed with water to obtain Au@Fe3O4-substrate solution; then mixed with aptazyme and reacted overnight to obtain Au@Fe3O4-substrate-aptazyme probe Needle;

As a preference, the preparation method of the Au@Fe ₃ O ₄ -substrate-aptazyme probe is as follows:

(1) Weigh FeCl ₃ and trisodium citrate and dissolve them in ethylene glycol, add sodium acetate, stir the mixture by magnetic force for 10-60 minutes, add it to the reaction kettle, and react at 200°C for 6-16 hours; after the precipitation is magnetically separated Washing with ethanol and water successively to obtain Fe ₃ O ₄ nanoparticles;

(2) Add 0.1% (mass fraction) trisodium citrate aqueous solution to the boiling 0.01% (mass fraction) HAuCl ₄ aqueous solution, and continue boiling for 10-30 minutes to obtain Au nanoparticles;

(3) Amination modification of Fe ₃ O ₄ nanoparticles was carried out with APTES, the product was mixed with Au nanoparticles, and washed with water after magnetic separation to obtain Au@Fe ₃ O ₄ nanoparticles;

(4) Mix Au@Fe ₃ O ₄ nanoparticles with DNA substrate, react at 37°C for 12-36 hours, wash with water after magnetic separation, and obtain Au@Fe ₃ O ₄ -substrate solution; then mix with aptazyme, and react at 37°C Overnight, get Au@Fe ₃ O ₄ -substrate-aptazyme probe;

The mass ratio of FeCl ₃ , trisodium citrate and sodium acetate in step (1) is: 0.65:0.2:1.2.

The volume ratio of _HAuCl4 and trisodium citrate aqueous solution in step (2) is 50:1.

The final concentration of APTES in step (3) is 1-10% (volume fraction) of the total reaction solution volume, and the concentration of Fe ₃ O ₄ nanoparticles is 0.5-5 mg/mL.

In step (4), the concentration of Au@Fe ₃ O ₄ nanoparticles is 0.5-5 mg/mL, the concentration of DNA substrate is 1-10 μM, and the concentration of aptazyme is 1-10 μM.

More preferably:

(1) Weigh 0.65g FeCl ₃ and 0.2g trisodium citrate and dissolve in 20mL ethylene glycol, add 1.2g sodium acetate, stir the mixture for 30min by magnetic force, add it into the reaction kettle, and react at 200°C for 10h; Washing with ethanol and water successively after magnetic separation to obtain Fe ₃ O ₄ nanoparticles;

(2) Add 1mL 0.1% trisodium citrate aqueous solution to boiling 50mL 0.01% HAuCl ₄ aqueous solution, and continue to boil for 15min to obtain Au nanoparticles;

(3) Adding 1% of the total reaction volume of APTES to modify 1 mg/mL Fe ₃ O ₄ nanoparticles by amination, the product was mixed with Au nanoparticles, magnetically separated and washed with water to obtain Au@Fe ₃ O ₄ nanoparticles.

(4) Mix 1mg/mL Au@Fe ₃ O ₄ nanoparticle aqueous solution with 1μM DNA substrate, react at 37°C for 24h, wash with water after magnetic separation to obtain Au@Fe ₃ O ₄ -substrate solution; then mix with 1μM aptazyme , react overnight at 37°C to obtain the magnetic probe Au@Fe ₃ O ₄ -substrate-aptazyme solution.

In the preparation method of the electrochemiluminescent sensor system for measuring adenosine triphosphate according to the present invention, the RuSiO ₂ -CS is obtained by mixing the RuSiO ₂ aqueous solution and the CS solution, and thoroughly mixing; the RuSiO ₂ is Triton X-100, ring Add Ru(bpy) ₃ Cl ₂ aqueous solution to the mixture of hexane and n-hexanol, mix well, add TEOS and ammonia water, stir for reaction; add acetone, then centrifuge, wash and precipitate to obtain RuSiO ₂ .

The _RuSiO2 is prepared as follows:

Add Ru(bpy) ₃ Cl ₂ aqueous solution to the mixture of Triton X-100, cyclohexane and n-hexanol, mix well, add TEOS and ammonia water, stir and react for 12-36 hours; add acetone and centrifuge, precipitate with ethanol and water in sequence to obtain RuSiO ₂ .

Preferably, measure 1-3mL Triton X-100, 5-10mL cyclohexane, and 1-3mL n-hexanol into the reaction vessel. After mixing thoroughly, add 250-500μL of 5-100mM Ru(bpy) to the mixture ₃ Cl ₂ aqueous solution, after mixing, add 50-200 μL TEOS and 30-200 μL ammonia water, stir and react for 12-36 hours; add 1-10 mL acetone, then centrifuge, wash the precipitate with ethanol and water in sequence, and resuspend the product in ethanol to obtain 1~8mg/mL RuSiO ₂ solution.

The RuSiO ₂ -CS solution was prepared as follows:

Add CS to acetic acid aqueous solution and ultrasonically dissolve to obtain a CS solution; take an equal volume of RuSiO ₂ solution and mix it with the CS solution, sonicate for 10-50 minutes and mix thoroughly to obtain a RuSiO ₂ -CS solution.

Preferably, take 0.1~2mg CS and add 0.1mL~2mL acetic acid aqueous solution with a volume fraction of 0.5%-3%, and ultrasonically disperse for 5~30min to obtain CS solution; take 0.1~2mL 1~8mg/mL RuSiO ₂ solution and add it to 0.1 ~2mL CS solution, ultrasonic treatment for 10~60min to obtain a uniformly dispersed RuSiO ₂ -CS solution.

The preparation process of the electrochemical luminescence sensor is as follows:

(1) After polishing the working electrode, ultrasonically clean it;

(2) Take the RuSiO ₂ -CS solution and add it dropwise to the surface of the above-mentioned working electrode, let it stand and dry at room temperature, wash and dry;

(3) Add glutaraldehyde aqueous solution dropwise to the above-mentioned electrode surface, wash and dry after room temperature reaction; add Capture DNA dropwise to the electrode surface, wash and dry after reaction;

(4) Add Blocker dropwise to the surface of the above electrodes, wash and dry after room temperature reaction;

Preferably, the working electrode is a glassy carbon electrode.

As preferably, the preparation method of the electrochemiluminescence sensor is prepared according to the following steps:

(1) After polishing the working electrode with 0.3 μm and 0.05 μm Al ₂ O ₃ powder in sequence, perform ultrasonic cleaning with water, ethanol, and water for 2 to 10 minutes;

(2) Add 2-20 μL of 1-8 mg/mL RuSiO ₂ -CS solution dropwise to the surface of the above-mentioned working electrode, let it dry at room temperature, wash it with PBS solution, and dry it in the air;

(3) Add 0.5-5% glutaraldehyde aqueous solution dropwise to the surface of the above electrode, react at room temperature for 1-3 hours, wash with PBS solution, and dry in the air; add 2-20 μL of 1-10 μM Capture DNA dropwise to the electrode surface, React at 37°C for 1-3 hours, wash with PBS solution, and dry in the air;

(4) Add 2-20 μL of 1-10 μM Blocker dropwise to the surface of the above electrode, react at room temperature for 1-3 hours, wash with PBS solution, and dry in the air;

More preferably,

(1) After polishing the working electrode with 0.3 μm and 0.05 μm Al ₂ O ₃ powder in sequence, perform ultrasonic cleaning with water, ethanol, and water for 4 minutes;

(2) Take 10 μL of 2mg/mL RuSiO ₂ -CS solution and add it dropwise to the surface of the above-mentioned working electrode, let it dry at room temperature, wash it with PBS solution, and dry it in the air;

(3) Add 2.5% glutaraldehyde aqueous solution to the surface of the above electrode dropwise, react at room temperature for 2 h, wash with PBS solution, and dry in the air; add 10 μL of 4 μM Capture DNA dropwise to the electrode surface, react at 37 °C for 2 h, and use Wash with PBS solution and dry;

(4) Add 2-20 μL of 1-10 μM Blocker dropwise to the surface of the above electrode, react at room temperature for 1-3 hours, wash with PBS solution, and dry in the air;

Wherein, the Blocker sequence is NH ₂ -TTTTTTTT.

Application of the electrochemiluminescent sensor system for measuring adenosine triphosphate of the present invention in the preparation of tools or reagents for quantitative detection of adenosine triphosphate.

The described quantitative detection of adenosine triphosphate, its detection operation steps are as follows:

(1) Mix the adenosine triphosphate solution with the magnetic probe Au@Fe ₃ O ₄ -substrate-aptazyme and continue to react for a period of time, and use magnetic adsorption to separate the binding complex of the adenosine triphosphate and the magnetic probe;

(2) Resuspend the above complex with enzyme digestion buffer, activate the enzyme digestion reaction at a specific temperature (37°C), generate a large amount of Trigger DNA, and remove the magnetic probe by magnetic adsorption to obtain a supernatant solution containing Trigger DNA ;

(3) Mix an equal volume of the above solution with hairpin-Fc and drop it on the surface of the electrochemiluminescence sensor. After a period of reaction, test the electrochemiluminescence signal of the sensor, and calculate the corresponding ATP concentration by the attenuation value of the electrochemiluminescence signal .

Specifically, the sensor was placed in 0.01M PBS solution containing 25mM triethylamine for CV test, the potential range was 0-1.3V, and the rate was 0.1V/s. Synchronously record the ECL luminescent signal, and the photomultiplier voltage (PMT) is 800V. Calculate the attenuation value of the ECL signal, and calculate the corresponding concentration of adenosine triphosphate according to the standard curve.

Wherein, the hairpin-Fc sequence is TCGTAGCAATACCAGGAGGCTACGATGACTCACTCCTGGTATT-Fc, and the above sequence is shown in SEQ ID NO.5.

As a preference,

(1) Mix the ATP solution to be detected with the Au@Fe ₃ O ₄ -substrate-aptazyme probe, react at 37°C for 0.5-3 hours, and then magnetically separate;

(2) Resuspend the magnetic probe adsorbed to adenosine triphosphate in step (1) with an enzyme digestion buffer (20 mM HEPES buffer containing 100 mM NaCl and 20 mM MgCl ₂ ), react at 37° C. for 2 h, and magnetically separate;

(3) Mix the supernatant and hairpin-Fc solution in equal volumes, take 5-50 μL of the mixed solution and drop it on the surface of the electrode, react at 37°C for 0.5-3 hours, wash with PBS solution, and dry in the air;

(4) Test the ECL light signal of the sensor.

More preferably,

(1) Take 100 μL of the ATP solution to be detected, mix it with 100 μL of Au@Fe ₃ O ₄ -substrate-aptazyme probe, react at 37°C for 2 hours, and then magnetically separate;

(2) Resuspend the ATP-adsorbed magnetic probe in step (1) with 20 μL of enzyme digestion buffer (20 mM HEPES buffer containing 100 mM NaCl and 20 mM MgCl ₂ ), react at 37° C. for 2 h, and magnetically separate;

(3) Mix the supernatant with 2 μM hairpin-Fc solution in equal volume, take 10 μL of the mixed solution and drop it on the surface of the electrode, react at 37 °C for 2 h, wash with PBS solution, and dry in the air;

(4) Test the ECL light signal of the sensor.

The pH of PBS used for washing in the present invention is 7.4.

The electrochemiluminescence sensor system for measuring adenosine triphosphate described in the present invention has the detection principle as follows: the magnetic probe Au@Fe3O4-substrate-aptazyme is used for the specific capture of adenosine triphosphate molecules, and at the same time starts the thermostatic enzyme amplification reaction of aptazyme to generate a large amount of Trigger DNA; Under the catalysis of Trigger DNA, hairpin-Fc is complementary to the Capture DNA modified on the sensor surface RuSiO2-CS, thereby immobilizing a large amount of hairpin-Fc on the electrode surface; because Fc can dose-dependently inhibit RuSiO2-CS The electrochemiluminescence signal, so the concentration of adenosine triphosphate has a linear relationship with the attenuation value of the electrochemiluminescence signal. Based on this principle, the electrochemical luminescence sensor system of the present invention realizes the quantitative detection of adenosine triphosphate.

The abbreviation of technical term among the present invention is as follows:

Adenosine triphosphate: ATP; terpyridine ruthenium chloride doped silica microspheres: RuSiO ₂ ; chitosan: CS; Si(OC ₂ H ₅ ) ₄ :TEOS; H ₂ NCH ₂ CH ₂ CH ₂ Si(OC ₂ H ₅ ) ₃ : APTES; Ferrocene: Fc.

Nucleic acid sequences such as Trigger DNA, Capture DNA, DNA substrate, aptazyme, Blocker, hairpin-Fc involved in the present invention were synthesized by Shanghai Sangon Bioengineering (Shanghai) Co., Ltd. All other raw material reagents in the present invention are commercially available. ATP, TEOS, APTES, HAuCl ₄ , and chitosan were purchased from Sigma Company in the United States, and the rest of the chemical reagents were of domestic analytical grade and were purchased from Shanghai Sinopharm Chemical Reagent Co., Ltd.

In the physiological activities of living organisms, adenosine triphosphate is often in a matrix with relatively complex components, which will cause false positive results to a certain extent in the actual detection process. Improving the sensitivity of biological analysis methods is a way to effectively reduce the matrix effect, so the present invention attempts to use nucleic acid constant temperature amplification technology for signal amplification to enhance the sensitivity of the analysis method. At the same time, magnetic separation technology is currently an effective means to purify target analytes from complex matrices and effectively eliminate sample matrix effects. Therefore, the present invention attempts to effectively combine two nucleic acid constant temperature amplification methods with magnetic separation technology, and utilizes the high-sensitivity characteristics of the electrochemiluminescence platform to design and prepare an electrochemiluminescence sensor system for the determination of adenosine triphosphate.

According to the specificity of the target, the present invention designs a sensor system with a novel dual signal amplification strategy. Starting from the signal amplification angle of the material, we synthesized RuSiO ₂ nanoparticles with silicon dioxide-wrapped terpyridine ruthenium chloride molecules, and combined it with the above-mentioned signal amplification strategy to obtain a new and excellent performance of electrochemical cells with multiple signal amplification capabilities. Luminescence sensor. During the detection process, the aptamerase specifically binds to adenosine triphosphate and cleaves the substrate probe in the sensor system to obtain a large amount of Trigger DNA, which triggers the catalytic hairpin self-assembly reaction on the electrode surface to generate Capture DNA-Hairpin-Fc double Strand DNA, and then complete the detection of sensor luminescence signal value on the electrochemiluminescence test instrument. Since Fc can effectively quench the electrochemiluminescent signal of RuSiO ₂ , the ultrasensitive detection of adenosine triphosphate can be realized by the signal attenuation value before and after the test. In addition, the sensor system of the present invention successfully realizes the quantitative detection of adenosine triphosphate in human serum, and the detection method has the advantages of good specificity, high sensitivity, wide linear range and low cost.

Beneficial effect: compared with the prior art, the present invention has the following advantages:

(1) The electrochemiluminescence sensor system of the present invention is applied to the detection of adenosine triphosphate in serum and bacterial cells, which does not require complex processing of samples in conventional detection methods, and avoids the problems of high cost and cumbersome operation of conventional detection methods such as HPLC .

(2) Compared with the existing commercial adenosine triphosphate detection kit and the reported electrochemiluminescence sensor system, the electrochemiluminescence sensor system of the present invention has higher sensitivity.

(3) Compared with other electrochemiluminescence sensors, the electrochemiluminescence sensor system of the present invention has applied multiple signal amplification strategies, and has the advantages of high sensitivity and high specificity; meanwhile, the present invention utilizes magnetic separation technology to effectively reduce the actual detection process false positive results in .

(4) The invention successfully prepared the high-efficiency luminescent material RuSiO ₂ , and successfully combined with signal amplification strategies such as aptamerase and catalytic hairpin self-assembly, which has certain guiding significance and theory for the development of multiple signal amplification strategies in the field of biosensing , Practical value.

(5) The present invention designs an electrochemiluminescence sensor system based on multiple signal amplification strategies for the ATP specificity of the target analyte. The sensor system of the present invention successfully realizes the quantitative detection of adenosine triphosphate in human serum, and has good specificity, High sensitivity, wide linear range, and low cost, easy to use and other advantages.

Description of drawings

Fig. 1 is the schematic diagram of the design and preparation of the electrochemiluminescence sensor of the present invention;

Fig. 2 is the cyclic voltammogram of the electrochemiluminescence sensor of the present invention;

3 is a schematic diagram of the relationship between the incubation time of the enzyme-cleaved product and the ECL intensity of the electrochemiluminescence sensor system of the present invention;

Fig. 4 is a linear relationship diagram between the ECL intensity and the logarithm of the antigen concentration of the electrochemiluminescence sensor system of the present invention;

Figure 5 is a selectivity investigation diagram of the electrochemiluminescence sensor system of the present invention;

Fig. 6 is a schematic diagram of the feasibility of using the electrochemiluminescence sensor system of the present invention for the quantitative detection of ATP in human serum.

Detailed ways

The present invention can be better understood from the following examples. However, those skilled in the art can easily understand that the content described in the embodiments is only for illustrating the present invention, and should not and will not limit the present invention described in the claims.

Example 1

Preparation of Au@Fe ₃ O ₄ -substrate-aptazyme probe

(1) Preparation of Fe ₃ O ₄ nanoparticles

Weigh 0.65g FeCl ₃ and 0.2g trisodium citrate into a beaker filled with 20mL ethylene glycol, stir well until completely dissolved, add 1.2g sodium acetate to it, carry out magnetic stirring for 30min, add the above mixed solution to the reaction In the kettle, react at 200°C for 10 h; after magnetic separation, the precipitate is washed with ethanol and water three times respectively to obtain Fe ₃ O ₄ nanoparticles.

(2) Preparation of Au nanoparticles

Prepare 50 mL of 0.01% HAuCl ₄ aqueous solution in a round bottom flask, heat it to boiling, add 1 mL of 0.1% trisodium citrate aqueous solution to the solution, continue heating and boiling for 15 minutes, and cool the sample to room temperature to obtain Au nanoparticles solution.

(3) Preparation of Au@Fe ₃ O ₄ nanoparticles

Weigh 10 mg of Fe ₃ O ₄ nanoparticles and add them to 10 mL of ethanol solution, stir well to disperse them fully, add 100 uL APTES solution to the solution, react at room temperature for 10 h, and obtain amination-modified Fe ₃ O ₄ nanoparticles. Take 1 mL of aminated Fe ₃ O ₄ solution, add 10 mL of Au nanoparticle solution to it, and place it on a horizontal shaker at room temperature to react overnight. The solid product is washed three times with ethanol and water respectively to obtain Au@Fe ₃ O ₄ nanoparticles.

(4) Preparation of Au@Fe ₃ O ₄ -substrate-aptazyme probe

Take 1mL of 1mg/mL Au@Fe ₃ O ₄ nanoparticle aqueous solution and 400uL of 1μM DNA substrate solution and mix well, react at 37°C for 24h, after magnetic separation, the solid complex is washed with water three times, and washed with 1mL of PBS buffer (Ph7.4 ) to resuspend the product to obtain Au@Fe ₃ O ₄ -substrate solution. Then the above solution was mixed with 400 uL of 1 μM aptazyme, reacted overnight at 37°C, the solid product was magnetically separated, washed with water three times, and the Au@Fe ₃ O ₄ -substrate-aptazyme probe was obtained.

Example 2

RuSiO ₂ -CS solution was prepared as follows:

Measure 2mL Triton X-100, 8mL cyclohexane, 2mL n-hexanol into the reaction vessel, mix well, add 350μL 40mM Ru(bpy) ₃ Cl ₂ aqueous solution to the mixture, mix well, add 150μL TEOS and 100μL Ammonia, stirred for 24 hours; centrifuged after adding 5mL of acetone, the precipitate was washed with ethanol and water in sequence, and the product was resuspended in ethanol to obtain a 4mg/mL RuSiO ₂ solution.

Add 1mg CS to 1mL 2% acetic acid aqueous solution, ultrasonically disperse for 20min to obtain a CS solution; take 1mL 4mg/mL RuSiO ₂ aqueous solution to 1mL CS solution, and ultrasonicate for 30min to obtain a uniformly dispersed RuSiO ₂ -CS solution.

Example 3

Preparation method of electrochemiluminescent sensor for measuring Trigger DNA

The preparation method of the electrochemiluminescent sensor is shown in Figure 1, comprising the following steps:

(1) Electrode pretreatment: After polishing the working electrode with 0.3 μm and 0.05 μm Al ₂ O ₃ powder in sequence, perform ultrasonic cleaning with water, ethanol, and water for 4 minutes;

(2) Modification of RuSiO ₂ : Take 10 μL of 2 mg/mL RuSiO ₂ -CS solution (Example 2) and drop it on the surface of the above-mentioned working electrode, leave it to dry at room temperature, wash it with PBS solution, and dry it in the air;

(3) Covalently linking Capture DNA: dropwise add 2.5% glutaraldehyde aqueous solution to the surface of the electrode, react at room temperature for 2 h, wash with PBS solution, and dry in the air; add 10 μL of 4 μM Capture DNA dropwise to the electrode surface, 37 React at ℃ for 2 hours, wash with PBS solution, and dry in the air;

(4) Blocking: Add 10 μL of 4 μM Blocker dropwise to the surface of the above electrode, react at room temperature for 2 hours, wash with PBS solution, and dry in the air.

Example 4

Cyclic Voltammetry Monitoring of the Assembly Process of Electrochemical Sensors

In order to explore the successful preparation of the electrochemiluminescence sensor, cyclic voltammetry scanning was performed to record the signal response analysis of the sensor at each modification stage, and the glassy carbon electrode (working electrode) obtained in each step in Example 3 was placed in a solution containing 2mM K ₃ [Fe (CN) ₆ ] in 0.01M PBS solution to carry out cyclic voltammetry scanning at the speed of 0.1V/s, the results are shown in Figure 2. When RuSiO ₂ -CS is modified on the surface of the electrode, the peak current value of the CV curve decreases compared with that of the bare electrode due to the increase of resistance. After the Capture DNA modification step, the current value decreased significantly, indicating that a large amount of Capture DNA was modified on the electrode surface, which was conducive to the smooth progress of the subsequent antigen detection step. Subsequently, each time the working electrode undergoes a modification, the current has a small decrease, which is caused by the steric hindrance effect and electronegativity produced by the binding of DNA on the electrode surface. This example illustrates the use of electrochemical methods to monitor the sensor assembly process, indicating that the corresponding materials and DNA are successfully modified to the electrode surface during the sensor preparation process.

Example 5

Detection process of electrochemiluminescence sensor system for determination of adenosine triphosphate

(1) Take 100 μL of the ATP solution to be detected, mix it with 100 μL of Au@Fe ₃ O ₄ -substrate-aptazyme probe, react at 37°C for 2 hours, and then magnetically separate;

(2) Resuspend the ATP-adsorbed magnetic probe in step (1) with 20 μL of enzyme digestion buffer (20 mM HEPES buffer containing 100 mM NaCl and 20 mM MgCl ₂ ), react at 37° C. for 2 h, and magnetically separate;

(3) Mix the supernatant containing Trigger DNA and 2 μM hairpin-Fc solution in equal volumes, take 10 μL of the mixed solution and drop it on the electrode surface, react at 37 ° C for 2 h, wash with PBS solution, and dry in the air;

(4) Test the ECL luminescence signal of the sensor: the sensor is placed in 0.01M PBS (pH7.4) solution containing 25mM triethylamine for CV test, the potential range is 0-1.3V, the rate is 0.1V/s, and the ECL luminescence is recorded simultaneously Signal, the photomultiplier high voltage (PMT) is 800V, the attenuation value of the ECL signal is calculated, and the corresponding concentration of adenosine triphosphate is calculated according to the standard curve.

Example 6

Optimization of incubation time for an electrochemiluminescence sensor system for the determination of adenosine triphosphate

To explore the influence of the incubation time of Trigger and Hairpi-Fc on the electrode surface on the ECL signal intensity. The detection process of the electrochemiluminescent sensor system is the same as in Example 5, the ATP concentration is 100pM and the mixture of the supernatant containing Trigger DNA and Hairpin-Fc in step (3) is selected for 30min, 60min, 90min, 120min on the electrode surface for incubation time , 150min and other 5 different times to carry out this experiment. The results are shown in Figure 3. When the reaction time is less than or equal to 90 min, the ΔECL signal intensity increases sharply with time, and reaches the maximum value at 90 min. Therefore, the electrochemiluminescence sensor system of the present invention selects 90 min as the incubation time.

Example 7

An Electrochemiluminescent Sensor System for Determining the Linear Relationship Between ΔECL Intensity and Antigen Concentration for Adenosine Triphosphate

The detection process of the electrochemiluminescence sensor system is the same as that in Example 5. Prepare adenosine triphosphate standard solutions of different concentrations, respectively 0.1pM, 1pM, 10pM, 100pM, 1000pM, set up 3 parallel experimental groups for each concentration, and adopt the detection method in Example 5.

The logarithmic value of the obtained ΔECL signal intensity and the antigen concentration was analyzed linearly, and the results are shown in FIG. 4 . With the increase of ATP concentration, the signal intensity of ΔECL gradually increased and showed a linear relationship. The lowest detection limit of the sensor is 0.054pM, and compared with the existing commercialized ATP detection kit (chemiluminescent method, the lowest detection limit is 0.1nM), the present invention has higher sensitivity.

Example 8

Specificity Analysis of Target Detection by Electrochemiluminescent Sensor System for Determination of Adenosine Triphosphate

Investigate whether the electrochemiluminescence sensor system of the present invention has a non-specific response to the structural analogue of the target analyte. The detection process of the electrochemiluminescence sensor system is the same as that in Example 5, except that step (1) uses different antigens: UTP, GTP, and CTP replaced ATP, and the results are shown in Figure 5. At the same concentration of 1000pM, the sensor can effectively distinguish ATP, and in the presence of structural analogues, the response signal of the sensor has no significant change compared with the control group, indicating that the sensor designed in the present invention has good specificity.

Example 9

Quantitative detection of ATP in human serum applied to the electrochemiluminescence sensor system of the present invention

In order to investigate the feasibility of the electrochemiluminescence sensor system of the present invention for the quantitative detection of ATP in human serum, the detection process of the electrochemiluminescence sensor system is the same as in Example 5, and the preparation method of the ATP solution to be detected used in step (1) is as follows: : Weigh different amounts of ATP and dissolve in 10% human serum solution (solvent: 0.01M PBS, pH 7.4) to final concentrations of 0.1pM, 1pM, 10pM, 100pM, 1000pM. The results are shown in Figure 6, and the detection results show that the recovery rate of the electrochemiluminescent sensor system of the present invention for detecting ATP in human serum is distributed at 95.68%-103.4%, and the relative standard deviation between different control groups is distributed at 1.881% -5.689%, indicating that the test data of the sensor system is stable and reliable, and can be used for the quantitative detection of ATP in human serum.

Example 10

The preparation of the Au@Fe3O4-substrate-aptazyme probe in this implementation is the same as the preparation method in Example 1, the difference is that: the amount of APTES added in step (3) is 10% of the volume of the reaction solution; Fe ₃ O ₄ nanoparticles The concentration of Au@Fe3O4 nanoparticles in step (4) is 5 mg/mL, the concentration of DNA substrate is 10 μM, and the concentration of aptazyme is 10 μM.

The RuSiO ₂ -CS solution was prepared as in Example 2, except that 1 mL of Triton X-100, 5 mL of cyclohexane, and 1 mL of n-hexanol were added to the reaction vessel, and after thorough mixing, 250 μL of 5 mM Ru(bpy) ₃ Cl ₂ aqueous solution, after mixing, add 50 μL TEOS and 30 μL ammonia water, stir and react for 12 hours; add 1 mL of acetone and centrifuge, wash the precipitate with ethanol and water in sequence, and resuspend the product in ethanol to obtain 1 mg/mL RuSiO ₂ solutions.

Add 0.1mg CS to 0.1mL acetic acid aqueous solution with a volume fraction of 0.5%, ultrasonically disperse for 5min to obtain a CS solution; take 0.1mL 1mg/mL RuSiO ₂ aqueous solution to 0.1mL CS solution, and ultrasonically treat for 10min to obtain uniformly dispersed RuSiO ₂ -CS solution.

The preparation of the electrochemiluminescence sensor is the same as that in Example 2, the difference is: (1) Electrode pretreatment: After polishing the working electrode with 0.3 μm and 0.05 μm Al ₂ O ₃ powders in sequence, conduct ultrasonication with water, ethanol, and water in sequence Wash for 2 minutes;

(2) Modification of RuSiO ₂ : 2 μL of 1 mg/mL RuSiO ₂ -CS solution was added dropwise to the surface of the above working electrode, left to dry at room temperature, washed with PBS solution, and dried in the air;

(3) Covalently link Capture DNA: dropwise add 0.5% glutaraldehyde aqueous solution to the surface of the above electrode, react at room temperature for 1 h, wash with PBS solution, and dry in the air; add 2 μL of 1 μM Capture DNA dropwise to the electrode surface, 37 React at ℃ for 1 hour, wash with PBS solution, and dry in the air;

(4) Blocking: Add 2 μL of 1 μM Blocker dropwise to the surface of the above electrode, react at room temperature for 1 hour, wash with PBS solution, and dry in the air.

Example 11

The preparation method of embodiment 10 is the same as that of embodiment 1, and the difference is that: the APTES addition amount described in step (3) is 5% of the reaction solution volume; Fe ₃ O ₄ The concentration of nanoparticles is 0.5mg/mL; step (4) ) The concentration of the Au@Fe3O4 nanoparticles is 0.5 mg/mL, the concentration of the DNA substrate is 5 μM, and the concentration of the aptazyme is 5 μM.

The RuSiO ₂ -CS solution was prepared as in Example 2, except that 3 mL of Triton X-100, 10 mL of cyclohexane, and 3 mL of n-hexanol were added to the reaction vessel, and after thorough mixing, 500 μL of 100 mM Ru(bpy) ₃ Cl ₂ aqueous solution, after mixing, add 200μL TEOS and 200μL ammonia water, stir and react for 36h; add 10mL acetone, centrifuge, wash the precipitate with ethanol and water in sequence, and resuspend the product in ethanol to obtain 8mg/mL RuSiO ₂ solutions.

Add 2mg CS to 2mL 3% acetic acid aqueous solution, ultrasonically disperse for 5min to obtain a CS solution; add 2mL 8mg/mL RuSiO ₂ aqueous solution to 2mL CS solution, and ultrasonicate for 60min to obtain a uniformly dispersed RuSiO ₂ -CS solution.

The preparation of the electrochemiluminescence sensor is the same as that in Example 2, the difference is: (1) Electrode pretreatment: After polishing the working electrode with 0.3 μm and 0.05 μm Al ₂ O ₃ powders in sequence, conduct ultrasonication with water, ethanol, and water in sequence Wash for 10 minutes;

(2) Modification of RuSiO ₂ : Take 20 μL of 8 mg/mL RuSiO ₂ -CS solution and add it dropwise to the surface of the above-mentioned working electrode, leave it to dry at room temperature, wash it with PBS solution, and dry it in the air;

(3) Covalently link Capture DNA: dropwise add 5% glutaraldehyde aqueous solution to the surface of the electrode, react at room temperature for 3 hours, wash with PBS solution, and dry; add 20 μL of 10 μM Capture DNA dropwise to the electrode surface, 37 React at ℃ for 3 hours, wash with PBS solution, and dry in the air;

(4) Blocking: Add 20 μL of 10 μM Blocker dropwise to the surface of the above electrode, react at room temperature for 3 hours, wash with PBS solution, and dry in the air.

Sequence Listing

<110> Southeast University

<120> An electrochemiluminescent sensor system for measuring adenosine triphosphate, its preparation method and application

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aaaaaaaaaa ttcaccaact atragctacg atgactcacc taggag 46

<210> 2

<211> 60

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tcatcgtaga gcgatctagg gggagtattg cggaggatag cacccatgtt agttggtgaa 60

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gctacgatga ctcacctagg ag 22

<210> 4

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctcctaggtg agtcatcgta gcctcctggt attgctacga tgactca 47

<210> 5

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctcctaggtg agtcatcgta gcctcctggt attgctacga tgactca 47

Claims (6)

1. An electrochemiluminescence sensor system for measuring adenosine triphosphate, characterized in that the system consists of a magnetic probe Au@Fe ₃ O ₄ -substrate-aptazyme that amplifies the concentration signal of adenosine triphosphate, an electrochemiluminescence sensor for measuring Trigger DNA, and a hairpin -Fc composition; the magnetic probe Au@Fe ₃ O ₄ -substrate-aptazyme is sequentially compounded by Fe ₃ O ₄ nanoparticles, gold nanoparticles, DNA substrate and aptazyme; the electrochemiluminescent sensor for determining Trigger DNA Obtained by linking amino-modified Capture DNA to the surface of the modified RuSiO ₂ -CS working electrode through glutaraldehyde cross-linking; The hairpin-Fc sequence is TCGTAGCAATACCAGGAGGCTACGATGACTCACTCCTGGTATT-Fc; The DNA substrate sequence is SH-AAAAAAAAAAATTCACCAACTTrAGCTACGATGACTCACCTAGGAG; the aptazyme sequence is "TCATCGTAGAGCGAT CTAGGGGGAGTATTGCGGAGGATAGCACCCATGTTAGTTGGTGAA; the amino-modified Capture DNA sequence is NH ₂ -CTCCTAGGTGAGTCATCGTAGCCTCCTGGTATTG CTACGATGACTCA; The preparation steps of the magnetic probe Au@Fe ₃ O ₄ -substrate-aptazyme are as follows: (1) Weigh FeCl ₃ and trisodium citrate and dissolve them in ethylene glycol, add sodium acetate, add the stirred mixture into the reaction kettle, precipitate and wash after reaction, and obtain Fe ₃ O ₄ nanoparticles; (2) Add trisodium citrate aqueous solution to HAuCl ₄ aqueous solution, and continue to boil to obtain Au nanoparticles; (3) Amination modification of Fe ₃ O ₄ nanoparticles was carried out with APTES, the product was mixed with Au nanoparticles, washed after magnetic separation, and Au@Fe ₃ O ₄ nanoparticles were obtained; (4) After Au@Fe ₃ O ₄ nanoparticles are mixed with DNA substrate, after the reaction, they are magnetically separated and washed with water to obtain Au@Fe ₃ O ₄ -substrate solution; then mixed with aptazyme and reacted overnight to obtain Au@Fe ₃ O _{4 -} substrate-aptazyme probe; The preparation process of the electrochemiluminescent sensor for measuring Trigger DNA is as follows: (1) After polishing the working electrode, ultrasonically clean it; (2) Take the RuSiO ₂ -CS solution and add it dropwise to the surface of the above-mentioned working electrode, let it stand and dry at room temperature, wash and dry; (3) Add glutaraldehyde aqueous solution dropwise to the surface of the above electrode, wash and dry after reaction at room temperature; add Capture DNA dropwise to the surface of the electrode, wash and dry after reaction; (4) Add Blocker dropwise to the surface of the above electrode, react at room temperature and then wash and dry to obtain an electrochemiluminescent sensor for detecting Trigger DNA. 2. the electrochemiluminescent sensor system of measuring adenosine triphosphate according to claim 1, is characterized in that, described Trigger DNA sequence is GCTACGATGACTCACCTAGGAG. 3. The electrochemiluminescent sensor _system for measuring adenosine triphosphate according to claim 1, wherein said RuSiO ₂ -CS is obtained by mixing RuSiO ₂ solution with CS solution; , cyclohexane, and n-hexanol mixture, add Ru(bpy) ₃ Cl ₂ aqueous solution, mix well, add TEOS and ammonia water, stir for reaction; add acetone, then centrifuge, wash and precipitate to obtain RuSiO ₂ . 4. The electrochemiluminescent sensor system for determining adenosine triphosphate according to claim 1, wherein the amount of APTES added in the step (3) of the preparation step of the magnetic probe Au@Fe ₃ O ₄ -substrate-aptazyme is the reaction solution _The concentration of Au@Fe ₃ O ₄ nanoparticles in step (4) is 0.5-5 mg/mL, and _the concentration of the DNA substrate is 1 ~10 μM, the concentration of aptazyme is 1~10 μM. 5. an application of the electrochemiluminescent sensor system for measuring adenosine triphosphate as claimed in claim 1 in the quantitative detection of adenosine triphosphate, said application comprises the steps of detecting adenosine triphosphate as follows: (1) Mix the adenosine triphosphate solution with the magnetic probe Au@Fe ₃ O ₄ -substrate-aptazyme and continue to react, and use magnetic adsorption to separate the binding complex between the adenosine triphosphate and the magnetic probe; (2) Resuspend the above complex with enzyme digestion buffer, activate the enzyme digestion reaction, generate a large amount of Trigger DNA, and remove the magnetic probe by magnetic adsorption to obtain a supernatant solution containing Trigger DNA; (3) Mix an equal volume of the above solution with hairpin-Fc and drop it on the surface of the electrochemiluminescence sensor. After a period of reaction, test the electrochemiluminescence signal of the sensor, and calculate the corresponding ATP concentration by the attenuation value of the electrochemiluminescence signal . 6. The application according to claim 5, characterized in that, the application is that the magnetic probe Au@Fe ₃ O ₄ -substrate-aptazyme is used for the specific capture of adenosine triphosphate molecules, and at the same time starts the constant temperature enzyme amplification reaction of aptazyme, A large amount of Trigger DNA is generated; under the catalysis of Trigger DNA, hairpin-Fc is complementary to the Capture DNA modified on the sensor surface RuSiO ₂ -CS, thereby immobilizing a large amount of hairpin-Fc on the electrode surface; since Fc can dose-dependently The electrochemiluminescence signal of RuSiO ₂ -CS is suppressed, so the concentration of ATP is linearly related to the attenuation value of the electrochemiluminescence signal to realize the quantitative detection of ATP.

Images