CN111004776A - Method for separating and culturing equine skeletal muscle satellite cells - Google Patents
Method for separating and culturing equine skeletal muscle satellite cells Download PDFInfo
- Publication number
- CN111004776A CN111004776A CN202010015249.5A CN202010015249A CN111004776A CN 111004776 A CN111004776 A CN 111004776A CN 202010015249 A CN202010015249 A CN 202010015249A CN 111004776 A CN111004776 A CN 111004776A
- Authority
- CN
- China
- Prior art keywords
- precipitate
- equine
- supernatant
- skeletal muscle
- satellite cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0658—Skeletal muscle cells, e.g. myocytes, myotubes, myoblasts
- C12N5/0659—Satellite cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2509/00—Methods for the dissociation of cells, e.g. specific use of enzymes
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Rheumatology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The embodiment of the invention discloses a method for separating and culturing equine skeletal muscle satellite cells, which comprises the steps of sterilizing equine muscle masses, removing adipose tissues and connective tissues, and crushing the equine muscle masses into massive muscle tissues; digesting the massive muscle tissue by trypsin, and centrifugally separating to obtain a first supernatant and a first precipitate; centrifuging the first supernatant to obtain a second supernatant and a second precipitate, discarding the second supernatant, re-suspending and centrifuging the second precipitate by using a proliferation culture solution to obtain a third supernatant and a third precipitate, discarding the third supernatant, suspending the proliferation culture solution of the third precipitate, passing through a cell filter, collecting a first filtrate, and centrifuging the first filtrate to obtain a fourth precipitate. The embodiment of the invention improves the number and the purity of skeletal muscle satellite cells through purification, and provides an accurate skeletal muscle satellite cell separation culture method for research institutes of muscle growth, muscle injury and other scientific research institutions.
Description
Technical Field
The embodiment of the invention relates to the technical field of cell culture, in particular to a culture system of horse skeletal muscle satellite cells.
Background
At present, horse racing and amusement are the mainstream of the future horse industry development, and muscles of horses can be damaged to different degrees according to the amount of exercise during the exercise process, so that the exercise performance of the horses is influenced, and the condition that the horses have good exercise performance in horse racing and equestrian exercise is necessary. The skeletal muscle satellite cells are myogenic stem cells which have proliferation and differentiation in skeletal muscles and play an indispensable role in the skeletal muscle regeneration process, most of the skeletal muscle satellite cells are static after the human body is grown up, and can be activated to proliferate and differentiate only when tissues are damaged, so that the repair of muscle fibers is promoted. Skeletal muscle satellite cells are important cell models for studying muscle growth and development, injury and repair, muscle-related diseases and the like.
Disclosure of Invention
Therefore, the embodiment of the invention provides a method for separating and culturing equine skeletal muscle satellite cells, which solves the problem that the prior art lacks an effective method for separating and culturing equine skeletal muscle satellite cells.
In order to achieve the above object, the embodiments of the present invention provide the following technical solutions:
a method for separating and culturing equine skeletal muscle satellite cells comprises sterilizing equine muscle mass, removing adipose tissue and connective tissue, and pulverizing into massive muscle tissue;
digesting the massive muscle tissue by trypsin, and centrifugally separating to obtain a first supernatant and a first precipitate;
centrifuging the first supernatant to obtain a second supernatant and a second precipitate, discarding the second supernatant, re-suspending and centrifuging the second precipitate by using a proliferation culture solution to obtain a third supernatant and a third precipitate, discarding the third supernatant, suspending the proliferation culture solution of the third precipitate, passing through a cell filter, collecting a first filtrate, and centrifuging the first filtrate to obtain a fourth precipitate;
digesting the first precipitate by collagenase, passing the first precipitate through a cell filter to obtain a second filtrate, centrifuging the second filtrate to obtain a fourth supernatant and a fifth precipitate, further centrifuging the fourth supernatant to obtain a sixth precipitate, mixing the fifth precipitate and the sixth precipitate, suspending the mixture by a proliferation culture solution, and centrifuging the mixture to obtain a fifth supernatant and a seventh precipitate;
mixing the fourth precipitate suspension with the seventh precipitate suspension, and centrifuging to obtain a sixth supernatant and an eighth precipitate;
suspending the eighth precipitate with a proliferation culture solution, filtering by using a cell filter to obtain a third filtrate, and centrifuging the third filtrate to obtain a ninth precipitate, namely the equine skeletal muscle satellite cells;
and suspending the ninth precipitate with a proliferation culture solution, culturing, and purifying by a differential adherence method to obtain the purified equine skeletal muscle satellite cells.
Preferably, the horse muscle mass is sterilized by soaking in 70% ethanol.
Preferably, the equine muscle mass is rinsed with DPBS containing penicillin streptomycin until the DPBS is clear and bloodless before the equine muscle mass is comminuted.
Preferably, the mass fraction of the trypsin is 0.25%.
Preferably, the centrifugation process is 700rpm-2000rpm, and the centrifugation time is 5-15 min.
Preferably, a 70 μm cell filter is used for the first filtrate and the second filtrate, and a 40 μm cell filter is used for the third filtrate.
Preferably, the proliferation culture solution comprises the following raw materials in percentage by mass: 20% fetal bovine serum, 1% penicillin streptomycin and amphotericin B and the balance DMEM.
Preferably, the collagenase is collagenase type IV, diluted by DMEM to a concentration of 1mg/1 mL.
The embodiment of the invention has the following advantages:
the embodiment of the invention establishes a culture system and a method of the equine skeletal muscle satellite cells, separates the equine skeletal muscle satellite cells which are fusiform, have good growth state and can be normally proliferated and passaged.
The embodiment of the invention adds multiple steps of centrifugation and cleaning to ensure that the obtained primary cells are clean and sterile, and purifies the equine skeletal muscle satellite cells by removing impurities, cell debris, fibroblasts and the like through a differential adherence method.
The embodiment of the invention improves the number and purity of skeletal muscle satellite cells through purification, provides an accurate method for obtaining the skeletal muscle satellite cells for research institutes of muscle growth, muscle injury and other scientific research institutions, provides favorable conditions and research foundation for the skeletal muscle satellite cells for muscle regeneration and injury repair, and has great scientific research and social values.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. It should be apparent that the drawings in the following description are merely exemplary, and that other embodiments can be derived from the drawings provided by those of ordinary skill in the art without inventive effort.
Fig. 1 is a microscope image of primary cultured skeletal muscle satellite cells provided in the embodiment of the present invention, wherein a: isolating the day 1 myosatellite cells; b: primary day 3 muscle satellite cells; c: primary day 5 myosatellite cells; d: primary day 7 myosatellite cells;
FIG. 2 is a graph of undifferentiated and differentiated myosatellite cells according to an embodiment of the invention, wherein A: myosatellite cells that reached 80% confluence before differentiation; b: myotubes are generated after differentiation;
fig. 3 is a diagram of skeletal muscle satellite cell identification by differential adherence provided in the embodiment of the invention, wherein a: adhering fibroblasts to the wall for 1 h; b: the fibroblasts are attached to the wall for 4 hours; c: the fibroblasts are attached to the wall for 8 hours; d: skeletal muscle satellite cells adhere to the wall for 1 h; e: skeletal muscle satellite cells adhere to the wall for 4 h; f: skeletal muscle satellite cells adhere to the wall for 8 h;
FIG. 4 is an electrophoretogram of the RT-PCR product for identifying the muscle satellite cells provided by the embodiment of the invention, wherein M: maker, lane 1: GAPDH, lane 2: pax7, lane 3: myod, lane 4: desmin;
FIG. 5 is a diagram of immunofluorescence for identifying myosatellite cells according to an embodiment of the present invention, wherein A, D, and G are myosatellite cell Hoechst nuclear staining; b: pax7 positive expression; e: positive expression of Myod; h: desmin positive expression; c, F and I are Merged graphs.
Detailed Description
The present invention is described in terms of particular embodiments, other advantages and features of the invention will become apparent to those skilled in the art from the following disclosure, and it is to be understood that the described embodiments are merely exemplary of the invention and that it is not intended to limit the invention to the particular embodiments disclosed. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
In the embodiment of the invention, the configured concentration of the collagenase type IV is as follows: 1mg/1mL, diluted with DMEM and filtered through a 0.22 μm filter.
In the embodiment of the invention, the preparation method of the proliferation culture solution comprises the following steps: 20% Fetal Bovine Serum (FBS), 1% penicillin streptomycin and amphotericin B, DMEM supplemented and filtered through 0.22 μm filters.
In the embodiment of the invention, the preparation method of the differentiation culture solution comprises the following steps: 2% horse serum, 1% penicillin streptomycin, balance DMEM supplemented and filtered through a 0.22 μm filter.
In the examples of the present invention, DMEM was purchased from Gibco, Inc. under the trade designation 2066482.
In the examples of the present invention, DPBS was purchased from Gibco, Inc. under the trade name of 2043115, and was prepared as a DPBS solution by dissolving DPBS in 1L of distilled water in each bag in a powdery form.
The apparatus used in the examples of the present invention is as follows: TD6A-WS desk type centrifuge, HWS-26 model electric heating constant temperature water bath, Thermo Scientific HERAcell 150i CO2Incubator, ZEISS inverted phase contrast microscope, CFX96 real-time fluorescence quantitative PCR instrument, Bio-Rad gel imaging system, ECHO revolve FL fluorescence microscope
Example 1 isolation and culture of equine skeletal muscle satellite cells
The method for separating and culturing the equine skeletal muscle satellite cells comprises the following steps:
1. muscles of horses 2 years old were harvested, the horse muscles were rapidly sterilized by immersion in a petri dish with 70% ethanol, and the sterilized muscle samples were immediately transferred to a new petri dish containing DPBS with penicillin streptomycin and rinsed with 3 volumes of DPBS until the DPBS was clear and bloodless. Wherein DPBS is previously added with 1% penicillin streptomycin and filtered through a 0.22 μm filter.
2. Removing fat and connective tissue visible on washed horse muscle mass with scalpel, cutting into pieces with scissors in culture dish containing DMEM, and cutting to 1mm3Size.
The minced muscle tissue was transferred to a 15mL centrifuge tube and centrifuged at 1000rpm for 5 min. Separating the precipitate with the massive muscle tissue from the supernatant, discarding the supernatant, collecting the muscle tissue precipitate in a 15mL centrifuge tube, adding 3 times of 0.25% trypsin for digestion, and shaking once every 10min in a water bath at 37 deg.C for 1 h. The digested muscle tissue was pipetted back and forth 10-15 times, gently dissociating the cells. Centrifuging a 15mL centrifuge tube at 200rpm for 5min, separating a first supernatant and a first precipitate, storing the first precipitate on ice, transferring the first supernatant into the 15mL centrifuge tube, centrifuging at 2000rpm for 5min to obtain a second supernatant and a second precipitate, resuspending the second precipitate with 5mL proliferation culture solution, centrifuging at 2000rpm for 10min to obtain a third supernatant and a third precipitate, suspending the third precipitate with 3mL proliferation culture solution, passing the suspension through a 70-micron cell filter, collecting to obtain a first filtrate, centrifuging the first filtrate at 2000rpm for 10min to obtain a fourth precipitate, suspending the fourth precipitate with 1mL proliferation culture solution, and storing on ice.
Digesting the first precipitate with collagenase type IV for 1h, sucking with a pipette for 10-15 times, gently dissociating the cells, filtering with a 70 μm filter after digestion to obtain a second filtrate, centrifuging the second filtrate for 5min at 2000rpm to obtain a fourth supernatant and a fifth precipitate, centrifuging the fourth supernatant again at 2000rpm for 10min to obtain a sixth precipitate, mixing the fifth precipitate and the sixth precipitate, suspending with 5mL of proliferation culture solution, centrifuging the cell suspension for 5min at 2000rpm to obtain a fifth supernatant and a seventh precipitate, suspending with 1mL of proliferation culture solution on ice. The fourth and seventh precipitate suspensions were mixed and centrifuged at 2000rpm for 5min to collect the precipitate. The suspension was suspended in 5mL of DPBS, centrifuged again at 2000rpm for 10min, and the precipitate was collected to give an eighth precipitate.
Suspending the eighth precipitate with 5mL of the proliferation culture solution, filtering with a 40 μm filter to obtain a third filtrate, adding the proliferation culture solution to the third filtrate to make the volume of the third filtrate to be 10mL, centrifuging at 700rpm for 10min, and collecting the precipitate to obtain a ninth precipitate.
4. The ninth pellet was suspended with 2mL of warm multiplication medium to obtain a cell suspension, which was plated in a petri dish. Purification of skeletal muscle satellite cells by differential adherence at 37 ℃ and 5% CO2And (5) culturing for 2 h. Two hour cultured cells the supernatant was transferred to a new petri dish at 37 ℃ and 5% CO2And (5) culturing to obtain the purified equine skeletal muscle satellite cells.
When the cultured equine skeletal muscle satellite cells are observed under a microscope, as shown in fig. 1, the skeletal muscle satellite cells are round cells immediately after being separated, only a small number of cells adhere to the wall in the first three days, then the adherent cells gradually increase along with the increase of time, the cells start to proliferate and grow after adhering to the wall, the cells are in a fusiform shape and a long fiber shape, are in a shape consistent with the shape of the equine skeletal muscle satellite cells, and have the characteristics of normal growth, proliferation and passage.
Example 2 identification of equine skeletal muscle satellite cells by induced differentiation
When the equine skeletal muscle satellite cells obtained by the culture in the embodiment 1 of the invention reach 70% -80% confluence, differentiation is induced by adding a differentiation culture solution with low serum. As shown in FIG. 2, it was found that the cells obtained by the culture were regularly arranged in parallel after the induction of differentiation with the differentiation medium, the cells elongated and thinned, and the cells proliferated in a large amount were fused with each other, and the formation of myotubes was observed to match the differentiation characteristics of the skeletal muscle satellite cells.
Example 3 identification of equine skeletal muscle satellite cells by differential adherence
Example 1 the cell culture process may be contaminated by fibroblast, horse skeletal muscle satellite cells are purified by a differential adherence method, the adherence time of the horse skeletal muscle satellite cells is long, the adherence time of the fibroblast is fast, adherence time of the skeletal muscle satellite cells and fibroblast is observed, and the horse skeletal muscle satellite cells are identified according to the characteristic. As shown in fig. 3, it was found that equine skeletal muscle satellite cells did not adhere to the wall at 1 hour, while few fibroblasts began to adhere to the wall at 1 hour, and equine skeletal muscle satellite cells began to adhere to the wall at 4 hours, while fibroblasts began to grow adherent to the wall, and the morphology of the cells began to take the shape of long fibers. When the adherent time is 8 hours, the equine skeletal muscle satellite cells start adherent growth, and the fibroblasts reach high confluence, and the result accords with the characteristic of long adherent time of the skeletal muscle satellite cells.
Example 4 identification of equine skeletal muscle satellite cells by RT-PCR
RNA was extracted from the skeletal muscle satellite cells cultured in example 1, and reverse-transcribed into cDNA, and corresponding primers were designed based on the specifically expressed genes Myod, Pax7, Desmin, wherein the primers used were as shown in Table 1. RT-PCR reaction System reuse is shown in Table 2, and the reaction conditions are shown in Table 3.
TABLE 1
| Serial number | Primer name | Sequence (5'to 3') |
| SEQ ID NO:1 | myod1-S | GAACCGCTACGATGGCACCTACTAC |
| SEQ ID NO:2 | myod1-A | CCACGATGCTAGACAGGCAGTCAAG |
| SEQ ID NO:3 | pax7-S | GTGCCCTCAGTGAGTTCGATTAGC |
| SEQ ID NO:4 | pax7-A | CTTGGCTTTATTCTCGCCGTCGT |
| SEQ ID NO:5 | desmin-S | GCCAAGCAGGCGATGATGGAGTAC |
| SEQ ID NO:6 | desmin-A | GTAGGACTGGATCTGGTGTCGGTAC |
The RT-PCR reaction system is shown in Table 2.
TABLE 2
TABLE 3
And performing gel electrophoresis on the RT-PCR product to run gel, as shown in FIG. 4, for amplifying DNA fragments of the specific expression genes Myod, Pax7 and Desmin, wherein the size of the DNA fragment of the amplified gene Myod is 92bp, the size of the DNA fragment of the gene Pax7 is 100bp, and the size of the DNA fragment of the gene Desmin is 80 bp. The specific expression genes Myod, Pax7 and Desmin are all positive expression, and the cells cultured in the embodiment 1 of the invention are equine skeletal muscle satellite cells.
Example 5 identification of horse skeletal muscle satellite cells by cellular immunofluorescence
The equine skeletal muscle satellite cells obtained from the culture of example 1 were fixed for 40min by adding 4% paraformaldehyde and washed once when the cells reached 70% -80% confluence. And incubating the membrane permeation solution at 4 ℃ overnight, washing once, and adding 2% BSA blocking solution for blocking for 1 h. Primary antibody (Pax7, Myod, Desmin) was diluted with blocking solution and incubated overnight at 4 deg.C and washed three times for ten minutes each. The secondary antibody was diluted with wash solution and incubated for 1h at room temperature, washed three times, ten minutes each time. And (4) diluting hoechst nuclei with a cleaning solution, dyeing for ten minutes, and cleaning once. The sections were observed under a fluorescent microscope and photographed. As shown in the immunofluorescence photograph of FIG. 5, the results showed that the specifically expressed antibodies Pax7, Myod and Desmin were positively expressed, and the cells cultured in example 1 of the present invention were equine skeletal muscle satellite cells.
Although the invention has been described in detail above with reference to a general description and specific examples, it will be apparent to one skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> university of inner Mongolia agriculture
<120> method for isolated culture of equine skeletal muscle satellite cells
<130>GG19720214A
<160>6
<170>SIPOSequenceListing 1.0
<210>1
<211>25
<212>DNA
<213>Artificial Sequence
<400>1
gaaccgctac gatggcacct actac 25
<210>2
<211>25
<212>DNA
<213>Artificial Sequence
<400>2
ccacgatgct agacaggcag tcaag 25
<210>3
<211>24
<212>DNA
<213>Artificial Sequence
<400>3
gtgccctcag tgagttcgat tagc 24
<210>4
<211>23
<212>DNA
<213>Artificial Sequence
<220>
Claims (8)
1. A method for separating and culturing equine skeletal muscle satellite cells is characterized by comprising the steps of sterilizing equine muscle masses, removing fat tissues and connective tissues, and crushing the equine muscle masses into massive muscle tissues;
digesting the massive muscle tissue by trypsin, and centrifugally separating to obtain a first supernatant and a first precipitate;
centrifuging the first supernatant to obtain a second supernatant and a second precipitate, discarding the second supernatant, re-suspending and centrifuging the second precipitate by using a proliferation culture solution to obtain a third supernatant and a third precipitate, discarding the third supernatant, suspending the proliferation culture solution of the third precipitate, passing through a cell filter, collecting a first filtrate, and centrifuging the first filtrate to obtain a fourth precipitate;
digesting the first precipitate by collagenase, passing the first precipitate through a cell filter to obtain a second filtrate, centrifuging the second filtrate to obtain a fourth supernatant and a fifth precipitate, further centrifuging the fourth supernatant to obtain a sixth precipitate, mixing the fifth precipitate and the sixth precipitate, suspending the mixture by a proliferation culture solution, and centrifuging the mixture to obtain a fifth supernatant and a seventh precipitate;
mixing the fourth precipitate suspension with the seventh precipitate suspension, and centrifuging to obtain a sixth supernatant and an eighth precipitate;
suspending the eighth precipitate with a proliferation culture solution, filtering by using a cell filter to obtain a third filtrate, and centrifuging the third filtrate to obtain a ninth precipitate, namely the equine skeletal muscle satellite cells;
and suspending the ninth precipitate with a proliferation culture solution, culturing, and purifying by a differential adherence method to obtain the purified equine skeletal muscle satellite cells.
2. The method for isolated culture of equine skeletal muscle satellite cells as claimed in claim 1,
the equine muscle mass is sterilized by 70% ethanol immersion.
3. The method for isolated culture of equine skeletal muscle satellite cells as claimed in claim 1,
before the equine muscle mass was comminuted, the equine muscle mass was rinsed with DPBS containing penicillin streptomycin until the DPBS was clear and bloodless.
4. The method for isolated culture of equine skeletal muscle satellite cells as claimed in claim 1,
the mass fraction of the trypsin is 0.25%.
5. The method for isolated culture of equine skeletal muscle satellite cells as claimed in claim 1,
the centrifugation process is 700rpm-2000rpm, and the centrifugation time is 5-15 min.
6. The method for isolated culture of equine skeletal muscle satellite cells as claimed in claim 1,
the first filtrate and the second filtrate both adopt 70-micron cell filters, and the third filtrate adopts a 40-micron filter.
7. The method for isolated culture of equine skeletal muscle satellite cells as claimed in claim 1,
the proliferation culture solution comprises the following raw materials in percentage by mass: 20% fetal bovine serum, 1% penicillin streptomycin and amphotericin B and the balance DMEM.
8. The method for isolated culture of equine skeletal muscle satellite cells as claimed in claim 1,
the collagenase is collagenase type IV, which is diluted to a concentration of 1mg/1mL by DMEM.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010015249.5A CN111004776A (en) | 2020-01-07 | 2020-01-07 | Method for separating and culturing equine skeletal muscle satellite cells |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010015249.5A CN111004776A (en) | 2020-01-07 | 2020-01-07 | Method for separating and culturing equine skeletal muscle satellite cells |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111004776A true CN111004776A (en) | 2020-04-14 |
Family
ID=70120635
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010015249.5A Pending CN111004776A (en) | 2020-01-07 | 2020-01-07 | Method for separating and culturing equine skeletal muscle satellite cells |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111004776A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112094806A (en) * | 2020-08-28 | 2020-12-18 | 内蒙古农业大学 | Method for improving adherent culture growth speed of equine skeletal muscle satellite cells and cell oxidative stress culture model |
| WO2022068029A1 (en) * | 2020-09-29 | 2022-04-07 | 中国肉类食品综合研究中心 | Special culture apparatus for 3d biological tissue, and method for preparing block-shaped cultured meat |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101886060A (en) * | 2010-07-20 | 2010-11-17 | 东北农业大学 | Methods for in vitro isolation and culture and induced differentiation of bovine muscle satellite cells |
| CN103160461A (en) * | 2013-04-08 | 2013-06-19 | 哈尔滨体育学院 | In-vitro separation culture method for skeleton satellite cells of excellent ice and snow athletes |
-
2020
- 2020-01-07 CN CN202010015249.5A patent/CN111004776A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101886060A (en) * | 2010-07-20 | 2010-11-17 | 东北农业大学 | Methods for in vitro isolation and culture and induced differentiation of bovine muscle satellite cells |
| CN103160461A (en) * | 2013-04-08 | 2013-06-19 | 哈尔滨体育学院 | In-vitro separation culture method for skeleton satellite cells of excellent ice and snow athletes |
Non-Patent Citations (3)
| Title |
|---|
| DEBOER ML等: "Cultured equine satellite cells as a model system to assess leucine stimulated protein synthesis in horse muscle", 《J ANIM SCI》 * |
| SOETA C等: "Isolation of Satellite Cells from Equine Skeletal Muscle", 《J EQUINE SCI》 * |
| 黄子莹 等: "lncRNA TCONS_00815878对猪骨骼肌卫星细胞分化的影响", 《遗传》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112094806A (en) * | 2020-08-28 | 2020-12-18 | 内蒙古农业大学 | Method for improving adherent culture growth speed of equine skeletal muscle satellite cells and cell oxidative stress culture model |
| WO2022068029A1 (en) * | 2020-09-29 | 2022-04-07 | 中国肉类食品综合研究中心 | Special culture apparatus for 3d biological tissue, and method for preparing block-shaped cultured meat |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107988153B (en) | Method for separating exosome from human umbilical cord blood mesenchymal stem cell source and used reagent | |
| CN105238751B (en) | Isolated culture method of umbilical cord tissue mesenchymal stem cells | |
| CN107746829B (en) | Method for separating and primary culturing dog placenta-derived mesenchymal stem cells | |
| CN114404441B (en) | Promoter for bone marrow mesenchymal stem cell osteogenic differentiation | |
| CN109136174B (en) | Stem cell-derived exosome preparation for delaying senescence | |
| CN106591224B (en) | Method for separating and purifying high-purity chicken precursor intramuscular fat cells and constructing coculture system of high-purity chicken precursor intramuscular fat cells and muscle satellite cells | |
| CN111004776A (en) | Method for separating and culturing equine skeletal muscle satellite cells | |
| CN113088487B (en) | Mesenchymal stem cell adipogenic transformation inhibitor | |
| CN110747159A (en) | Mouse or rat kidney fibroblast cell separation and subculture method | |
| CN107354130B (en) | Human placenta chorion mesenchymal stem cell separation method | |
| CN117511939A (en) | Application of cyclic RNA circRERE in promoting nerve regeneration and repairing central nerve injury | |
| CN110117570B (en) | Primary culture method of rheumatoid arthritis synovial fibroblasts | |
| KR20080004881A (en) | Method for preparing of mesenchymal stem cell by ultrasound treatment | |
| CN114874979A (en) | Separation and purification method of donkey skeletal muscle satellite cells | |
| CN115537389A (en) | Preparation method of umbilical cord mesenchymal stem cell source exosome with inflammation regulation function | |
| CN115558638A (en) | Exosome prepared from placenta mesenchymal stem cells and application thereof | |
| CN115786237A (en) | Method for establishing spontaneous immortalized tree shrew brain microvascular endothelial cell line | |
| CN109439614B (en) | Exosome preparation for maintaining and restoring hair papilla cell stem property | |
| CN114149977A (en) | Method for immortalizing mouse lung microvascular endothelial cells to obtain extracellular vesicles | |
| CN113528576A (en) | Recurrent grapevine patient specific induced pluripotent stem cell line containing NLRP7 pure and mutant and construction method thereof | |
| KR101738715B1 (en) | Method for derivation of pluripotent stem cells using plant stem cells or callus extracts, and pluripotent stem cells produced using the same | |
| CN111394301A (en) | Application of piceatannol in increasing number of secreted exosomes of pluripotent stem cells and bioactivity | |
| CN113652394B (en) | Method for in vitro separation of primary sperm cells of rats | |
| CN112126627B (en) | Construction method and application of canine corneal epithelial cell immortalized cell line | |
| CN114410688B (en) | Method for promoting iPSC to directionally differentiate into islet beta-like cells by lncRNA Peln1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200414 |
|
| RJ01 | Rejection of invention patent application after publication |