CN111020006A - Electrochemical luminescence sensor system for measuring adenosine triphosphate, and preparation method and application thereof - Google Patents

Electrochemical luminescence sensor system for measuring adenosine triphosphate, and preparation method and application thereof Download PDF

Info

Publication number
CN111020006A
CN111020006A CN201911156060.1A CN201911156060A CN111020006A CN 111020006 A CN111020006 A CN 111020006A CN 201911156060 A CN201911156060 A CN 201911156060A CN 111020006 A CN111020006 A CN 111020006A
Authority
CN
China
Prior art keywords
dna
adenosine triphosphate
solution
substrate
rusio
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201911156060.1A
Other languages
Chinese (zh)
Other versions
CN111020006B (en
Inventor
沈艳飞
宁振强
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Southeast University
Original Assignee
Southeast University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Southeast University filed Critical Southeast University
Priority to CN201911156060.1A priority Critical patent/CN111020006B/en
Publication of CN111020006A publication Critical patent/CN111020006A/en
Application granted granted Critical
Publication of CN111020006B publication Critical patent/CN111020006B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/6825—Nucleic acid detection involving sensors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/682—Signal amplification
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
    • G01N21/76—Chemiluminescence; Bioluminescence
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G01N27/28—Electrolytic cell components
    • G01N27/30—Electrodes, e.g. test electrodes; Half-cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G01N27/416—Systems
    • G01N27/4163—Systems checking the operation of, or calibrating, the measuring apparatus

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Electrochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Plasma & Fusion (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an electrochemical luminescence sensor system for measuring adenosine triphosphate, a preparation method and application thereof, wherein the system consists of a magnetic probe for amplifying an adenosine triphosphate concentration signal and an electrochemical luminescence sensor for measuring Trigger DNA; the magnetic probe is made of Fe3O4The nano-particles, the gold nano-particles, the DNA substrate and the aptazyme are compounded in sequence; electrochemical luminescence sensor connects amino modified Capture DNA to modified RuSiO through glutaraldehyde crosslinking2The working electrode surface of CS. Phosphorus in the inventionThe adenosine monophosphate participates in a constant-temperature amplification reaction guided by a magnetic probe, and generates a large amount of intermediate Trigger DNA; then, the electrochemical luminescence sensor of the invention is used for carrying out quantitative detection on the Trigger DNA of the intermediate, and finally, the aim of indirectly and quantitatively detecting the adenosine triphosphate is achieved.

Description

Electrochemical luminescence sensor system for measuring adenosine triphosphate, and preparation method and application thereof
Technical Field
The invention belongs to the field of biomedical detection, and particularly relates to an electrochemiluminescence sensor system for measuring adenosine triphosphate, and a preparation method and application thereof.
Background
Adenosine Triphosphate (ATP) is a small molecule high-energy phosphate compound, and is also a main energy source in organic life bodies, so that energy supply of various vital activities of cells is guaranteed. As an "energy currency", it participates in many important physiological processes in living beings, such as: gene synthesis, nutrient metabolism, drug delivery, and regulation of immune and neural-mediated biological activities. Related researches show that the change of ATP content as an indicator of cell viability and cell damage of organic life bodies is closely related to the occurrence of diseases such as cardiovascular diseases, Parkinson's disease, Alzheimer's disease and the like. In addition, in the field of food safety, quantitative detection of ATP is also used for detection of food-borne pathogenic microorganisms. Therefore, the ATP quantitative detection method with high sensitivity and high specificity is established, and has intuitive and important effects on the fields of life science research, clinical diagnosis, food safety, environmental analysis and the like.
Various detection methods have been developed for the quantitative detection of ATP, such as: capillary electrophoresis, high performance liquid chromatography, mass spectrometry, chemiluminescence, etc. The detection method has the advantages of accuracy, high efficiency and the like, but also has the defects of complicated and time-consuming sample processing steps, low sensitivity, huge equipment, high cost and the like, and limits the wide application of the detection method in different fields to a certain extent. Therefore, in order to meet the research and application needs in various fields, it is urgently needed to develop a simple, rapid and high-sensitivity ATP quantitative detection method.
Electrochemiluminescence (ECL) is an electrochemically driven chemiluminescence phenomenon that has superior performance compared to other optical detection methods by intelligently integrating electrochemical and chemiluminescence technologies. The electrochemiluminescence does not need an additional light source, so that experimental equipment is simplified, background interference of magazines and scattering light sources is avoided, and the electrochemiluminescence has higher sensitivity. In addition, the electrochemiluminescence has the advantages of high specificity, simplicity in operation, good reproducibility and the like, attracts the attention of a plurality of researchers, is widely applied to the fields of food and medicine analysis, environmental monitoring and the like, and is one of the most potential platforms for realizing the quantitative detection of the advantageous ATP. In order to develop a sensor meeting the requirements of the current ATP quantitative detection, the invention integrates a DNA signal amplification strategy and the excellent luminescence effect of the nano material, thereby realizing a multiple signal amplification system and being successfully applied to the ATP quantitative detection.
Disclosure of Invention
The purpose of the invention is as follows: aiming at the defects of complexity, time consumption, low sensitivity, huge equipment, high cost and the like in the prior art, the invention provides an electrochemical luminescence sensor system for measuring adenosine triphosphate.
Another object of the present invention is to provide a method for preparing the ATP electrochemiluminescence sensor system.
It is another object of the invention to provide the use of such an adenosine triphosphate electrochemiluminescence sensor system. The invention provides a method for quantitatively detecting adenosine triphosphate in human serum by using the sensor system, and the detection method has the advantages of good specificity, high sensitivity, wide linear range and low cost.
The technical scheme is as follows: in order to achieve the above object, the present invention provides an electrochemiluminescence sensor system for measuring adenosine triphosphate, which comprises a magnetic probe Au @ Fe3O 4-substrate-aptamer enzyme for amplifying adenosine triphosphate concentration signal and an electrochemiluminescence sensor for measuring Trigger DNA; the magnetic probe Au @ Fe3O4-substrate-aptamer from Fe3O4The nano-particles, the gold nano-particles, the DNA substrate and the aptazyme are compounded in sequence; the electrochemiluminescence sensor for measuring Trigger DNA connects amino modified CaptureDNA to modified RuSiO through glutaraldehyde crosslinking2The working electrode surface of CS.
In the invention, adenosine triphosphate firstly participates in a constant-temperature amplification reaction guided by a magnetic probe, and generates a large amount of intermediate Trigger DNA; then, the electrochemical luminescence sensor of the invention is used for carrying out quantitative detection on the Trigger DNA of the intermediate, and finally, the aim of indirectly and quantitatively detecting the adenosine triphosphate is achieved.
Wherein the DNA substrate sequence is SH-AAAAAAAATTCACCAACTAATrAGCTACGATGACTCACCTAGGAG; the aptazyme sequence is "TCATCGTAGAGCGATCTAGGGGGAGTATTGCGGAGGATAGCACCCATGTTAGTTGGTGAA"; the Trigger DNA sequence is 'GCTACGATGACTCACCTAGGAG'; the amino modified Capture DNA sequence is' NH2-CTCCTAGGTGAGTCATCGTAGCCTCCTGGTATTGCTACGATGACTC A "; the sequences are respectively shown by SEQ ID NO. 1-4.
The intermediate Trigger DNA is a DNA fragment generated by the enzyme digestion of DNA substrate by aptazyme, and has the function of using a magnetic probe Au @ Fe3O4The substrate-aptamer mediated signal amplification strategy is organically linked to the sensor detection: after ATP is combined with the magnetic probe, the enzyme digestion activity of the aptazyme is started and specifically cuts a DNAssubstrate chain to finally generate Trigger DNA; because the concentration of the product Trigger DNA is in a direct proportion relation with the ATP concentration, the sensor can realize the quantitative detection of ATP by detecting the Trigger DNA.
The invention relates to a preparation method of an electrochemical luminescence sensor system for measuring adenosine triphosphate, which comprises the following steps:
magnetic probe Au @ Fe3O4Preparation of substrate-aptazyme
(1) Weighing FeCl3And dissolving trisodium citrate in ethylene glycol, adding sodium acetate, adding the stirred mixed solution into a reaction kettle, and cleaning the precipitate after reaction to obtain Fe3O4Nanoparticles;
(2) to HAuCl4Adding trisodium citrate aqueous solution into the aqueous solution, and continuously boiling to obtain Au nanoparticles;
(3) using APTES on Fe3O4Carrying out amination modification on the nano particles, mixing the product with Au nano particles, carrying out magnetic separation, and then cleaning to obtain Au @ Fe3O4Nanoparticles;
(4)Au@Fe3O4after mixing the nano particles and DNA substrate, carrying out magnetic separation after reaction, and then washing with water to obtain Au @ Fe3O4-substrate solution; then mixed with aptazymeSynthesizing and reacting overnight to obtain an Au @ Fe3O 4-substrate-aptamer probe;
preferably, the Au @ Fe3O4The preparation method of the substrate-aptamer probe comprises the following steps:
(1) weighing FeCl3Dissolving trisodium citrate in ethylene glycol, adding sodium acetate, magnetically stirring for 10-60 min, adding the mixed solution into a reaction kettle, and reacting for 6-16 h at 200 ℃; the precipitate is washed by ethanol and water in sequence after magnetic separation to obtain Fe3O4Nanoparticles;
(2) 0.01% (mass fraction) HAuCl to boiling4Adding 0.1% (mass fraction) trisodium citrate aqueous solution into the aqueous solution, and continuously boiling for 10-30 min to obtain Au nanoparticles;
(3) using APTES on Fe3O4Performing amination modification on the nano particles, mixing the product with Au nano particles, performing magnetic separation, and then washing with water to obtain Au @ Fe3O4Nanoparticles;
(4)Au@Fe3O4mixing the nano particles and DNA substrate, reacting at 37 ℃ for 12-36 h, magnetically separating, and washing with water to obtain Au @ Fe3O4-a substrate solution; then mixed with aptazyme and reacted at 37 ℃ overnight to obtain Au @ Fe3O4-a substrate-aptamer probe;
FeCl described in step (1)3The weight ratio of the trisodium citrate to the sodium acetate is as follows: 0.65:0.2:1.2.
HAuCl in the step (2)4And the volume ratio of the trisodium citrate aqueous solution is 50: 1.
The final concentration of the APTES in the step (3) is 1-10% (volume fraction) of the total reaction liquid volume, and Fe3O4The concentration of the nano particles is 0.5-5 mg/mL.
The Au @ Fe in the step (4)3O4The concentration of the nano particles is 0.5-5 mg/mL, the concentration of DNA substrate is 1-10 mu M, and the concentration of the aptazyme is 1-10 mu M.
More preferably:
(1) 0.65g FeCl was weighed3And 0.2g trisodium citrate dissolved in 20mL ethylene glycol, added1.2g of sodium acetate, magnetically stirring the mixture for 30min, adding the mixture into a reaction kettle, and reacting for 10h at 200 ℃; the precipitate is washed by ethanol and water in sequence after magnetic separation to obtain Fe3O4Nanoparticles;
(2) 50mL 0.01% HAuCl to boil4Adding 1mL of 0.1% trisodium citrate aqueous solution into the aqueous solution, and continuously boiling for 15min to obtain Au nanoparticles;
(3) adding APTES to 1mg/mL Fe in a total reaction volume of 1%3O4Performing amination modification on the nano particles, mixing the product with Au nano particles, performing magnetic separation, and then washing with water to obtain Au @ Fe3O4Nanoparticles.
(4)1mg/mL Au@Fe3O4Mixing the nano particle aqueous solution with 1 mu M DNA substrate, reacting at 37 ℃ for 24h, magnetically separating, and washing with water to obtain Au @ Fe3O4-a substrate solution; then mixed with 1 mu M of aptazyme to react at 37 ℃ overnight to obtain a magnetic probe Au @ Fe3O4Substrate-aptazyme solution.
The invention relates to a preparation method of an electrochemiluminescence sensor system for measuring adenosine triphosphate, and RuSiO2-CS is from RuSiO2Mixing the aqueous solution and the CS solution, and fully and uniformly mixing to obtain the compound; the RuSiO2Adding Ru (bpy) into a mixture of Triton X-100, cyclohexane and n-hexanol3Cl2Mixing the aqueous solution, adding TEOS and ammonia water, and stirring for reaction; adding acetone, centrifuging, cleaning and precipitating to obtain RuSiO2。
The RuSiO2The preparation method comprises the following steps:
adding Ru (bpy) into a mixture of Triton X-100, cyclohexane and n-hexanol3Cl2Uniformly mixing the aqueous solution, adding TEOS and ammonia water, and stirring and reacting for 12-36 h; adding acetone, centrifuging, sequentially cleaning precipitate with ethanol and water to obtain RuSiO2。
Preferably, 1-3 mL of Triton X-100, 5-10 mL of cyclohexane, 1-3 mL of hexanol are weighed and added into a reaction container, after the mixture is fully mixed, 250-500 μ L of 5-100mM Ru (bpy) is added into the mixed solution3Cl2Uniformly mixing the aqueous solution, adding 50-200 mu L TEOS and 30-200 mu L ammonia water, and stirring and reacting for 12-36 h; adding 1-10 mL of acetone, centrifuging, sequentially cleaning precipitates with ethanol and water, and re-suspending the product with ethanol to obtain 1-8 mg/mL RuSiO2And (3) solution.
The RuSiO2The CS solution was prepared as follows:
adding CS into an acetic acid aqueous solution and carrying out ultrasonic dissolution to obtain a CS solution; taking equal volume of RuSiO2Mixing the solution and the CS solution, and carrying out ultrasonic treatment for 10-50 min to obtain RuSiO2-a CS solution.
Preferably, 0.1-2 mg of CS is added into 0.1-2 mL of acetic acid aqueous solution with volume fraction of 0.5% -3%, and ultrasonic dispersion is carried out for 5-30 min to obtain CS solution; taking 0.1-2 mL of 1-8 mg/mL RuSiO2Adding the solution into 0.1-2 mL of CS solution, and carrying out ultrasonic treatment for 10-60 min to obtain uniformly dispersed RuSiO2-a CS solution.
The preparation process of the electrochemical luminescence sensor is as follows:
(1) polishing the working electrode, and then ultrasonically cleaning;
(2) taking RuSiO2Dripping a CS solution on the surface of the working electrode, standing and drying at room temperature, and cleaning and airing;
(3) dripping glutaraldehyde aqueous solution on the surface of the electrode, reacting at room temperature, and then cleaning and airing; dropwise adding the Capture DNA to the surface of an electrode, and cleaning and airing after reaction;
(4) dropwise adding Blocker on the surface of the electrode, reacting at room temperature, and then cleaning and drying;
preferably, the working electrode is a glassy carbon electrode.
Preferably, the preparation method of the electrochemical luminescence sensor comprises the following steps:
(1) the working electrode was successively treated with 0.3 μm and 0.05 μm Al2O3Polishing the powder, and then carrying out ultrasonic cleaning for 2-10 min by using water, ethanol and water in sequence;
(2) taking 2-20 mu L of 1-8 mg/mL RuSiO2Dropping CS solution on the surface of the working electrode, standing and drying at room temperature, and adding PBS solutionCleaning and drying;
(3) dropwise adding a glutaraldehyde aqueous solution with the mass fraction of 0.5-5% onto the surface of the electrode, reacting at room temperature for 1-3 h, cleaning with a PBS solution, and drying in the air; dripping 2-20 mu L of 1-10 mu M Capture DNA onto the surface of an electrode, reacting for 1-3 h at 37 ℃, cleaning with a PBS solution, and drying in the air;
(4) dropwise adding 2-20 mu L of 1-10 mu M of Blocker on the surface of the electrode, reacting for 1-3 h at room temperature, cleaning with a PBS solution, and drying;
more preferably still, the first and second liquid crystal compositions are,
(1) the working electrode was successively treated with 0.3 μm and 0.05 μm Al2O3Polishing the powder, and then ultrasonically cleaning for 4min by using water, ethanol and water in sequence;
(2) taking 10 mu L of 2mg/mL RuSiO2Dripping a CS solution on the surface of the working electrode, standing and drying at room temperature, washing with a PBS solution, and drying in the air;
(3) dripping 2.5 mass percent of glutaraldehyde aqueous solution on the surface of the electrode, reacting for 2 hours at room temperature, cleaning with PBS solution, and drying in the air; dripping 10 mu L of 4 mu M Capture DNA on the surface of an electrode, reacting for 2h at 37 ℃, washing with a PBS solution, and drying in the air;
(4) dropwise adding 2-20 mu L of 1-10 mu M of Blocker on the surface of the electrode, reacting for 1-3 h at room temperature, cleaning with a PBS solution, and drying;
wherein the Blocker sequence is NH2-TTTTTTTT。
The invention relates to an application of an electrochemiluminescence sensor system for measuring adenosine triphosphate in the preparation of a tool or a reagent for quantitatively detecting adenosine triphosphate.
The quantitative detection of the adenosine triphosphate comprises the following detection operation steps:
(1) mixing adenosine triphosphate solution with a magnetic probe Au @ Fe3O4-substrate-aptamer mixing and reaction for a period of time, separating bound complexes of adenosine triphosphate and magnetic probes using magnetic adsorption;
(2) resuspending the compound by using enzyme digestion buffer solution, activating enzyme digestion reaction at a specific temperature (37 ℃) to generate a large amount of Trigger DNA, and removing the magnetic probe by magnetic adsorption to obtain supernatant solution containing the Trigger DNA;
(3) and mixing the solution with hairpin-Fc in the same volume, dropwise adding the mixture on the surface of the electrochemical luminescence sensor, reacting for a period of time, testing an electrochemical luminescence signal of the sensor, and calculating the corresponding ATP concentration according to the attenuation value of the electrochemical luminescence signal.
Specifically, the sensor is placed in a 0.01M PBS solution containing 25mM triethylamine for CV test, the potential range is 0-1.3V, and the speed is 0.1V/s. ECL luminescence signals were recorded simultaneously with a photomultiplier high voltage (PMT) of 800V. And calculating the attenuation value of the ECL signal, and calculating the concentration of the corresponding adenosine triphosphate according to the standard curve.
Wherein the hairpin-Fc sequence is TCGTAGCAATACCAGGAGGCTACGATGACTCACTCCTGGTATT-Fc, and the sequence is shown by SEQ ID NO. 5.
As a preference, the first and second liquid crystal compositions are,
(1) mixing the ATP solution to be detected with Au @ Fe3O4Mixing a substrate-aptamer probe, reacting at 37 ℃ for 0.5-3 h, and performing magnetic separation;
(2) with digestion buffer (containing 100mM NaCl and 20mM MgCl)220mM HEPES buffer solution) resuspending the adenosine triphosphate-adsorbing magnetic probe in the step (1), reacting for 2h at 37 ℃, and magnetically separating;
(3) mixing the supernatant with a hairpin-Fc solution in equal volume, dripping 5-50 mu L of the mixture on the surface of an electrode, reacting at 37 ℃ for 0.5-3 h, washing with a PBS solution, and drying in the air;
(4) and testing the ECL luminescence signal of the sensor.
More preferably still, the first and second liquid crystal compositions are,
(1) taking 100 mu L of ATP solution to be detected, and mixing with 100 mu L of Au @ Fe3O4Mixing a substrate-aptamer probe, reacting at 37 ℃ for 2h, and performing magnetic separation;
(2) mu.L of digestion buffer (containing 100mM NaCl and 20mM MgCl)220mM HEPES buffer solution) resuspending the adenosine triphosphate-adsorbing magnetic probe in the step (1), reacting for 2h at 37 ℃, and magnetically separating;
(3) mixing the supernatant with 2 mu M hairpin-Fc solution in equal volume, dripping 10 mu L of the mixture on the surface of an electrode, reacting for 2h at 37 ℃, washing with PBS solution, and drying in the air;
(4) and testing the ECL luminescence signal of the sensor.
The pH of PBS used for washing in the present invention was 7.4.
The electrochemical luminescence sensor system for measuring adenosine triphosphate has the detection principle that: the magnetic probe Au @ Fe3O 4-substrate-aptamer is used for specific capture of adenosine triphosphate molecules, and simultaneously the isothermal enzyme amplification reaction of the aptamer is started to generate a large amount of Trigger DNA; under the catalytic action of Trigger DNA, hairpin-Fc is complementarily combined with Capture DNA modified on RuSiO2-CS on the surface of the sensor, so that a large amount of hairpin-Fc is fixed on the surface of an electrode; since Fc can inhibit the electrochemical luminescence signal of RuSiO2-CS in a dose-dependent manner, the concentration of adenosine triphosphate has a linear relation with the attenuation value of the electrochemical luminescence signal. Based on the principle, the electrochemical luminescence sensor system realizes the quantitative detection of adenosine triphosphate.
Abbreviations for technical terms in the present invention are as follows:
adenosine triphosphate, ATP; silica microsphere doped with ruthenium terpyridyl chloride RuSiO2(ii) a CS as chitosan; si (OC)2H5)4:TEOS；H2NCH2CH2CH2Si(OC2H5)3APTES; ferrocene: fc.
The nucleic acid sequences of Trigger DNA, Capture DNA, DNA substrate, aptazyme, Blocker, hairpin-Fc, etc. involved in the present invention were synthesized by Shanghai Biotechnology engineering (Shanghai) Ltd. Other starting reagents in the present invention are commercially available. ATP, TEOS, APTES, HAuCl4Chitosan was purchased from Sigma, usa, and the rest of the chemical reagents were all domestic analytical purifiers, purchased from the pharmaceutical group chemical reagents ltd, shanghai.
During the physiological activities of a living body, adenosine triphosphate is often in a matrix with complex components, which can cause the generation of false positive results to some extent in the actual detection process. The present invention attempts to enhance the sensitivity of the assay by amplifying signals using isothermal nucleic acid amplification, which is a way to effectively reduce the matrix effect. Meanwhile, the magnetic separation technology is an effective means which can purify the target analyte from a complex matrix and effectively eliminate the effect of the sample matrix at present. Therefore, the invention tries to effectively combine two nucleic acid constant-temperature amplification methods with a magnetic separation technology and design and prepare an electrochemical luminescence sensor system for measuring the adenosine triphosphate by utilizing the high-sensitivity characteristic of an electrochemical luminescence platform.
The invention designs a novel sensor system with a double signal amplification strategy aiming at the particularity of a target object, wherein the sensor is formed by connecting aptamer Enzyme and Enzyme-Free constant-temperature signal amplification technology based on catalytic hairpin self-assembly in series, and then is cut in from the signal amplification angle of a luminescent material to synthesize RuSiO of silicon dioxide-coated terpyridine ruthenium chloride molecules2The nano-particles are combined with the signal amplification strategy to obtain a novel electrochemical luminescence sensor with excellent performance and multiple signal amplification capability. In the detection process, aptamer enzyme is specifically combined with adenosine triphosphate and cuts a substrate probe in a sensor system to obtain a large amount of Trigger DNA, the Trigger DNA triggers a catalytic Hairpin self-assembly reaction on the surface of an electrode to generate Capture DNA-Hairpin-Fc double-chain DNA, and then the detection of a sensor luminescence signal value is completed on an electrochemical luminescence test instrument. Due to Fc, RuSiO can be effectively quenched2The electrochemical luminescence signal of (2), therefore, the ultra-sensitive detection of the adenosine triphosphate can be realized through the signal attenuation values before and after the test. In addition, the sensor system successfully realizes the quantitative detection of the adenosine triphosphate in the human serum, and the detection method has the advantages of good specificity, high sensitivity, wide linear range and low cost.
Has the advantages that: compared with the prior art, the invention has the following advantages:
(1) the electrochemical luminescence sensor system is applied to detecting adenosine triphosphate in serum and bacteria cells, does not need complex treatment on samples in conventional detection methods, and also avoids the problems of high cost, complex operation and the like of the conventional detection methods such as HPLC (high performance liquid chromatography).
(2) Compared with the existing commercial adenosine triphosphate detection kit and the reported electrochemical luminescence sensor, the electrochemical luminescence sensor system has higher sensitivity.
(3) Compared with other electrochemical luminescence sensors, the electrochemical luminescence sensor system disclosed by the invention applies a multiple signal amplification strategy and has the advantages of high sensitivity, high specificity and the like; meanwhile, the invention effectively reduces false positive results in the actual detection process by utilizing the magnetic separation technology.
(4) The invention successfully prepares the high-efficiency luminescent material RuSiO2And the method is successfully combined with signal amplification strategies such as aptamer enzyme and catalytic hairpin self-assembly, and has certain guiding significance, theoretical value and practical value for development of multiple signal amplification strategies in the field of biosensing.
(5) The invention designs an electrochemiluminescence sensor system based on a multiple signal amplification strategy aiming at the specificity of ATP of a target analyte, the sensor system successfully realizes the quantitative detection of adenosine triphosphate in human serum, and has the advantages of good specificity, high sensitivity, wide linear range, low cost, convenient use and the like.
Drawings
FIG. 1 is a schematic diagram of the design and fabrication of an electrochemiluminescence sensor according to the present invention;
FIG. 2 is a cyclic voltammogram of an electrochemiluminescence sensor of the invention;
FIG. 3 is a schematic diagram showing the relationship between the incubation time of the ECL system according to the present invention for the enzyme-cleaved product and the ECL intensity;
FIG. 4 is a graph of the linear relationship between ECL intensity and log of antigen concentration for an electrochemiluminescence sensor system of the present invention;
FIG. 5 is a diagram illustrating an alternative view of an electrochemiluminescence sensor system of the present invention;
FIG. 6 is a schematic diagram of the feasibility of the electrochemiluminescence sensor system of the present invention for quantitative determination of ATP in human serum.
Detailed Description
The invention will be better understood from the following examples. However, those skilled in the art will readily appreciate that the description of the embodiments is only for illustrating the present invention and should not be taken as limiting the invention as detailed in the claims.
Example 1
Au@Fe3O4Preparation of substrate-aptamer Probe
(1)Fe3O4Preparation of nanoparticles
0.65g FeCl was weighed3Adding 0.2g of trisodium citrate into a beaker containing 20mL of ethylene glycol, fully stirring until the trisodium citrate is completely dissolved, adding 1.2g of sodium acetate into the beaker, carrying out magnetic stirring for 30min, adding the mixed solution into a reaction kettle, and reacting for 10h at 200 ℃; magnetic separating the precipitate, washing with ethanol and water for three times to obtain Fe3O4Nanoparticles.
(2) Preparation of Au nanoparticles
50mL HAuCl with mass fraction of 0.01 percent is prepared4Adding the aqueous solution into a round-bottom flask, heating the round-bottom flask to boiling, adding 1mL of trisodium citrate aqueous solution with the mass fraction of 0.1%, continuously heating and boiling for 15min, and cooling the sample to room temperature to obtain the Au nanoparticle solution.
(3)Au@Fe3O4Nanoparticle preparation
10mg of Fe are weighed3O4Adding the nano particles into 10mL of ethanol solution, fully stirring to fully disperse the nano particles, adding 100uL of APTES solution into the solution, reacting at room temperature for 10h to obtain the amination modified Fe3O4Nanoparticles. 1mL of aminated Fe was taken3O4Adding 10mL of Au nanoparticle solution into the solution, placing the solution on a horizontal shaking table at room temperature for reaction overnight, and washing the solid product with ethanol and water for three times respectively to obtain Au @ Fe3O4Nanoparticles.
(4)Au@Fe3O4Preparation of substrate-aptamer Probe
1mL of 1mg/mL Au @ Fe is taken3O4The nanoparticle aqueous solution was mixed well with 400uL of 1. mu.M DNA substrate solution, reacted at 37 ℃ for 24 hours,after magnetic separation, the solid complex was washed three times with water and the product was resuspended in 1mL of PBS buffer (Ph7.4) to yield Au @ Fe3O4-a substrate solution. Then mixing the solution with 400uL of 1 mu M aptazyme, reacting at 37 ℃ overnight, magnetically separating the solid product, and washing with water for three times to obtain Au @ Fe3O4Substrate-aptamer probes.
Example 2
RuSiO2The CS solution was prepared as follows:
2mL of Triton X-100, 8mL of cyclohexane, and 2mL of n-hexanol were weighed and added to a reaction vessel, and after thoroughly mixing, 350. mu.L of 40mM Ru (bpy) was added to the mixture3Cl2Uniformly mixing the aqueous solution, adding 150 mu L TEOS and 100 mu L ammonia water, and stirring to react for 24 h; adding 5mL of acetone, centrifuging, sequentially cleaning precipitates with ethanol and water, and resuspending the product with ethanol to obtain 4mg/mL RuSiO2And (3) solution.
Adding 1mg of CS into 1mL of acetic acid aqueous solution with the volume fraction of 2%, and performing ultrasonic dispersion for 20min to obtain a CS solution; 1mL of RuSiO 4mg/mL is taken2Adding the aqueous solution into 1mL of CS solution, and carrying out ultrasonic treatment for 30min to obtain RuSiO with uniform dispersion2-a CS solution.
Example 3
Preparation method of electrochemiluminescence sensor for measuring Trigger DNA
The preparation method of the electrochemical luminescence sensor is shown in figure 1 and comprises the following steps:
(1) electrode pretreatment: the working electrode was successively treated with 0.3 μm and 0.05 μm Al2O3Polishing the powder, and then ultrasonically cleaning for 4min by using water, ethanol and water in sequence;
(2) modified RuSiO2: taking 10 mu L of 2mg/mL RuSiO2A CS solution (example 2) is dripped on the surface of the working electrode, is kept stand and dried at room temperature, is washed by a PBS solution and is dried in the air;
(3) covalent attachment of Capture DNA: dripping 2.5% glutaraldehyde aqueous solution on the surface of the electrode, reacting for 2h at room temperature, cleaning with PBS solution, and air drying; dripping 10 mu L of 4 mu M Capture DNA on the surface of an electrode, reacting for 2h at 37 ℃, washing with a PBS solution, and drying in the air;
(4) and (3) sealing: 10 mu L of 4 mu M Blocker is dripped on the surface of the electrode, and the reaction is carried out for 2h at room temperature, washed by PBS solution and dried.
Example 4
Cyclic voltammetry monitoring of electrochemical sensor assembly process
To investigate the successful preparation of the electrochemiluminescence sensor by performing cyclic voltammetric scanning to record the signal response analysis of the sensor at each modification stage, the glassy carbon electrode (working electrode) obtained from each step in example 3 was placed in a solution containing 2mM K3[Fe(CN)6]In 0.01M PBS at a rate of 0.1V/s, and the results are shown in FIG. 2. When RuSiO2After CS is modified on the surface of the electrode, the peak current value of the CV curve is reduced compared with that of a bare electrode due to the increase of the resistance. After the step of the Capture DNA modification, the current value is obviously reduced, which indicates that a large amount of Capture DNA is modified on the surface of the electrode, and is beneficial to the smooth operation of the subsequent antigen detection step. Then, the working electrode undergoes small-amplitude reduction of current every time the working electrode undergoes modification, which is caused by steric hindrance and electronegativity generated after DNA is combined on the surface of the electrode. This example illustrates the use of electrochemical methods to monitor the sensor assembly process, which illustrates the successful modification of the corresponding materials and DNA to the electrode surface during the sensor fabrication process.
Example 5
Electrochemiluminescence sensor system detection process for detecting adenosine triphosphate
(1) Taking 100 mu L of ATP solution to be detected, and mixing with 100 mu L of Au @ Fe3O4Mixing a substrate-aptamer probe, reacting at 37 ℃ for 2h, and performing magnetic separation;
(2) mu.L of digestion buffer (containing 100mM NaCl and 20mM MgCl)220mM HEPES buffer solution) resuspending the adenosine triphosphate-adsorbing magnetic probe in the step (1), reacting for 2h at 37 ℃, and magnetically separating;
(3) mixing the supernatant containing Trigger DNA with 2 mu M hairpin-Fc solution in equal volume, dripping 10 mu L of the mixture on the surface of an electrode, reacting for 2h at 37 ℃, washing with PBS solution, and drying in the air;
(4) ECL luminescence signal of the test sensor: the sensor is placed in 0.01M PBS (pH7.4) solution containing 25mM triethylamine for CV test, the potential range is 0-1.3V, the speed is 0.1V/s, ECL luminescence signals are synchronously recorded, the photomultiplier high Pressure (PMT) is 800V, the attenuation value of the ECL signals is calculated, and the corresponding concentration of the adenosine triphosphate is calculated according to a standard curve.
Example 6
Optimization of incubation time of electrochemiluminescence sensor system for measuring adenosine triphosphate
The effect of incubation time of Trigger and Hairpi-Fc on ECL signal intensity on the electrode surface was explored. The detection process of the electrochemiluminescence sensor system is the same as that in example 5, the ATP concentration is 100pM, and 5 different times, such as 30min, 60min, 90min, 120min, 150min and the like, are selected for incubation time of the mixed solution containing the supernatant of the Trigger DNA and the Hairpin-Fc on the surface of the electrode in the step (3) to carry out the experiment. As shown in FIG. 3, the Δ ECL signal intensity rapidly increases with time when the reaction time is less than or equal to 90min and reaches a maximum value at 90min, so that the electrochemiluminescence sensor system of the present invention selects 90min as the incubation time.
Example 7
Linear relationship between delta ECL intensity and antigen concentration of electrochemical luminescence sensor system for measuring adenosine triphosphate
The procedure of the electrochemiluminescence sensor system was the same as in example 5. Preparing standard solutions of adenosine triphosphate with different concentrations, respectively 0.1pM, 1pM, 10pM, 100pM and 1000pM, setting 3 parallel experimental groups for each concentration, and adopting the detection method of example 5.
The linear relationship between the Δ ECL signal intensity and the antigen concentration was analyzed and the results are shown in fig. 4. The Δ ECL signal intensity gradually increases with increasing ATP concentration and is linear. The lowest detection limit of the sensor is 0.054pM, and compared with the existing commercial ATP detection kit (chemiluminescence method, the lowest detection limit is 0.1nM), the invention has higher sensitivity.
Example 8
Specific analysis of target detection by electrochemiluminescence sensor system for measuring adenosine triphosphate
Examining whether the electrochemiluminescence sensor system has nonspecific response to the structural analog of the target analyte, the detection process of the electrochemiluminescence sensor system is the same as that in example 5, except that different antigens are selected in the step (1): UTP, GTP, CTP instead of ATP, the results are shown in FIG. 5. Under the same concentration, namely 1000pM, the sensor can effectively distinguish ATP, and when the structural analogue exists, the response signal of the sensor has no obvious change compared with a control group, which shows that the sensor designed by the invention has good specificity.
Example 9
The electrochemical luminescence sensor system of the invention applies the quantitative detection of ATP in human serum
In order to examine the feasibility of the electrochemiluminescence sensor system of the present invention for quantitatively detecting ATP in human serum, the detection process of the electrochemiluminescence sensor system is the same as that in example 5, and the preparation method of the ATP solution to be detected used in step (1) is as follows: different amounts of ATP were weighed and dissolved in 10% volume fraction human serum solution (solvent 0.01M PBS, pH7.4) to final concentrations of 0.1pM, 1pM, 10pM, 100pM, 1000pM, respectively. The result is shown in fig. 6, and the detection result shows that the recovery rate of ATP in human serum detected by the electrochemiluminescence sensor system disclosed by the invention is 95.68% -103.4%, and the relative standard deviation between different control groups is 1.881% -5.689%, which indicates that the test data of the sensor system is stable and has good reliability, and the sensor system can be used for quantitative detection of ATP in human serum.
Example 10
The preparation of the Au @ Fe3O 4-substrate-aptamer probe in the embodiment is the same as the preparation method of the embodiment 1, except that: in the step (3), the addition amount of the APTES is 10 percent of the volume of the reaction solution; fe3O4The concentration of the nano particles is 5 mg/mL; the concentration of the Au @ Fe3O4 nano particles in the step (4) is 5mg/mL, the concentration of DNA substrate is 10 mu M, and the concentration of aptazyme is 10 mu M.
RuSiO2The CS solution was prepared as in example 2, except that: 1mL of Triton X-100, 5mL of cyclohexane and 1mL of n-hexanol are weighed and added into the mixtureAfter mixing well in a container, 250. mu.L of 5mM Ru (bpy) was added to the mixture3Cl2Mixing the aqueous solution evenly, adding 50 mu L TEOS and 30 mu L ammonia water, and stirring for reaction for 12 h; adding 1mL of acetone, centrifuging, sequentially cleaning precipitates with ethanol and water, and resuspending the product with ethanol to obtain 1mg/mL RuSiO2And (3) solution.
Adding 0.1mg of CS into 0.1mL of acetic acid aqueous solution with volume fraction of 0.5%, and performing ultrasonic dispersion for 5min to obtain a CS solution; taking 0.1mL of 1mg/mL RuSiO2Adding the aqueous solution into 0.1mL of CS solution, and carrying out ultrasonic treatment for 10min to obtain RuSiO with uniform dispersion2-a CS solution.
An electrochemiluminescence sensor was prepared as in example 2, except that: (1) electrode pretreatment: the working electrode was successively treated with 0.3 μm and 0.05 μm Al2O3Polishing the powder, and then carrying out ultrasonic cleaning for 2min by using water, ethanol and water in sequence;
(2) modified RuSiO2: 2 mu L of 1mg/mL RuSiO2Dripping a CS solution on the surface of the working electrode, standing and drying at room temperature, washing with a PBS solution, and drying in the air;
(3) covalent attachment of Capture DNA: dropwise adding a glutaraldehyde aqueous solution with the mass fraction of 0.5% to the surface of the electrode, reacting for 1h at room temperature, washing with a PBS solution, and drying; dripping 2 mu L of 1 mu M Capture DNA on the surface of an electrode, reacting for 1h at 37 ℃, washing with a PBS solution, and drying in the air;
(4) and (3) sealing: and (3) dropwise adding 2 mu L of 1 mu M Blocker on the surface of the electrode, reacting at room temperature for 1h, washing with a PBS solution, and drying.
Example 11
Example 10 was prepared in the same manner as example 1, except that: in the step (3), the addition amount of the APTES is 5 percent of the volume of the reaction solution; fe3O4The concentration of the nano particles is 0.5 mg/mL; the concentration of the Au @ Fe3O4 nano particles in the step (4) is 0.5mg/mL, the concentration of DNA substrate is 5 mu M, and the concentration of aptazyme is 5 mu M.
RuSiO2The CS solution was prepared as in example 2, except that: weighing 3mL of Triton X-100, 10mL of cyclohexane and 3mL of hexanol, adding into a reaction container, fully mixingTo the mixture was added 500. mu.L of 100mM Ru (bpy)3Cl2Uniformly mixing the aqueous solution, adding 200 mu L TEOS and 200 mu L ammonia water, and stirring to react for 36 h; adding 10mL of acetone, centrifuging, sequentially cleaning precipitates with ethanol and water, and resuspending the product with ethanol to obtain 8mg/mL RuSiO2And (3) solution.
Adding 2mg of CS into 2mL of acetic acid aqueous solution with volume fraction of 3%, and performing ultrasonic dispersion for 5min to obtain a CS solution; 2mL of RuSiO 8mg/mL is taken2Adding the aqueous solution into 2mL of CS solution, and carrying out ultrasonic treatment for 60min to obtain RuSiO with uniform dispersion2-a CS solution.
An electrochemiluminescence sensor was prepared as in example 2, except that: (1) electrode pretreatment: the working electrode was successively treated with 0.3 μm and 0.05 μm Al2O3Polishing the powder, and then carrying out ultrasonic cleaning for 10min by using water, ethanol and water in sequence;
(2) modified RuSiO2: 20 mu L of RuSiO 8mg/mL is taken2Dripping a CS solution on the surface of the working electrode, standing and drying at room temperature, washing with a PBS solution, and drying in the air;
(3) covalent attachment of Capture DNA: dropwise adding a glutaraldehyde aqueous solution with the mass fraction of 5% to the surface of the electrode, reacting for 3 hours at room temperature, cleaning with a PBS solution, and drying in the air; dripping 20 mu L of 10 mu M Capture DNA on the surface of an electrode, reacting for 3h at 37 ℃, washing with a PBS solution, and drying in the air;
(4) and (3) sealing: 20 μ L of 10 μ M Blocker was dropped on the electrode surface, and the reaction was carried out at room temperature for 3 hours, washed with PBS solution, and dried.
Sequence listing
<110> university of southeast
<120> electrochemical luminescence sensor system for measuring adenosine triphosphate, preparation method and application thereof
<160>5
<170>SIPOSequenceListing 1.0
<210>1
<211>46
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
aaaaaaaaaa ttcaccaact atragctacg atgactcacc taggag 46
<210>2
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
tcatcgtaga gcgatctagg gggagtattg cggaggatag cacccatgtt agttggtgaa 60
<210>3
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
gctacgatga ctcacctagg ag 22
<210>4
<211>47
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
ctcctaggtg agtcatcgta gcctcctggt attgctacga tgactca 47
<210>5
<211>47
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
ctcctaggtg agtcatcgta gcctcctggt attgctacga tgactca 47

Claims (10)

1. An electrochemical luminescence sensor system for measuring adenosine triphosphate is characterized in that the system comprises a magnetic probe Au @ Fe for amplifying an adenosine triphosphate concentration signal3O4-substrate-aptazyme and an electrochemiluminescence sensor for measuring Trigger DNA; the magnetic probe Au @ Fe3O4-substrate-aptamer from Fe3O4The nano-particles, the gold nano-particles, the DNA substrate and the aptazyme are compounded in sequence; the electrochemiluminescence sensor for measuring Trigger DNA connects amino modified Capture DNA to modified RuSiO through glutaraldehyde crosslinking2The working electrode surface of CS.
2. The electrochemiluminescence sensor system for detecting adenosine triphosphate according to claim 1, wherein the DNA substrate sequence is "SH-aaaaaaaattcaccacacaactataragct acgatgactcaccactagggag"; the aptazyme sequence is "TCATCGTAGAGCGATCTAGGGGGAGTATTGCGGAGGATAGCACCCATGTTAGTTGGTGAA"; the Trigger DNA sequence is 'GCTACGATGACTCACCTAGGAG'; the amino modified Capture DNA sequence is 'NH 2-CTCCTAGGTGAGTCATCGTAGCCTCCTGGTATTGCTACGATGACTCA'.
3. The electrochemiluminescence sensor system for detecting adenosine triphosphate according to claim 1, wherein the RuSiO is2-CS is preferably made of RuSiO2Mixing the solution with a solution containing CS; the RuSiO2Adding Ru (bpy) into a mixture of Triton X-100, cyclohexane and n-hexanol3Cl2Mixing the aqueous solution, adding TEOS and ammonia water, and stirring for reaction; adding acetone, centrifuging, cleaning and precipitating to obtain RuSiO2。
4. The electrochemiluminescence sensor system for detecting adenosine triphosphate according to claim 1, wherein the magnetic probe Au @ Fe3O4The substrate-aptamer preparation procedure is as follows:
(1) weighing FeCl3And dissolving trisodium citrate in ethylene glycol, adding sodium acetate, adding the stirred mixed solution into a reaction kettle, and cleaning the precipitate after reaction to obtain Fe3O4Nanoparticles;
(2) to HAuCl4Adding trisodium citrate aqueous solution into the aqueous solution, and continuously boiling to obtain Au nanoparticles;
(3) using APTES on Fe3O4Carrying out amination modification on the nano particles, mixing the product with Au nano particles, carrying out magnetic separation, and then cleaning to obtain Au @ Fe3O4Nanoparticles;
(4)Au@Fe3O4mixing the nano particles and DNA substrate, carrying out magnetic separation after reaction, and washing with water to obtain Au @ Fe3O4-a substrate solution; then mixed with aptazyme and reacted overnight to give Au @ Fe3O4-substrate-aptazyme probe.
5. The method according to claim 3, wherein the amount of APTES added in step (3) is 1-10% of the reaction solution, and Fe is added3O4The concentration of the nano particles is 0.5-5 mg/mL; the concentration of the Au @ Fe3O4 nanoparticles in the step (4) is 0.5-5 mg/mL, the concentration of DNA substrate is 1-10 mu M, and the concentration of aptazyme is 1-10 mu M.
6. The electrochemiluminescence sensor system for detecting adenosine triphosphate according to claim 1, wherein the electrochemiluminescence sensor for detecting Trigger DNA is prepared by the following steps:
(1) polishing the working electrode, and then ultrasonically cleaning;
(2) taking RuSiO2Dripping a CS solution on the surface of the working electrode, standing and drying at room temperature, and cleaning and airing;
(3) dripping glutaraldehyde aqueous solution on the surface of the electrode, reacting at room temperature, and then cleaning and airing; dropwise adding the Capture DNA to the surface of an electrode, and cleaning and airing after reaction;
(4) and dropwise adding Blocker on the surface of the electrode, reacting at room temperature, cleaning and airing to obtain the electrochemiluminescence sensor for measuring Trigger DNA.
7. Use of an electrochemiluminescence sensor system for the determination of adenosine triphosphate according to claim 1 for the quantitative determination of adenosine triphosphate.
8. The use according to claim 7, characterized in that it comprises the following steps for detecting adenosine triphosphate:
(1) mixing adenosine triphosphate solution with a magnetic probe Au @ Fe3O4-substrate-aptamer mixing and continuous reaction, separating bound complexes of adenosine triphosphate and magnetic probes by magnetic adsorption;
(2) resuspending the compound by using enzyme digestion buffer solution, activating enzyme digestion reaction to generate a large amount of Trigger DNA, and removing the magnetic probe by magnetic adsorption to obtain supernatant solution containing the Trigger DNA;
(3) and mixing the solution with hairpin-Fc in the same volume, dropwise adding the mixture on the surface of the electrochemical luminescence sensor, reacting for a period of time, testing an electrochemical luminescence signal of the sensor, and calculating the corresponding ATP concentration according to the attenuation value of the electrochemical luminescence signal.
9. The use of claim 7, wherein said hairpin-Fc sequence is TCGTAGCAATACCAGGAGGCTACGATGACTCACTCCTGGTATT-Fc.
10. The use of claim 7, wherein the use is magnetic probe Au @ Fe3O 4-substrate-aptamer for specific capture of atp molecules, while initiating the isothermal enzymatic amplification reaction of the aptamer to produce large amounts of Trigger DNA; under the catalytic action of Trigger DNA, hairpin-Fc and RuSiO on the surface of the sensor2-complementary binding of the modified Capture DNA on CS, thereby immobilizing a plurality of hairpin-Fc on the electrode surface; since Fc can inhibit the electrochemical luminescence signal of RuSiO2-CS in a dose-dependent manner, the concentration of adenosine triphosphate and the attenuation value of the electrochemical luminescence signal form a linear relationship to realize the quantitative detection of the adenosine triphosphate.
CN201911156060.1A 2019-11-22 2019-11-22 Electrochemical luminescence sensor system for measuring adenosine triphosphate, and preparation method and application thereof Active CN111020006B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911156060.1A CN111020006B (en) 2019-11-22 2019-11-22 Electrochemical luminescence sensor system for measuring adenosine triphosphate, and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911156060.1A CN111020006B (en) 2019-11-22 2019-11-22 Electrochemical luminescence sensor system for measuring adenosine triphosphate, and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN111020006A true CN111020006A (en) 2020-04-17
CN111020006B CN111020006B (en) 2023-04-07

Family

ID=70206951

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911156060.1A Active CN111020006B (en) 2019-11-22 2019-11-22 Electrochemical luminescence sensor system for measuring adenosine triphosphate, and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN111020006B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112067602A (en) * 2020-08-19 2020-12-11 南昌大学 ATP chemiluminescence detection method based on enzyme digestion-assisted unmarked aptamer sensor
CN112697858A (en) * 2020-12-08 2021-04-23 云南民族大学 Electrochemical analysis method for determining activity of T4 polynucleotide kinase based on magnetic nano material

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106475568A (en) * 2015-08-28 2017-03-08 赵世芬 The preparation of Au nanoparticle
CN106918633A (en) * 2017-04-24 2017-07-04 中国科学院苏州生物医学工程技术研究所 The detection method of the cytokine TNF α based on fit and golden magnetic nano particle
CN107091834A (en) * 2017-05-24 2017-08-25 青岛科技大学 It is a kind of that the method that amplifying technique detects DNA is circulated based on hair fastener mispairing
CN108241010A (en) * 2017-10-27 2018-07-03 石狮纳通新材料科技有限公司 The preparation method and applications of Au-Fe3O4 nanocomposites
CN108918509A (en) * 2018-07-16 2018-11-30 青岛科技大学 A kind of development and its application based on CdSe quantum dot Electrochemiluminescsensor sensor
CN109439659A (en) * 2018-11-13 2019-03-08 湖南工程学院 A kind of aptamer ribozyme sequence

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106475568A (en) * 2015-08-28 2017-03-08 赵世芬 The preparation of Au nanoparticle
CN106918633A (en) * 2017-04-24 2017-07-04 中国科学院苏州生物医学工程技术研究所 The detection method of the cytokine TNF α based on fit and golden magnetic nano particle
CN107091834A (en) * 2017-05-24 2017-08-25 青岛科技大学 It is a kind of that the method that amplifying technique detects DNA is circulated based on hair fastener mispairing
CN108241010A (en) * 2017-10-27 2018-07-03 石狮纳通新材料科技有限公司 The preparation method and applications of Au-Fe3O4 nanocomposites
CN108918509A (en) * 2018-07-16 2018-11-30 青岛科技大学 A kind of development and its application based on CdSe quantum dot Electrochemiluminescsensor sensor
CN109439659A (en) * 2018-11-13 2019-03-08 湖南工程学院 A kind of aptamer ribozyme sequence

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
HAIFENG SHA等: "《Electroluminescent aptasensor based on RuSiO2 nanoparticles for detection cytochrome c using ferrocene as quenching probe》", 《BIOSENSORS AND BIOELECTRONICS》 *
MIN CHEN等: "《Aptamer-conjugated bio-bar-code Au-Fe3O4 nanoparticles as amplification station for electrochemiluminescence detection of tumor cells》", 《ANALYTICA CHIMICA ACTA》 *
XIA LI等: "《Cascaded signal amplification via target-triggered formation of aptazyme for sensitive electrochemical detection of ATP》", 《BIOSENSORS AND BIOELECTRONICS》 *
杨玉东: "《生物医学纳米磁性材料原理及应用》", 31 October 2005, 吉林人民出版社 *
葛金龙: "《材料化学专业实验》", 30 September 2019, 中国科学技术大学出版社 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112067602A (en) * 2020-08-19 2020-12-11 南昌大学 ATP chemiluminescence detection method based on enzyme digestion-assisted unmarked aptamer sensor
CN112067602B (en) * 2020-08-19 2021-12-14 南昌大学 ATP chemiluminescence detection method based on enzyme digestion-assisted unmarked aptamer sensor
CN112697858A (en) * 2020-12-08 2021-04-23 云南民族大学 Electrochemical analysis method for determining activity of T4 polynucleotide kinase based on magnetic nano material

Also Published As

Publication number Publication date
CN111020006B (en) 2023-04-07

Similar Documents

Publication Publication Date Title
US10605761B2 (en) Electrochemical biosensor based on aptamer/nano silver probe and EXO I enzyme
CN107101997B (en) A kind of building of the electrochemical luminescence sensor for acetyltransferase activity detection
Sun et al. A highly selective and sensitive detection of insulin with chemiluminescence biosensor based on aptamer and oligonucleotide-AuNPs functionalized nanosilica@ graphene oxide aerogel
US20130196341A1 (en) Methods and compositions for detection of analytes
CN108344783B (en) Electrochemical cell sensor and preparation method and application thereof
Zhao et al. Highly sensitive protein kinase activity assay based on electrochemiluminescence nanoprobes
CN109490284A (en) A kind of dual catalytic Particles in Electrochemiluminescofce ofce Luminol biosensor based on gold nano grain and two titanium carbide MXenes
CN111020006B (en) Electrochemical luminescence sensor system for measuring adenosine triphosphate, and preparation method and application thereof
CN110794017B (en) Preparation method of electrochemical immunosensor for detecting procalcitonin
CN109507256B (en) Unmarked electrochemiluminescence aptamer sensor for detecting carcino-embryonic antigen and preparation method and using method thereof
CN102021226A (en) Luminol direct bonded nano gold nucleic acid analyzing probe and application thereof
CN114295694A (en) Electrochemical luminescence aptamer sensor for breast cancer HER-2 detection and detection method thereof
CN108918853B (en) Pd @ Ag @ CeO2Preparation method and application of labeled immunosensor
Hu et al. Ratiometric electrochemical aptasensor for point-of-care testing Vibrio parahaemolyticus together with antimicrobial peptide-labeled nano metal-organic framework signal tag
CN106198699A (en) Prepare two kind of two anti-conjugate and for detection alpha-fetoprotein and the method for carcinoembryonic antigen simultaneously
Li et al. An aptasensor for the detection of ampicillin in milk using a personal glucose meter
CN114324521B (en) Electrochemical biosensor and preparation method and application thereof
CN112763562B (en) Preparation method of branch-shaped walking machine aptamer electrochemical sensor for adenosine triphosphate detection
Si et al. Sensitive electrochemical detection of A549 exosomes based on DNA/ferrocene-modified single-walled carbon nanotube complex
CN108918873B (en) Preparation method and application of photoelectrochemical thrombin aptamer sensor based on dual inhibition of PS @ Au on ZnCdS
CN115932000A (en) Electrochemical biosensor for detecting EGFR-ctDNA (epidermal growth factor receptor-ctDNA), and preparation method and application thereof
CN110132946A (en) A kind of aptamer sensor and its preparation method and application
CN114509481B (en) Preparation method and application of electrochemical biosensor based on butterfly effect
CN114019172B (en) Detection kit for disease protein marker based on peptide and antibody and application thereof
CN114252485B (en) Electrochemical aptamer sensor for detecting mycobacterium tuberculosis MPT64 and detection method thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant