CN112126627B - Construction method and application of canine corneal epithelial cell immortalized cell line - Google Patents
Construction method and application of canine corneal epithelial cell immortalized cell line Download PDFInfo
- Publication number
- CN112126627B CN112126627B CN202011055337.4A CN202011055337A CN112126627B CN 112126627 B CN112126627 B CN 112126627B CN 202011055337 A CN202011055337 A CN 202011055337A CN 112126627 B CN112126627 B CN 112126627B
- Authority
- CN
- China
- Prior art keywords
- corneal epithelial
- canine
- cells
- immortalized
- epithelial cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0625—Epidermal cells, skin cells; Cells of the oral mucosa
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
- C12N2510/04—Immortalised cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/22011—Polyomaviridae, e.g. polyoma, SV40, JC
- C12N2710/22022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Dermatology (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the technical field of biology, and particularly relates to a construction method and application of a canine corneal epithelial cell immortalized cell line, which comprises the following steps: after anaesthetizing the experimental dog, collecting corneal tissues, collecting corneal epithelial tissues, and performing primary culture on epithelial cells; and (3) performing virus transfection carrying SV40T antigen genes on the purified primary canine corneal epithelial cells, and obtaining the immortalized canine corneal epithelial cells through single cloning. The cells established by the method of the invention are easy to culture, have quick proliferation, serum dependence and no tumor change, are beneficial to the in vitro research of the pathogenesis, the drug development and the disease prevention of the cornea-related diseases, and provide a basic material preparation method.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a construction method and application of a canine corneal epithelial cell immortalized cell line.
Background
Dogs, the most common companion animal, have been raised in number in recent years. Due to canities and the particularity of the anatomical structure of the eye, corneal diseases caused by trauma, fungi, bacteria, viruses and the like become common ophthalmic diseases. The corneal epithelial cell layer, which is the outermost layer of the cornea, is involved in the innate immune response, senses the presence of pathogens and signals the activation of the corneal defense system. In vitro culture of corneal epithelial cells is an extremely important means for studying corneal physiology, pathology, immunology, molecular biology and the like, and is commonly used for studying cell metabolites, pathogenic infection, and the influence of various growth factors and drugs on cell growth. Primary canine corneal epithelial cells (cCEpi) cultured in vitro are easy to age and limited in passage times, and living body sampling requires a large number of animals, so that animal welfare is reduced, and the requirements of in vitro research are difficult to meet. The SV40T antigen is randomly integrated into a host genome, and the expressed SV40T antigen can cause cell immortalization, which is one of the common methods for establishing immortalized cell lines at present. The technical method successfully establishes an Immortalized cell line (cCEpi-SV 40T) of canine corneal epithelial cells by transfecting SV40T, can stably express the biological characteristics of the cells after continuous passage, has no aging, has the characteristics of serum dependence and no tumor, can be used as canine corneal disease research or in vitro research such as drug screening, reduces the use of animals and improves the welfare of the animals.
Disclosure of Invention
In order to solve the technical problems, the invention provides a construction method and application of a canine corneal epithelial cell immortalized cell line, and the cells established by the method are easy to culture, have quick proliferation, serum dependence and no tumor change, and are beneficial to the in vitro research of corneal related disease pathogenesis, drug development and disease prevention and treatment.
In order to achieve the purpose, the invention provides the following technical scheme:
a construction method of a canine corneal epithelial cell immortalized cell line comprises the following steps:
anaesthetizing a test dog, collecting corneal tissue, collecting corneal epithelial tissue, and performing epithelial cell primary culture;
and (3) performing virus transfection carrying SV40T antigen genes on the purified primary canine corneal epithelial cells, and obtaining the immortalized canine corneal epithelial cells through single cloning.
Further, inoculating the immortalized canine corneal epithelial cells with bacteria, and detecting the mRNA expression quantity of IL-1 beta, IL-6, IL-8, TNF-alpha and TLR 2; the primer sequences are as follows:
further, the detection method comprises the following steps: the fluorescent quantitative reaction systems I and II are mixed in a 96-well plate, and are instantaneously separated at 4 ℃ after a sealing film is covered. Centrifuging, and reacting in a fluorescent quantitative PCR instrument under the following reaction conditions: reaction at 95 ℃ for 30s pre-denaturation → reaction at 95 ℃ for 10s → reaction at 60 ℃ for 30s for 40 cycles;
the cycle number of the genes of GAPDH, IL-1 beta, IL-6, IL-8, TNF-alpha and TLR2 when the fluorescence signal of the reactant reaches the threshold value is Ct value; calculating the gene expression amount by adopting a relative quantitative method, and taking GAPDH as an internal reference gene; by using 2 -ΔΔCT The Ct value of each gene is analyzed by the method, and the calculation formula of the relative expression quantity of the gene is 2 -ΔΔCt ；
Wherein Δ Δ Ct ═ is (average Ct value of target gene of sample to be tested-average Ct value of GAPDH of sample to be tested) - (average Ct value of target gene of control sample-average Ct value of GAPDH of control sample);
fluorescent quantitative PCR reaction system I:
and (3) a fluorescent quantitative PCR reaction system II:
further, the cultured primary canine corneal epithelial cells, different generation immortalized canine corneal epithelial cells and 293T cells are respectively taken, and the following primers are adopted to carry out SV40T detection;
an upstream primer: AGTGGCTGGGCTGTTCTTTT, respectively;
a downstream primer: ATGGGAGCAGTGGTGGAATG are provided.
5. The method for constructing the canine corneal epithelial cell immortalized cell line according to claim 1, wherein 3 days before sampling, the periphery of the eye of the experimental dog is shaved, the eye is spotted with the eye drops of chloramphenicol for two eyes 4 times a day, 1 hour before sampling, the experimental dog is intravenous-titrated with mannitol, and the mannitol is used in an amount of 1g/kg body weight.
Furthermore, during sampling, the experimental dog adopts inhalation anesthesia and retrobulbar anesthesia, the anesthetized dog is kept on the side on an operating table, the operating eye faces upwards, and the iris surface of the sampling eye is ensured to be parallel to the operating table surface.
Furthermore, before sampling, the conjunctival sac and the eyelids are washed by sodium lactate ringer injection.
Further, the method for collecting the corneal tissue comprises the following steps: under an ophthalmic microscope, corneal tissue with the thickness of 280-320 mu m is collected and placed in a centrifuge tube of 3mL of preheated culture medium, and the corneal tissue is immediately transferred to a super clean bench.
Further, after collecting corneal tissue, washing the corneal tissue with preheated PBS containing 1 Xdouble antibody, cutting the corneal tissue into small pieces, putting into 3mL of 1.2IU/mL of Dispase II enzyme, and digesting for 45min at 37 ℃; after digestion is finished, centrifuging for 5min at 1000r/min, removing digestive juice, adding 3mL of preheating culture medium, transferring to a sterile dish, and stripping the epithelium and the stroma under an ophthalmic microscope; collecting the stripped epithelial tissue, washing with PBS for 3 times, centrifuging, discarding PBS, aseptically shearing, inoculating cell bottle, standing for 24 hr, and changing the solution; the solution was changed 1 time every two days thereafter, and the cells were confluent for about 1 week.
Further, the virus transfection method carrying the SV40T antigen gene comprises the following steps: removing original culture medium of primary canine corneal epithelial cells, washing with PBS for 3 times, and adding diluted virus liquid carrying SV40T antigen gene; adding polybrene according to the concentration of 4 mu g/mL, 1200g, and centrifuging for 1h at 37 ℃; after centrifugation, after static culture for 48h in a cell culture box at 37 ℃, the culture medium is replaced, and then liquid replacement and passage are carried out according to the growth condition of cells; after approximately 7 days of culture, the detached cells were digested with 0.25% trypsin-0.02% EDTA; digestion was stopped with DMEM/F12 complete medium, the suspension cells were aspirated and counted to a cell density of 5/mL, and 200 μ L/well of cell suspension was added to a 96-well plate so that each well contained 1 cell, and observed after one week of culture.
Further, when the corneal epithelial cells grew to 50%, they were transferred to a 24-well plate and cultured, and immortalized canine corneal epithelial cells were obtained by single cloning.
Further, primary canine corneal epithelial cells were transfected with viruses carrying the SV40T antigen gene at a multiplicity of transfections with MOI ═ 1: 20.
The invention also provides application of the method in research and development of cornea-related disease drugs.
The technical scheme provided by the invention realizes the following beneficial effects:
the technical method successfully establishes the immortalized cell line of the canine corneal epithelial cells by transfecting the SV40T, can stably express the biological characteristics of the cells after continuous passage, has no aging, has the characteristics of serum dependence and no tumor, can be used for canine corneal disease research or in vitro research such as drug screening and the like, reduces the use of animals and improves the animal welfare.
The dog immortalized corneal epithelial cell line is established by introducing exogenous genes into the dog corneal epithelial cells for the first time, and the current situation that the cell line is lacked in the current pet-related disease research is improved; secondly, the immortalized cell line reduces the using amount of dogs and improves the welfare of animals; thirdly, the cells established by the method are easy to culture, have quick proliferation, serum dependence and no tumor change, are beneficial to the in vitro research of the pathogenesis, the drug development and the disease prevention and treatment of the cornea-related diseases, and provide a basic material preparation method.
Drawings
FIG. 1SV40T gene detection and morphology features of immortalized canine corneal epithelial cells of different generations. (A) SV40T gene detection results. 293T: positive control, known to express SV 40T. P2 cepi: primary canine corneal epithelial cells were not transfected. P5, 10, 20, 30cCEpi-SV 40T: canine corneal epithelial cells after different generations of transfection. (B) Immortalized canine corneal epithelial cell morphology at passage 10 (40 ×). (C) Immortalized canine corneal epithelial cell morphology at passage 20 (40 ×). (D) Immortalized canine corneal epithelial cell morphology at passage 30 (40 ×). (E) Immortalized canine corneal epithelial cell morphology at passage 40 (40 ×).
FIG. 2 results of immunofluorescence assay for cytokeratin 12 (200 ×)
FIG. 3 Primary and immortalized canine corneal epithelial cell growth curves
Note: "x" indicates very significant difference compared to the cecepi group (p < 0.01).
FIG. 4 cell growth cycle results
Note: "x" indicates that the difference was very significant compared to the cepi group (p < 0.01).
FIG. 5 serum dependence analysis
Note: "+" indicates a significant difference (0.01< p <0.05) compared to the 0% group, "+" indicates a significant difference (p <0.01) compared to the 0% group; "#" indicates a significant difference (0.01< p <0.05) compared to the 20% group, and "# #" indicates a significant difference (p <0.01) compared to the 20% group.
FIG. 6 expression of immortalized canine corneal epithelial cell-associated inflammatory factors following Staphylococcus pseudointermedius inoculation
Note: "x" indicates significant difference compared to control group (0.01< p < 0.05); "x" indicates that the difference was very significant compared to the control group (p < 0.01).
Detailed Description
Example 1
1. Material
1.1 test tissue
Cornea of 1-year-old healthy beagle dog
1.2 Primary reagents
Simian vacuolating virus 40(SV40T) antigen gene virus liquid (stored in a laboratory); DMEM/F12 medium (Sigma, USA); endotoxin-free fetal bovine serum (Lonsera, china); trypsin (Amresco, usa); collagenase type II (Sigma, usa); type II neutral protease (Sigma company, usa); L-Glutamine (Sigma, USA); epidermal growth factor (Sigma, usa); HEPES buffer (Gibco, usa); cytokeratin 12 monoclonal antibody (Abcam, usa); reverse transcription kit, dye-based quantitative PCR assay kit (Vazyme, China); goat anti-rabbit secondary antibody (Abcam, usa); CCK-8 assay kit (Vazyme, China), etc.
1.3 Main instrumentation
Carbon dioxide incubator (Thermo, usa); ultra pure water systems (Millipore, usa); biomicroscopes (Olympus CX22, japan); clean bench (suzhou clean equipment limited); refrigerated centrifuge (Eppendorf, germany); ultra-low temperature refrigerators (Eppendorf, germany); PCR instrument (BioRad, usa); real-time fluorescent quantitative PCR system (BioRad, usa); a micro nucleic acid protein concentration meter (Thermo corporation, usa); ultra-high resolution confocal laser microscopy (Leica, Germany); autoclave (TOMY corporation, japan); PCR machine (BioRad, USA).
2. Test method
2.1 construction of immortalized canine corneal epithelial cell line
2.1.1 Primary culture of Canine corneal epithelial cells
The test dogs were shaved around the eyes 3 days before sampling, the eye drops of chloramphenicol were applied to the eyes 4 times a day, and mannitol (1g/kg body weight) was added to the test dogs in the first 1 h. During sampling, the experimental dog adopts inhalation anesthesia and retrobulbar anesthesia, the anesthetized dog is kept on the side on an operating table, and the operating eye faces upwards so as to ensure that the iris surface of the sampling eye is parallel to the operating table top. Adopting sodium lactate ringer containing 1 Xdouble antibiotics to wash conjunctival sac and disinfect inside eyelid, and normally disinfecting eye periphery. Corneal tissue with a thickness of about 300 μm was collected under an ophthalmic microscope, placed in a centrifuge tube of 3mL of pre-warmed medium, and immediately transferred to a super clean bench. The corneal tissue was rinsed with pre-warmed PBS containing 1 Xdouble antibody, then cut into small pieces with sterile corneal scissors, placed in 3mL,1.2IU/mL Dispase II enzyme, and digested for 45min at 37 ℃. Centrifuging for 5min at 1000r/min after digestion is finished, discarding digestive juice, adding 3mL of preheating culture medium, and transferring to sterile dish. Under an ophthalmic microscope, the epithelium is aseptically peeled off the stroma. And (3) collecting the stripped epithelial tissue, washing with PBS (phosphate buffer solution) for 3 times, centrifuging, discarding the PBS, performing aseptic shearing, inoculating a cell bottle, performing static culture for 24 hours, and then changing the liquid. The cells were confluent about 1 week after every two days fluid changes.
2.1.2 immortalization of Canine corneal epithelial cells
The primary canine corneal epithelial cells in good state after purification are treated according to the method 10 5 6 wells for inoculationPlates, incubate overnight. Viruses carrying the SV40T antigen gene were diluted with complete medium at a multiplicity of infection MOI of 1: 20. Original culture medium of primary canine corneal epithelial cells is removed, PBS is used for washing for 3 times, and diluted SV40T virus solution is added. Polybrene was added at a concentration of 4. mu.g/mL, 1200g, and centrifuged at 37 ℃ for 1 hour. And (4) after centrifugation, placing the cell culture box in a 37 ℃ for static culture, after infection for 48 hours, replacing a fresh culture medium, and then replacing the culture medium and carrying out passage according to the growth condition of the cells. After approximately 7 days of culture, the digested cells were detached with 0.25% trypsin-0.02% EDTA. The digestion was stopped with DMEM/F12 complete medium, the suspension cells were aspirated and counted to a cell density of 5/mL, 200 μ L/well of the cell suspension was added to a 96-well plate so that each well contained 1 cell, and observed after one week of culture. If the corneal epithelial cells grow to 50%, the cells are transferred to a 24-well plate to continue culturing, and the immortalized canine corneal epithelial cells are obtained by monocloning.
2.1.3 Canine corneal epithelial cell SV40T assay
And (3) respectively taking the cultured primary canine corneal epithelial cells, different generation immortalized canine corneal epithelial cells and 293T cells, and adopting the primers in the table 1 to carry out SV40T detection.
TABLE 1 primer sequences
2.1.4 dog corneal epithelial cell identification
(1) Fixing: taking primary canine corneal epithelial cells and 5 th, 10 th, 20 th, 30 th and 40 th generation immortalized canine corneal epithelial cells, and performing primary treatment on the primary canine corneal epithelial cells and the immortalized canine corneal epithelial cells at a ratio of 1 × 10 5 The cells are inoculated in 24-well culture plates with cell slide at a density of one cell/mL, and after the cells grow to 80% confluence, the cells are washed by precooled PBS and fixed by adding 4% paraformaldehyde at room temperature for 30 min.
(2) Membrane permeation: the fixative was discarded, washed 3 times with PBS for 5min each, and the membrane was incubated with 0.3% Triton X-100 for 15min at room temperature to allow permeation.
(3) And (3) sealing: the membrane-permeabilizing solution was discarded and blocked with 5% bovine serum albumin for 1h at room temperature.
(4) Antibody incubation: blocking solution was discarded, CK12 primary antibody was added and incubated at room temperature for 1h, and the negative control group replaced CK12 primary antibody with an equal amount of PBS. After washing with PBS, cells were incubated with fluorescently labeled secondary antibody for 1h at room temperature in the dark.
(5) Dyeing the core: the secondary antibody was discarded, washed 3 times with PBS, and nuclei were stained with DAPI stain for 15 min.
(6) And (3) sealing: the DAPI stain was discarded and washed 3 times with PBS. And (3) placing the cell slide on a glass slide on which an anti-fluorescence quenching sealing solution is dripped, and sealing the slide.
(7) Shooting: and observing under a laser confocal microscope, and taking and storing photos.
2.1.5 Canine corneal epithelial cell proliferation assay
Cell growth curves were plotted by the CCK-8 assay. According to 5X 10 2 Cell density per well cells were seeded in 96-well plates and cultured continuously for 7 days. After 24h of cell culture, a row of 6 wells was discarded of medium, washed 3 times with PBS, 100. mu.L of basal medium and 10. mu.L of CCK-8 reagent was added to each well, and cultured in an incubator at 37 ℃ for 2 h. The absorbance values were measured at a wavelength of 450nm with a microplate reader and cell growth curves were plotted.
2.1.6 analysis of canine corneal epithelial cell cycle and ploidy
(1) The 2 nd generation primary canine corneal epithelial cells and the 30 th generation immortalized canine corneal epithelial cells are arranged according to the proportion of 1 multiplied by 10 6 Concentration inoculation dish.
(2) After the cells were more than 80% confluent, the cells were washed 3 times with PBS. The digested cells were detached with 0.25% trypsin-0.02% EDTA and digested at 37 ℃ for 3-5 min.
(3) The digestion is stopped by complete culture medium, cells are collected by aspiration, and the cells are centrifuged for 5min at 1200 r/min.
(4) Discard the supernatant, add 1mL precooled PBS to resuspend the cells, move the cell suspension to a new EP tube, centrifuge for 5min at 1200 r/min.
(5) Discarding the supernatant, adding 1mL of precooled 70% ethanol, uniformly blowing, and fixing at 4 ℃ for 12-24 h.
(6) The fixed cell suspension is centrifuged for 5min at 1200 r/min.
(7) The supernatant was discarded, 1mL of precooled PBS was added to resuspend the cells, and the cell suspension was centrifuged at 1200r/min for 5 min.
(8) Discard the supernatant, add 0.5mL propidium iodide staining solution into each tube, slowly and fully resuspend the cells, incubate at 37 ℃ for 30min in the dark, and store at 4 ℃. (200 mesh Filter for cell before detection)
(9) Data analysis was performed by flow cytometry to detect red fluorescence at 488nm wavelength.
(10) The DNA ploidy analysis formula is that DI (sample G0/G1 peak mean fluorescence intensity)/(normal diploid G0/G1 peak mean fluorescence intensity)
The determination standard is that the DI is 2.0 plus or minus 0.1, and the tetraploid is determined; the near diploid is judged if DI is 1.1 +/-0.15; d1 was judged as diploid when it was 1.0 ± 0.1.
2.1.7 Canine corneal epithelial cell serum-dependent assay
2 nd generation primary canine corneal epithelial cells and 30 generation immortalized canine corneal epithelial cells are mixed according to the proportion of 2 multiplied by 10 3 Inoculating 96-well plates per well, culturing for 12h, replacing the culture medium with DMEM/F12 culture medium containing 0%, 5%, 10% and 20% fetal bovine serum after the cells are completely attached, repeating each concentration for 3 times, and using the culture medium containing different concentrations of serum as blank control. After further incubation for 24h, 10. mu.L of CCK-8 reagent was added to each well and incubated in an incubator at 37 ℃ for 2 h. The absorbance values were measured at a wavelength of 450nm with a microplate reader and plotted as a bar graph.
2.2 construction of model of inflammation of canine corneal epithelial cells infected by Staphylococcus pseudointermedius
2.2.1 bacterial culture and enumeration
And (3) recovering the cryopreserved bacterial liquid of the staphylococcus pseudointermedius, and carrying out passage by adopting a 3-zone streaking method. And picking a single colony to shake culture in a nutrient broth culture medium. Collecting bacterial liquid, centrifuging at 4000r/min for 5min, discarding supernatant, repeating twice, diluting by multiple times, counting by plate counting method, and adjusting bacterial liquid concentration to 10 6 CFU/mL。
2.2.2 cell treatment
Immortalized canine corneal epithelial cells according to 10 6 cells/well inoculated 6-well culture plate, after the cells grow to more than 80%, PBS washed 3 times, serum-free medium was replaced, and experimental groups were performed according to MOI 1: 1 adding the staphylococcus pseudointermedium to continue culturing for 3 hours.
2.2.3 primer design
Relevant primers were designed for the mRNA sequences of canine GAPDH, IL-1 β, IL-6, IL-8, TNF- α and TLR2, and the primer information was as follows:
TABLE 2 primer sequences
2.2.4 Total RNA extraction from cells
(1) After cell treatment, the culture medium is discarded and washed 3 times with PBS, lmL Trizol is added into each hole, the cells are blown and beaten, and after the cells are dissolved, the cells are respectively collected in a 1.5mL enzyme-free centrifuge tube and are kept stand for 5 min.
(2) Adding 0.2mL of chloroform into the centrifuge tube, oscillating for 30s, and standing for 5min after full emulsification and no phase separation.
(3) Centrifuge at 12000r/min for 15min at 4 deg.C, and transfer 400. mu.L of supernatant into a new 1.5mL centrifuge tube.
(4) Add 400. mu.L of isopropanol, mix the tube liquid gently, and let stand at room temperature for 10 min.
(5) Centrifuging at 12000r/min at 4 deg.C for 10min, and discarding supernatant.
(6) Adding 1mL of 75% ethanol, gently washing the precipitate, centrifuging at 4 ℃ and 12000r/min for 5min, and removing the supernatant.
(7) Drying at room temperature for 5min, and dissolving with appropriate amount of RNase-free water.
(8) The dissolved RNA was taken out and the concentration was measured, and the RNA concentration was adjusted to 900 ng/. mu.L and stored at-80 ℃ for further use.
2.2.5cDNA Synthesis
The reverse transcription operation is carried out by adopting a two-step method according to the instruction of a kit.
(1) Reaction system for removing DNA genome
And lightly blowing and beating the mixture by using a pipettor, and then placing the centrifuge tube filled with the mixture into a PCR instrument for reaction. The reaction conditions were 42 ℃ for 2min → 4 ℃ stop.
(2) Reverse transcription reaction system
And lightly blowing and stirring the mixture by using a pipettor, and placing the centrifuge tube filled with the mixture into a PCR instrument for reaction. The reaction conditions are 50 ℃ for 15min → 85 ℃ for 2min → 4 ℃ for termination.
2.2.6 fluorescent quantitation PCR detection of related inflammatory factors
(1) Fluorescent quantitative PCR reaction system I
(2) Fluorescent quantitative PCR reaction system II
The reaction systems I and II were mixed in a 96-well plate, covered with a sealing film and instantaneously separated at 4 ℃. Centrifuging and placing the mixture into a fluorescent quantitative PCR instrument for reaction under the following reaction conditions: reaction at 95 ℃ for 30s pre-denaturation → 95 ℃ for 10s → 60 ℃ for 30s for 40 cycles.
The number of cycles of the genes GAPDH, IL-1 beta, IL-6, IL-8, TNF-alpha and TLR2 when the fluorescence signal of their reactants reached the threshold value is the Ct value. The gene expression level of this test was calculated by a relative quantitative method, and GAPDH was used as an internal reference gene. By using 2 -ΔΔCT The method analyzes the Ct value of each gene, and the calculation formula of the relative expression quantity of the gene is 2 -ΔΔCt 。
Wherein, the delta Ct is (average Ct value of target gene of sample to be detected-average Ct value of GAPDH of sample to be detected) - (average Ct value of target gene of control sample-average Ct value of GAPDH of control sample).
2.3 data processing and analysis
The experimental data were statistically analyzed using One-way ANOVA and Duncan in SPSS 18.0 software and the results are expressed as Mean ± SEM. p <0.05 indicates significant difference, and p <0.01 indicates significant difference.
3. Results
3.1.1 Canine corneal epithelial cell immortalization establishment and characterization thereof
In the experiment, the SV40T transfection method is adopted to immortalize canine corneal epithelial cells, the expression of SV40T is not found in primary canine corneal epithelial cells, and the SV40T gene can be detected in different generations of immortalized canine corneal epithelial cells and 293T cells (figure 1A), so that the result shows that the SV40T gene is successfully transferred into the canine corneal epithelial cells and can be stably expressed along with cell passage. The immortalized canine corneal epithelial cells did not undergo morphological changes during the serial passages, and maintained cobblestone morphology at all times (fig. 1B, C, D, E).
3.1.2 dog corneal epithelial cell identification results
Selecting primary canine corneal epithelial cells and different generations of immortalized corneal epithelial cells, and carrying out keratin 12 detection, wherein the immunofluorescence result is shown in figure 2. Thus, in primary corneal epithelial cells and 5 th, 10 th, 20 th, 30 th and 40 th generation immortalized corneal epithelial cells, keratin 12 is obviously expressed; keratin 12 expression was not seen in the negative control group.
3.1.3 dog corneal epithelial cell growth Curve analysis
As can be seen from FIG. 3, the primary canine corneal epithelial cells and the immortalized canine corneal epithelial cells were cultured continuously for 7 days, and then the cells entered the plateau phase after the cells were in the latent phase at 1d-2d and in the logarithmic growth phase at 3d-5 d. Starting at 3d, immortalized cells are more active than primary cells. The result shows that the immortalized canine corneal epithelial cells have normal proliferation capacity in the in vitro culture process and are better than primary cells (p is less than 0.01).
3.1.4 Canine corneal epithelial cell cycle, ploidy analysis
The results of the cell cycle are shown in FIG. 4. As can be seen from the results, the cells of the 2 nd generation primary canine corneal epithelial cells in the G0/G1 phase are obviously more than those of the 30 generation immortalized canine corneal epithelial cells, and the difference is extremely obvious (p < 0.01); the cells of the 2 nd generation primary canine corneal epithelial cells in the S phase are obviously less than those of the 30 th generation immortalized canine corneal epithelial cells, and the difference between the two is very obvious (p is less than 0.01). The immortalized canine corneal epithelial cells are shown to have higher proliferative activity compared to primary cells.
According to flow type results, the average fluorescence intensity value of the peak in G0/G1 phase of the 2 nd generation primary canine corneal epithelial cell is 48972.43, and the average fluorescence intensity value of the peak in G0/G1 phase of the 30 th generation immortalized canine corneal epithelial cell is 50083.31.
Immortalized epithelial cells are therefore judged to be diploid, 0.9 < DI ═ 1.023 < 1.1.
3.1.5 Canine corneal epithelial cell serum-dependent assay
The cells with canceration lose serum dependency in the in vitro passage process, and in order to identify that the immortalized canine corneal epithelial cells introduced with SV40T have not cancerated, the experiment adopted different serum concentrations to culture the cells, and the results are shown in fig. 5: neither primary nor immortalized cells grew normally in the absence of serum; the cells can proliferate at serum concentrations of 5%, 10%, and 20%. And the proliferation promoting capacity of 20% serum is obviously higher than that of 5% serum concentration (0.01< p <0.05), so that the immortalized canine corneal epithelial cells still keep serum dependency in the in vitro passage process, and the immortalized canine corneal epithelial cells are not cancerated after the SV40T gene is introduced.
3.2 expression of immortalized canine corneal epithelial cell-associated inflammatory factor
As shown in fig. 6, immortalized canine corneal epithelial cells were cultured according to MOI ═ 1: 1, after inoculating staphylococcus pseudointermedius, culturing for 3h, compared with a blank control group, the mRNA expression levels of IL-1 beta, IL-6, IL-8 and TNF-alpha in a model group are all remarkably increased (p is less than 0.01), and the mRNA expression level of TLR2 is remarkably increased (p is less than 0.05).
Claims (8)
1. A construction method of a canine corneal epithelial cell immortalized cell line is characterized by comprising the following steps:
anaesthetizing an experimental dog, collecting corneal tissue, collecting corneal epithelial tissue, and performing epithelial cell primary culture;
carrying out virus transfection carrying SV40T antigen gene on the purified primary canine corneal epithelial cells, and obtaining immortalized canine corneal epithelial cells by monoclonal;
the virus transfection method carrying the SV40T antigen gene comprises the following steps: removing original culture medium of primary canine corneal epithelial cells, washing with PBS for 3 times, and adding diluted virus liquid carrying SV40T antigen gene; adding polybrene according to the concentration of 4 mu g/mL, 1200g, and centrifuging for 1h at 37 ℃; after centrifugation, after static culture for 48h in a cell culture box at 37 ℃, the culture medium is replaced, and then liquid replacement and passage are carried out according to the growth condition of cells; after approximately 7 days of culture, the detached cells were digested with 0.25% trypsin-0.02% EDTA; stopping digestion by using a DMEM/F12 complete culture medium, blowing and beating suspended cells, counting the suspended cells to enable the cell density to be 5/mL, adding 200 mu L/hole of cell suspension into a 96-well plate to enable each hole to contain 1 cell, and observing after culturing for one week;
inoculating bacteria to the immortalized canine corneal epithelial cells, and detecting the mRNA expression quantity of IL-1 beta, IL-6, IL-8, TNF-alpha and TLR 2; the primer sequences are as follows:
2. the method for constructing the canine corneal epithelial cell immortalized cell line according to claim 1, wherein the detection method comprises the following steps: mixing the fluorescent quantitative reaction systems I and II in a 96-well plate, covering a sealing film, and then instantaneously separating at 4 ℃; centrifuging, and reacting in a fluorescent quantitative PCR instrument under the following reaction conditions: reaction at 95 ℃ for 30s of pre-denaturation → 95 ℃ for 10s → 60 ℃ for 30s for 40 cycles;
the cycle number of the genes of GAPDH, IL-1 beta, IL-6, IL-8, TNF-alpha and TLR2 when the fluorescence signal of the reactant reaches a threshold value is Ct value; calculating the gene expression amount by adopting a relative quantitative method, and taking GAPDH as an internal reference gene; by means of 2 -ΔΔCT The method analyzes the Ct value of each gene, and the calculation formula of the relative expression quantity of the gene is 2 -ΔΔCt ；
Wherein Δ Δ Ct ═ is (average Ct value of target gene of sample to be tested-average Ct value of GAPDH of sample to be tested) - (average Ct value of target gene of control sample-average Ct value of GAPDH of control sample);
fluorescent quantitative PCR reaction system I:
volume of reaction solution
2×ChamQ SYBR qPCR Master Mix 5μL
Template cDNA 2. mu.L
And (3) a fluorescent quantitative PCR reaction system II:
3. the method for constructing the canine corneal epithelial cell immortalized cell line according to claim 1, wherein the cultured primary canine corneal epithelial cells, different generation immortalized canine corneal epithelial cells and 293T cells are respectively used for SV40T detection by the following primers;
an upstream primer: AGTGGCTGGGCTGTTCTTTT;
a downstream primer: ATGGGAGCAGTGGTGGAATG are provided.
4. The method for constructing the canine corneal epithelial cell immortalized cell line according to claim 1, wherein 3 days before sampling, the periphery of the eye of the experimental dog is shaved, the eye is spotted with the eye drops of chloramphenicol for two eyes 4 times a day, 1 hour before sampling, the experimental dog is intravenous-titrated with mannitol, and the mannitol is used in an amount of 1g/kg body weight.
5. The method for constructing an immortalized cell line of canine corneal epithelial cells according to claim 1, wherein the method for collecting corneal tissue comprises: under an ophthalmic microscope, corneal tissue with the thickness of 280-320 mu m is collected and placed in a centrifuge tube of 3mL pre-heated culture medium, and the corneal tissue is immediately transferred to a super-clean bench.
6. The method for constructing the canine corneal epithelial cell immortalized cell line according to claim 1, wherein after the corneal tissue is collected, the corneal tissue is washed with preheated PBS containing 1 Xdouble antibody, and then cut into small pieces and digested in Dispase II enzyme of 3mL and 1.2IU/mL for 45min at 37 ℃; after digestion is finished, centrifuging for 5min at 1000r/min, removing digestive juice, adding 3mL of preheating culture medium, transferring to sterile dish, and peeling epithelium and stroma under an ophthalmic microscope; collecting the stripped epithelial tissue, washing with PBS for 3 times, centrifuging, discarding PBS, aseptically shearing, inoculating cell bottle, standing and culturing for 24h, and changing the solution; the cells were confluent about 1 week after 1 fluid change every two days.
7. The method for constructing an immortalized cell line of canine corneal epithelial cells according to claim 1, wherein the immortalized canine corneal epithelial cells are obtained by single cloning by transferring to a 24-well plate for further culture when the corneal epithelial cells have grown to 50%.
8. The method for constructing the canine corneal epithelial cell immortalized cell line according to claim 1, wherein the virus carrying the SV40T antigen gene is transfected into primary canine corneal epithelial cells by using the transfection complex number of MOI 1: 20.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011055337.4A CN112126627B (en) | 2020-09-30 | 2020-09-30 | Construction method and application of canine corneal epithelial cell immortalized cell line |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011055337.4A CN112126627B (en) | 2020-09-30 | 2020-09-30 | Construction method and application of canine corneal epithelial cell immortalized cell line |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112126627A CN112126627A (en) | 2020-12-25 |
| CN112126627B true CN112126627B (en) | 2022-08-19 |
Family
ID=73843232
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011055337.4A Active CN112126627B (en) | 2020-09-30 | 2020-09-30 | Construction method and application of canine corneal epithelial cell immortalized cell line |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112126627B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105779395A (en) * | 2016-03-22 | 2016-07-20 | 西北农林科技大学 | Immortalized canine adipic mesenchymal stem cell line and constructing method thereof |
| CN107881197A (en) * | 2017-11-17 | 2018-04-06 | 扬州大学 | One kind immortalizes cow rumen epithelial cell line and its construction method |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0851028B1 (en) * | 1996-12-24 | 2006-12-06 | Societe Des Produits Nestle S.A. | Immortalized human epithelial cell line from cornea |
| US6458593B1 (en) * | 1999-01-21 | 2002-10-01 | Vitro Diagnostics, Inc. | Immortalized cell lines and methods of making the same |
| WO2012065067A2 (en) * | 2010-11-12 | 2012-05-18 | Georgetown University | Immortalization of epithelial cells and methods of use |
| CN104531607B (en) * | 2014-12-29 | 2017-11-07 | 南京农业大学 | The primary bronchiole epithelial cell of dog and its application in immortalized cells is prepared |
-
2020
- 2020-09-30 CN CN202011055337.4A patent/CN112126627B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105779395A (en) * | 2016-03-22 | 2016-07-20 | 西北农林科技大学 | Immortalized canine adipic mesenchymal stem cell line and constructing method thereof |
| CN107881197A (en) * | 2017-11-17 | 2018-04-06 | 扬州大学 | One kind immortalizes cow rumen epithelial cell line and its construction method |
Non-Patent Citations (2)
| Title |
|---|
| Canine corneal epithelial cells possess a sustained proliferative capacity and generate a spontaneously derived cell line;Morita, M等;《EXPERIMENTAL EYE RESEARCH》;20180630;第171卷;第7页右栏第2段、第8页左栏第3段、2.2部分 * |
| 犬穿透性角膜移植手术方法的研究;吴艳菊等;《黑龙江畜牧兽医》;20181220(第24期);1.1-1.5部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112126627A (en) | 2020-12-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| IBARAKI et al. | Human lens epithelial cell line | |
| CN112574946B (en) | Primary isolated culture method for constructing fibroblast cells from multiple tissues of terrapin and immortalization of fibroblast cells | |
| Lorenzo et al. | Generation of mouse and human induced pluripotent stem cells (iPSC) from primary somatic cells | |
| US20220154139A1 (en) | YAP1 Gene-Modified Mesenchymal Stem Cell and Preparation Method Thereof | |
| CN114292816A (en) | Lung cancer organoid culture solution, and culture reagent combination and culture method thereof | |
| CN112143708B (en) | Umbilical cord mesenchymal stem cells, stem cell essence factor and application thereof in aspect of resisting skin aging | |
| CN108504625A (en) | A kind of l cell and application thereof | |
| CN111718995B (en) | Biomarker for nasopharyngeal carcinoma metastasis diagnosis and/or prognosis evaluation | |
| CN112029717B (en) | Serum-free in vitro domestication culture of human mesenchymal stem cells | |
| CN107446883B (en) | Mutual proliferation promoting effect of Treg cells and myocardial fibroblasts during co-culture | |
| CN112126627B (en) | Construction method and application of canine corneal epithelial cell immortalized cell line | |
| US20090047738A1 (en) | Feeder cell derived from tissue stem cell | |
| CN108624553B (en) | Medaka muscle cell line | |
| CN115651887A (en) | Application of human normal corneal epithelial cells | |
| CN113817777B (en) | Congenital giant black nevus benign tumor cell line from human and construction method thereof | |
| CN111925985B (en) | Domestication culture method of mesenchymal stem cells | |
| Catanuto et al. | Mouse retinal pigmented epithelial cell lines retain their phenotypic characteristics after transfection with human papilloma virus: a new tool to further the study of RPE biology | |
| CN114149977A (en) | Method for immortalizing mouse lung microvascular endothelial cells to obtain extracellular vesicles | |
| CN113528576A (en) | Recurrent grapevine patient specific induced pluripotent stem cell line containing NLRP7 pure and mutant and construction method thereof | |
| CN111269940A (en) | Method for directly transdifferentiating mesenchymal stem cells into sperms by using transcription factor FOXO1 | |
| CN108441475B (en) | Method for culturing mesonasal concha-derived olfactory ensheathing cells | |
| CN112029718B (en) | Method for serum-free domestication culture of mesenchymal stem cells and culture medium used by same | |
| CN115161285B (en) | Immortalized Holstein male calf small intestine epithelial cell line and construction method and application thereof | |
| CN117417964A (en) | Sheep mammary gland epithelial cell line and construction method and application thereof | |
| CN111549033B (en) | Lentiviral-infected human epidermal keratinocyte strain and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |